Bioinformatics Analysis of NprR-NprX Quorum-Sensing System of Bacillus thuringiensis Isolates from the Papaloapan Region, Oaxaca-Mexico

Abstract

Quorum sensing is a chemical communication process that bacteria use to regulate collective behaviors. In Gram-positive bacteria, oligopeptides (called autoinducers) are the signaling molecules to elicit quorum sensing. In Bacillus thuringiensis, NprR is a transcriptional regulator whose activity depends on the NprX signalling peptide. Bacillus thuringiensis is closely related to Bacillus cereus and Bacillus anthracis. The principal difference between them is that Bacillus thuringiensis is the only one that produced Cry protein. The aim of this study is to explore the relation of nprR and 16S rRNA genes in Bacillus thurin-giensis. Phylogenetic trees of nucleotide sequences of nprR and 16S rRNA genes were built. Sequences of fourteen new isolates from Papaloapan region were included in those phylo-genetic trees. In order to identify the isolates, a simple and fast methodology considering the Cry protein formation was used. The 16S rRNA phylogenetic tree allows identify eight isolates as Bacillus thuringiensis and the others as Bacillus spp. The nprR phylogenetic tree does not match with the 16S rRNA phylogenetic tree. This confirms that nprR is not a molecular marker for evolution. Most of the new isolates have the same NprR sequence (WTSDIVG). However, the SKPDIVG is the most common NprR sequence in thuringiensis species.

Share and Cite:

Bravo-D, H. , Cruz-Nolasco, A. , Gutiérrez-Lucas, L. and Navarro-Mtz, A. (2015) Bioinformatics Analysis of NprR-NprX Quorum-Sensing System of Bacillus thuringiensis Isolates from the Papaloapan Region, Oaxaca-Mexico. Advances in Biological Chemistry, 5, 293-304. doi: 10.4236/abc.2015.57027.

Received 28 October 2015; accepted 27 December 2015; published 30 December 2015

1. Introduction

Several bacterial species use the Quorum Sensing (QS, cell-cell communication) to coordinate their behavior as a whole community [1] . In Gram-positive bacteria, the signaling molecules are mostly small secreted peptides that are actively released into the extracellular environment [2] . The QS regulators of soil bacteria have been grouped in a new protein family called RNPP (Rap, NprR, PlcR and PrgX). Genome analysis indicated that genes encoding a putative regulator (NprR) and a putative signaling peptide (NprX or NprRB) were found upstream from nprA in the bacteria of the Bacillus cereus (B. cereus) group [3] [4] . These genes encode for a receptor and for a small protein. The small protein has a putative signal sequence used in the export pathway and a secreted domain [5] . The signaling peptide exported is processed by extracellular proteases and it is internalized by an oligopeptide permease [6] . The secreted QS factor allowing the activation of nprA expression corresponds to the central part of NprX and it is at least seven amino acids long [3] . The NprR-NprX system was found in all the species of B. cereus group, where 31 different NprR polypeptide sequences were identified [3] .

The B. cereus group comprises a number of closely related pathogenic species (Bacillus thuringiensis, B. thuringiensis; Bacillus anthracis, B. anthracis; and B. cereus) [7] . B. thuringiensis is a Gram-positive endospore- forming bacterium which is the only one in B. cereus group that synthesizes a crystalline delta-endotoxin protein (named Cry) [8] . Cry protein is formed during sporulation process and it is an insoluble and crystalline protein. The main application of the Cry protein is in the biological control and it has been also reported that some Cry proteins are highly cytotoxic to a wide range of human cancer cells [9] .

The aim of the present study is to determine if the genes encoding the signaling peptide (nprX) and the 16S rRNA genes are related in B. thuringiensis. New isolates from the Papaloapan region were used in the study. Also, a simple and rapid isolation method for B. thuringiensis is proposed.

2. Material and Methods

2.1. Soil Samples

The new B. thuringiensis isolates were obtain from uncultivated and cultivated soil samples from the Papaloapan region. The cultivated soil samples were from sugarcane, coffee and banana crops. The geographic location and coordinates of the soil sampling is show in the Electronic Supplementary Material, Table S1. Papaloapan region is a humid tropical region with annual average conditions of 70% of humidity, 33˚C and 3000 mm of precipitation. Five samples of 500 g at 15 cm deep of soil per crop (four corners and the center) were collected. The samples were stored at 4˚C for 24 h.

