High Levels Production of Recombinant Human Activin A—Effect upon in Vivo Follicle Stimulation

Abstract

Activin plays an important role in numerous physiological processes such as cell differentiation and remodeling, regeneration and repair of tissues from various organs, angiogenesis, morphogenesis of glandular organs, pluripotency and differentiation of stem cells, cell adhesion and apoptosis. It participates in reproductive processes like embryogenesis, in the expression of Follicle Stimulating Hormone and Luteinizing Hormone and maturation of ovarian follicles and therefore has application in the area of reproduction of vertebrates. Given the economic importance of activin, we develop an efficient and economical method for the production of recombinant human activin A (rACT), using as expression system the yeast Pichia pastoris. rACT showed biological activity as it induced, on submicromolar dose, the increase of ovarian mass and the ovulation process in a mammal model.

Share and Cite:

de Souza, N. , de Almeida, M. , Walkiria de Araujo, G. , de Melo Leite, R. , Santos, I. , Lima, M. and Pesquero, J. (2015) High Levels Production of Recombinant Human Activin A—Effect upon in Vivo Follicle Stimulation. Advances in Bioscience and Biotechnology, 6, 96-104. doi: 10.4236/abb.2015.62010.

1. Introduction

Activins are homodimeric proteins which are present in three different isoforms [1] -[3] . Each isoform is constituted by two beta subunits (14 kDa) linked by disulphide bonds [1] [4] . They are members of the transforming growth fator-β (TGF-β) superfamily, a group of molecules with similar structure and functions. Activins are synthesized in various tissues and its expression levels are elevated in the hypothalamus, pituitary gland, adrenal and placenta [5] [6] . They participate in numerous physiological processes, such as cellular differentiation and remodeling [7] -[9] , neural survival [10] , angiogenesis [11] , tissue repair [12] , cell adhesion and apoptosis [6] . In reproductive process, activin A plays an important role in embryogenesis, gonadotropins expression (Follicle Stimulating Hormone (FSH) and Luteinizing Hormone (LH)) and ovarian follicles maturation [13] -[16] . Activin A is distributed in spermatocytes, eggs and in various organs during embryogenesis [17] and is important to support granulosa cells survival and proliferation [18] .

Some organisms are used to produce recombinant proteins in order to minimize potential problems related to antigenic reactions, and assist in the correct expression of heterologous proteins [19] . Among yeasts, Pichia pastoris secretory system permits posttranslational modifications such as proteolytic maturation, disulfide bond formation and glycosylation, being mostly N-linked mannose residues and few O-linked [20] [21] . This enables such compounds to be injected into the bloodstream without inducing antigenic reactions, a problem often found in highly glycosylated proteins.

In this work, a new protocol for the production and purification of recombinant human activin A was established. Recombinant protein produced is similar to the native and secreted into the culture medium, facilitating its purification. The recombinant protein showed to be biologically active since on submicromolar dose it induced the increase of ovarian mass and the ovulation process in a mammal model.

2. Material and Methods

2.1. Animals

Peripubertal female Wistar rats (31 - 34 days, 65 - 90 g, 7 each group) were kept under standard laboratory conditions with a 12-h light, 12-h dark regimen [22] . These animals were from the animal’s house of University of Mogi das Cruzes. This project was approved by the local animal ethics committee.

2.2. Cloning of Activin

The cDNA fragment corresponding to mature activin was amplified using human genomic DNA and the oligon- ucleotides GAATTCGGCCTGGAGTGTGAC and GCGGCCGCCTATGAGCAACCA. The products were cloned into pGEM-T easy (Promega, USA). Clones with the correct sequence were sub-cloned into pPIC9 (Invitrogen) and incubated with BglII restriction endonuclease to linearization and integration into the AOX1 gene locus. The linearized plasmids were used to transform the yeast Pichia pastoris (SMD 1165 Invitrogen, USA) by electroporation (1500 V, 25 µF, 400 Ω).