2.2. Isolation and Identification Method

The isolation method was design considering the principal characteristics of B. thuringiensis which is forming an insoluble and crystalline protein (Cry protein). The method consist them in two steps: 1) colony and microscopically morphology and 2) production of an insoluble protein at the end of the submerged culture. In order to compare the isolates B. thuringiensis var. kurstaki HD-73 (ATCC-35866), which produces a 133.3 kDa Cry1A(c) insecticidal crystal protein, was used as a reference. The isolates were phylogenetically identified comparing the molecular chronometer 16S rRNA from the isolates with 16S rRNA from B. thuringiensis strains reported in databases.

Steps 1: Colony and Microscopically Morphology. From the collected sample serial dilutions were done with sterile distilled water. The 1 × 10−3 dilutions were inoculated by triplicate in nutrient agar and were incubated at 30˚C for 24 hours. Colonies were selected by their morphology looking for white to off-white color, opaque, slightly raised elevation, and regular outlined colonies [10] . The selected colonies were inoculated in serial subcultures of nutrient agar until pure cultures were obtained. After that, the selected isolates were inoculated in 250 ml of nutrient broth by duplicate at 30˚C and 180 rpm during 48 h. At eight hours of culture (during the exponential growth) samples were collected for Gram staining, looking for gram positive bacteria. At 24 hours of culture (during the sporulation phase) samples were collected for spore formation staining. The stains were analyzed with a microscope under dark field illumination, with a 40× objective and 10× ocular lenses. It is important for a proper Gram staining of B. thuringiensis to take the sample during the exponential growth; otherwise, according to our experiments, the bacteria could be stained as a gram negative. At the end of the cultures the broth were collected for Cry protein detection.

Step 2: Detection of Insoluble Protein. The Cry proteins are insoluble at neutral pH, they are soluble just under alkaline conditions [9] [11] . The detection of Cry protein was done by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Bovine serum albumin (BSA) was used as protein standard. Considering the insolubility of Cry protein, the culture broth were centrifuged in 50 ml corning tubes at 5580 g during 30 min. The pellets were resuspended in 2 ml of distilled water, concentrated in a 15 ml corning tube and centrifuged at 5580 g during 30 min. The samples preparation and the solubilization process were done using the methodology described by Navarro et al. [12] . Four replicates were done for each sample.

2.3. Bioinformatic Analysis

The selected isolates were inoculated in Gerry Rowe culture medium, and incubated in orbital shaker (Thermo Scientific) at 30˚C and 200 rpm during 48 h. At eight hours of culture, 5 ml samples were centrifuged at 11,180 g during 15 min at 4˚C. Genomic DNA was extracted using the Ultra Clean microbial DNA isolation kit (MOBIO) following the manufacturer’s recommendations. DNA was quantified using a nano-spectrophotometer (Nanodrop 2000, Thermo Scientific).

The PCR amplification of 16S DNA gene was done using 100 ng of genomic DNA, 10 pM fD1 primer (CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG) and rD1 primer (CCCGGGATCCAAGCTTAA GGAGGTGATCCAGCC) [13] . 16S DNA PCR was performed in a MaxyGene (Axygen Scientific®) thermal cycler under the following conditions: 95˚C 5 min; 35 cycles of 95˚C for 1 min, 55˚C for 40 s and 72˚C for 30 s; finally, 72˚C for 10 min. The PCR amplification of nprX gene was done using the primers NprR-1 (GGGCAT TTGTTCTGTCTC) and NprR-2 (GCTAACACTAACGCTAAAC) [4] for NprR-NprX in 50 μL reaction (DreamTaq kit ™ 2X Green PCR Master Mix, Fermentas). nprX gene PCR was performed in a MaxyGene (Axygen Scientific®) thermal cycler under the following conditions: 95˚C 5 min; 35 cycles of 95˚C for 1 min, Ta 1 min and 72˚C for 1 min; finally, 72˚C for 10 min. The amplifications were observed with an imaging and analyzing system INGENIUS SYNGENNE®. The PCR products were purified using Thermo Scientific GeneJET PCR Purification Kit. The sequencing service was performed in Macrogen Inc. Korea. The nucleotide sequences obtained in this study were compared with sequences retrieved from databases in a pairwise mode, with the BLAST2 sequences tool (http://www.ncbi.nlm.nih.gov/BLAST/bl2seq/wblast2.cgi). The identification criteria proposed by Pothathil and Lazzazzera [6] , and Perchat et al. [3] were used to identify the isolates putative signal pentapeptide sequence.

Likelihood trees of 16S rRNA gene and nprX gene nucleotide sequences were built for isolates bioinformatic analysis. For phylogenetic tree based on 16S rRNA, the sequences from 29 isolates and 42 sequences from B. cereus group strains were included. For phylogenetic tree based on nprX gene, 24 isolates and 33 sequences from B. cereus group strains were included (Electronic Supplementary Material Table S2 and Table S3). The B. cereus group strains sequences were obtained from the GenBank database of the NCBI (http://www.ncbi.nlm.nih.gov/genbank) and IMG database (Integrated Microbial genomes, http://img.jgi.doe.gov). The phylogenetic tree based on 16S rRNA gene was built under the Statistical Method Maximum Likelihood. The Substitution Model used was Tamura Nei [14] . The phylogenetic tree based on 16S rRNA gene topology was optimized with the nearest neighbor interchanges (NNI). The phylogenetic tree based on nprX gene was built under the general time reversible (GTR) substitution model using Phyml [15] , while the topology was optimized with the nearest neighbor interchanges and sub-tree pruning and regrafting approaches. Statistical support was determined by 10,000 bootstrap replicates. The phylogenetic trees based on 16S rRNA and nprX gene were built using MEGA 6.0 software and CLUSTALW analysis.

3. Results

3.1. Isolation and Identification of Strains

The results of the isolation method are shown in Table 1. From colony and microscopically morphology 45 isolates were selected as B. thuringiensis; from those, 41 isolates produce an insoluble protein between 60 and 130 kDa (91%). Considering just colony morphology, approximately 63% of the isolates produce an insoluble protein. Therefore, the combination of colony and microscopically morphology increase the possibility to isolate correctly B. thuringiensis strains.

3.2. Molecular Characterization and Phylogenetic Analysis

For isolates identification three consecutive phylogenetic trees were built. The first one was built using 25 reported sequences of 16S rRNA gene: 19 of B. cereus group strains (10 for B. thuringiensis, 6 for B. cereus, 3 for B. anthracis), 4 of Bacillus subtilis (B. subtilis), 1 of Bacillus licheniformis (B. licheniformis) and 1 of Escherichia coli (E. coli), Figure 1. This phylogenetic tree shows three groups, one with all the strains of B. cereus

Table 1. Results from the isolation method.

Figure 1. Rectangular phylogenetic tree built with the 16S rRNA genes sequences (first tree) for several strains of B. cereus group (obtained from the GenBank and IMG). Abbreviations: Bt: Bacillus thuringiensis (blue), Bc: B. cereus (orange), Ba: B. anthracis (purple), Bs: B. subtilis (green), BI DSM 13: B. licheniformis DMS 13 (black). Group I corresponds to B. cereus group strains and group II corresponds to B. subtilis strains.

group, the second one with B. subtilis and B. licheniformis and the last one with E. coli.

A ClustalW analysis [16] using the isolates 16S rRNA gene sequences and the sequences used for the first tree with the MEGA 6.0 was done. With this alignment the second phylogenetic tree was built using the Tamura Nei model [14] (Figure 2). The second phylogenetic tree shows two groups, one with the B. cereus strains and

Figure 2. Rectangular phylogenetic tree built with the 16S rRNA gene sequences (second tree) for isolates strains of Papaloapan region (red) and for several strains of B. cereus group (obtained from the GenBank and IMG). Abbreviations: Bt: Bacillus thuringiensis (blue), Bc: B. cereus (orange), Ba: B. anthracis (purple), Bs: B. subtilis (green). Group I corresponds to B. cereus group strains, group II corresponds to B. subtilis strains, group III corresponds to B. thuringiensis strains and group IV corresponds to A-X isolates group.

the other one with B. subtilis. All the isolates sequences are closer to the B. cereus group (Figure 2). The 16S rRNA gene sequences of 16 isolates (A-8, A-6, A-37, A-36, A-33, A-32, A-31, A-30, A-3, A-28, A-27, A-26, A-22, A-15, A-14 and A-11) have a comb-like configuration. Through the alignment of these sequences, it was observed that all the sequences are identical. Therefore, they were considered as one group (A-X group).

Considering the results of the first and the second phylogenetic tree, the third one was built (Figure 3). For the third phylogenetic tree 22 sequences of B. thuringiensis strains were added (Electronic Supplementary Material Table S2). In this third phylogenetic tree (Figure 3) it can be observed that isolated AC1 presents similarity with B. thuringiensis alesti; as well as AC2 with B. thuringiensis HD-771, AC3 with B. thuringiensis higo and A-13 with B. thuringiensis IAM 12077. Besides, A-9 and A-24 show similarity not only with B. thuringiensis IAM 12077 but also with different varieties of B. thuringiensis such as chinensis, oswaldocruzi, kenyae and thompsoni. Isolates AC5, AC6, AC7 and AC8 show similarity with B. thuringiensis and B. cereus. The A-X group share information with B. thuringiensis (ostriniae, seoulensis and BMB) and with B. cereus (ATCC 14579). The isolated A-34 shows similarity with B. thuringiensis tolworthi. The isolated A-35 and A-5 show similarity with the group of B. thuringiensis, B. cereus and B. anthracis species. Table 2 shows the results from

Figure 3. Circular phylogenetic tree built with the 16S rRNA gene sequences (third tree) for isolates strains of Papaloapan region (red) and several strains of B. cereus group (obtained from the GenBank and IMG). Abbreviations: Bt: Bacillus thuringiensis (blue), Bc: B. cereus (orange), Ba: B. anthracis (purple), Bs: B. subtilis (green). A-X group represent A-8, A-6, A-37, A-36, A-33, A-32, A-31, A-30, A-3, A-28, A-27, A-26, A-22, A-15, A-14 and A-11 isolates.

Table 2. Phylogenetic analysis results of 16S rRNA gene sequences of isolates strains of Papaloapan region.

the phylogenetic identification of the isolates from the Papaloapan region. For AC-5, AC-6, AC-7, AC-8, A-5 and A-35 isolates the phylogenetic analysis is not conclusive, therefore, they were identified as Bacillus spp. However, all of these isolates produce an insoluble protein at the end of the culture.

3.3. NprX Bioinformatic Analysis

The phylogenetic tree based on nprR gene nucleotide sequence built on 29 strains isolated and 32 strains of B. cereus group from the literature (Figure 4, Electronic Supplementary Material Table S3) show a perfect correlation of seven putative mature NprX heptapeptide sequences [3] . Analysis of the NprX peptide was performed using the software SignalP 3 [15] , which incorporates a prediction of cleavage sites and a signal peptide/non- signal peptide prediction based on a combination of several artificial neural networks and hidden Markov models. Alignment of the secreted region was done using ClustalX to identify putative mature signaling peptides. The putative mature NprX for isolated strains are show in Table 2.

In phylogenetic tree based on nprR gene (Figure 4) different putative mature NprX can be observed: SKPDIVG for 15 B. thuringiensis strains, 3 B. anthracis strains and one B. cereus strain; WTSDIVG for 5 B. thuringiensis strains and 4 Bacillus spp. strains; SRPDVLT** for 2 strains of B. thuringiensis, one of B. cereus and two of Bacillus spp.; WKPDVLG* for 2 B. thuringiensis strains; WKPDTLG* for 2 B. thuringiensis strains and one B. cereus strain; SNPDIY** for one B. thuringiensis strain and one B. cereus strain; SKPDTYG for 2 strains of B. cereus.

The phylogenetic tree based on nprR gene also shows the type of Cry protein produced for the reported strains (Figure 4, Electronic Supplementary Material Table S3). No relationship was found between the Cry protein type produced and the putative mature peptides of all strain studied.

4. Discussion

The isolation method results show that the phase contrast microscopy strategy is not enough for B. thuringiensis isolation. Just 63% of the isolates produce an insoluble protein (Cry protein) at the end of the culture. In general, phase contrast microscopy is the backbone of the isolation strategy [17] . Another disadvantage of the phase contrast microscopy strategy is that a large proportion of isolates contain cry1 gene (bipyramidal shaped crystal) and relatively few novel isolates [17] .

According to the isolation method results (Table 1), the critical step in the method is to obtain forward and reverse sequencing. With both sequences, around 83% of the strains were identified by phylogenetic analysis. In this study, the phylogenic analysis of the 16S rRNA gene from 30 isolates from the Papalopan region 24 isolates was identified as B. thuringiensis while 6 of them were unidentified (Table 2). However, B. thuringiensis is the

Figure 4. Phylogenetic tree based on nprX gene sequence. 34 sequences of the B. cereus group were used under the model of amino acid substitution. One asterisk represents sequences of NprX that are lowly predicted to be exported from the cell. Two asterisks represent NprX sequences that are not predicted to be secreted by the cell.

only strain in B. cereus group that produces an insoluble protein at the end of the culture, named Cry protein. The 6 unidentified isolates produce this insoluble protein; therefore, they cannot be discarded as B. thuringiensis.

Several methods have been used in order to classify the B. cereus group. However, the classification results depend on the method, the strains, and the molecular marker used for each study. For example, multi-locus enzyme electrophoresis and the analysis of nine chromosomal genes showed that B. cereus, B. anthracis, and B. thuringiensis are the same species [18] . On the other hand, analysis of 16S rRNA, 23S, rpoB and gyrB genes from B. cereus group strains indicated that B. anthracis can be distinguished from B. cereus and B. thuringiensis strains [17] [19] .

The phylogenetic tree based on nprR gene does not match with the phylogenetic tree based on 16S rRNA gene indicating that the nprR is not specific for the species but it is specific for the strain. Several species of Bacillus could have the same heptapeptide sequence. For B. thuringiensis five different heptapeptide sequences were found. Although the SKPDIVG is the most common heptapeptide in thuringiensis species. For the isolates strain, the most common peptide sequence is WTSDIVG and there is no relationship with the soil type. Considering A-X as the same strain, for thuringiensis species SKPDIVG is the most common peptide. It has been reported that the SKPDIVG and the SKPDI are the most common peptide in thuringiensis species [3] [4] . The NprR-NprX quorum-sensing system was found to be strain-specific with a possible cross-talk between some pherotypes. The phylogenic relationship between NprR and NprX suggests a coevolution of the regulatory protein and its signalling peptide [3] . The incongruence between the phylogenetic trees based on nprR and 16S rRNA genes indicates that NprR is not a molecular marker for evolution. Therefore, the nprR gene is not useful for strain identification. Although phylogenetic tree based on nprR gene provides significant biological information, as it constitutes a system that controls functions like extracellular enzyme productions and plays a role in sporulation and cry transcription [3] .

Acknowledgements

This work had been supported by Consejo Nacional de Ciencia y Tecnología (2008-105057) and by Programa de Mejoramiento del Profesorado (103.5/10/0246). Alain Cruz-Nolasco acknowledges the fellowship provided by Programa de Mejoramiento del Profesorado. Humberto Rafael Bravo-D acknowledges the fellowship provided by Consejo Nacional de Ciencia y Tecnología Project 2008-105057.

Supplementary Tables

Table S1. Soil type and location of sampling in the Papaloapan region in the state of Oaxaca.

Table S2. Strains used for phylogenetic bioinformatics study of the 16S rRNA gene.

Table S3.Strains used for phylogenertic study of the NprRB gene.

NOTES

*Corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

[1] Waters, C.M. and Bassler, B.L. (2005) Quorum Sensing: Cell-to-Cell Communication in Bacteria. Annual Review of Cell and Developmental Biology, 21, 319-346.
http://dx.doi.org/10.1146/annurev.cellbio.21.012704.131001[CrossRef] [PubMed]
[2] Monnet, V. and Gardan, R. (2015) Quorum-Sensing Regulators in Gram-Positive Bacteria: Cherchez le Peptide. Molecular Microbiology, 97, 181-184.
http://dx.doi.org/10.1111/mmi.13060[CrossRef] [PubMed]
[3] Perchat, S., Dubois, T., Zouhir, S., Gominet, M., Poncet, S., Lemy, C., Aumont-Nicaise, M., Deutscher, J., Gohar, M., Nessler, S. and Lereclus, D. (2011) A Cell-Cell Communication System Regulates Protease Production during Sporulation in Bacteria of the Bacillus cereus Group. Molecular Microbiology, 82, 619-633.
http://dx.doi.org/10.1111/j.1365-2958.2011.07839.x[CrossRef] [PubMed]
[4] Rocha, J., Flores, V., Cabrera, R., Soto-Guzman, A., Granados, G., Juaristi, E., Guarneros, G. and de la Torre, M. (2012) Evolution and Some Functions of the NprR-NprRB Quorum-Sensing System in the Bacillus cereus Group. Applied Microbiology and Biotechnology, 94, 1069-1078.
http://dx.doi.org/10.1007/s00253-011-3775-4[CrossRef] [PubMed]
[5] Lazazzera, B.A. (2001) The Intracellular Function of Extracellular Signaling Peptides. Peptides, 22, 1519-1527.
http://dx.doi.org/10.1016/S0196-9781(01)00488-0[CrossRef]
[6] Pottathil, M. and Lazazzera, B.A. (2003) The Extracellular Phr Peptide-Rap Phosphatase Signaling Circuit of Bacillus subtilis. Frontiers in Bioscience, 8, 32-45.
http://dx.doi.org/10.2741/913[CrossRef] [PubMed]
[7] Raymond, B., Johnston, P.R., Nielsen-LeRoux, C., Lereclus, D. and Crickmore, N. (2010) Bacillus thuringiensis: An Impotent Pathogen? Trends in Microbiology, 18, 189-194.
http://dx.doi.org/10.1016/j.tim.2010.02.006[CrossRef] [PubMed]
[8] Rowe, G.E. and Margaritis, A. (1987) Bioprocess Development in the Production of Bioinsecticides by Bacillus thuringiensis. Critical Reviews in Biotechnology, 6, 87-127.
http://dx.doi.org/10.3109/07388558709086986[CrossRef]
[9] Ito, A., Sasaguri, Y., Kitada, S., Kusaka, Y., Kuwano, K., Masutomi, K., Mizuki, E., Akao, T. and Ohba, M. (2004) A Bacillus thuringiensis Crystal Protein with Selective Cytocidal Action to Human Cells. Journal of Biological Chemistry, 279, 21282-21286.
http://dx.doi.org/10.1074/jbc.M401881200[CrossRef]
[10] Muniady, S., Rathinam, X. and Subramaniam, S. (2011) Quick Isolation and Characterization for the Confirmation of a Novel Bacillus thuringiensis Strains from Chicken Manure Samples. African Journal of Microbiology Research, 5, 3131-3137.
[11] Wabiko, H. and Yasuda, E. (1995) Bacillus thuringiensis Protoxin: Location of Toxic Border and Requirement of Non-Toxic Domain for High-Level in Vivo Production of Active Toxin. Microbiology, 141, 629-639.
http://dx.doi.org/10.1099/13500872-141-3-629[CrossRef] [PubMed]
[12] Navarro, A.K., Farrera, R.R., Lopez, R. and Perez-Guevara, F. (2006) Relationship between Poly-β-Hydroxybutirate Production and δ-Endotoxin for Bacillus thuringiensis var. kurstaki. Biotechnology Letters, 28, 641-644.
http://dx.doi.org/10.1007/s10529-006-0029-0[CrossRef] [PubMed]
[13] Weisburg, W., Barns, S., Pelletier, D. and Lane, D. (1991) 16S Ribosomal DNA Amplification for Phylogenetic Study. Journal of Bacteriology, 173, 697-703.
[14] Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S. (2011) MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution, 28, 2731-2739.
http://dx.doi.org/10.1093/molbev/msr121[CrossRef] [PubMed]
[15] Emanuelsson, O., Brunak, S., von Heijne, G. and Nielsen, H. (2007) Locating Proteins in the Cell Using Target P, Signal P, and Related Tools. Nature Protocols, 2, 953-971.
http://dx.doi.org/10.1038/nprot.2007.131[CrossRef] [PubMed]
[16] Thompson, J., Higgins, D. and Gibson, T. (1994) Clustal W: Improving the Sensitivity of Progressive Multiple Sequence Alignment through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice. Nucleic Acids Research, 22, 4673-4680.
http://dx.doi.org/10.1093/nar/22.22.4673[CrossRef] [PubMed]
[17] Bavykin, S., Lysov, Y., Zakhariev, V., Kelly, J., Jackman, J., Stahl, D. and Cherni, A. (2004) Use of 16S rRNA, 23S rRNA, and gyrB Gene Sequence Analysis to Determine Phylogenetic Relationships of Bacillus cereus Group Microorganisms. Journal of Clinical Microbiology, 42, 3711-3730.
http://dx.doi.org/10.1128/JCM.42.8.3711-3730.2004[CrossRef]
[18] Helgason, E., Okstad, O.E., Caugant, D.A., Johansen, H.A., Fouet, A., Mock, M., Hegna, I. and Kolsto, A.B. (2000) Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis One Species on the Basis of Genetic Evidence. Applied and Environmental Microbiology, 66, 2627-2630.
http://dx.doi.org/10.1128/AEM.66.6.2627-2630.2000[CrossRef]
[19] Zasada, A. and Gierczyński, R. (2006) Some Bacillus thuringiensis Strains Share rpoB Nucleotide Polymorphisms Also Present in Bacillus anthracis. Journal of Clinical Microbiology, 44, 1606-1607.
http://dx.doi.org/10.1128/JCM.44.4.1606-1607.2006[CrossRef]

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.