2.3. Fermentation

Transformed Pichia pastoris were picked up from solid YPD medium (1% yeast extract, 2% peptone, 2% glucose) plates and inoculated into 300 mL of MGY medium (1.34% yeast nitrogen base, 1% glycerol; 4 ´ 10−5 % biotin) to grow at 30˚C under shaking (200 rpm) in a 1 L shake flask for 24 h (until OD600), when the medium was transferred to a bioreactor (Bioflo 110, New Brunswick, USA) containing 3 L of glycerol plus salts medium [23] and 13.2 mL of trace mineral medium (PTM1). When glycerol was consumed (36 h), a solution containing 50% glycerol and PTM1 (4.4 mL/L) was added in a flow rate of 1 mL/min/L, for 48 h, until yeast wet weight reached 208 g/L. To induce protein expression the glycerol solution was replaced by a mixture containing 100% methanol and PTM1 (12 mL/L) which during the first 24 hours was added in a flow rate of 2 mL/h/L and increased to 3 mL/h/L for the next 48 hours when the fermentation was completed. The biomass (yeast) was separated of the supernatant using the CFP-2-E-4MA (Amersham Biosciences Corp, USA) column in the hollow fiber system. The biomass was discarded and the supernatant transferred to a hollow-fiber system with a UFP-5-C column (GE Healthcare, USA) for tangential filtration and dialysis against 0.15 M NaCl. The protein concentration was estimated using Proteoquant reagent (Proteobras, Brazil) according to the method described previously [24] .

2.4. Gel Filtration Chromatography

A sample of protein from tangential filtration was loaded on a Biogel P-30 (1 ´ 60 cm, Bio-Rad, USA) column equilibrated and eluted with sodium phosphate buffer 50 mM, pH 7.0, at a flow rate of 1 mL/min. Fractions of 1 mL were collected and protein elution was monitored at 280 nm.

2.5. Western Blotting

Protein samples were heated (95˚C; 5 min), centrifuged and electrophoresed on 12.5% polyacrylamide gel containing 0.4% sodium dodecyl sulphate (SDS-PAGE). Proteins were transferred to a nitrocellulose membrane (Millipore, Ireland) using a Trans-Blot turbo system (Bio-Rad, Singapore) (20 mA, 7 min). The membrane was incubated with 35 mM sodium phosphate buffer containing 150 mM NaCl (PBS) and 0.3% tween-20 (PBST) for 1 hour and washed (PBST; 0.05% tween). Then the membrane was incubated with anti-activin A antibody (R & D Systems Inc., USA) for 2 hours, washed with PBST and incubated with anti-rabbit IgG peroxidase-conjugate (Merck, Germany) for 1 hour. The revelation was performed using the Luminata Forte Western HRP Substrate (Millipore, USA).

2.6. Biological Activity

The purified protein was injected daily (intraperitoneally) in prepubertal female rats [22] , during 3 days, at doses of 1.0, 0.5 or 0.1 µg per day. Animals from control group received saline (0.15 M NaCl). The animals were weighed, the ovaries (left and right) were excised and weighed after removing the water excess. The effect of treatment on the development of the ovaries was evaluated by determining the relationship between ovarian mass and animal body mass.

2.7. Histological Analysis

Ovaries were stained by hematoxylin/eosin and viewed at 40´ and 100´ magnification. The degree of maturational development of ovarian follicles was observed comparing the slides of ovaries treated with activin with the control.

2.8. Statistical Analysis

The relative mass of experimental and control groups were analyzed using the Student’s t test and are presented as mean ± standard error of the mean (SEM), considering significant p values < 0.05. GraphPad Prismversion 5.00 for Windows, GraphPad Software (San Diego California, USA).

3. Results

3.1. Expression of Recombinant Human Activin A

The supernatant from fermentation (4 L) was dialyzed and concentrated in the hollow fiber system to 0.5 L, the protein content estimated (0.42 mg/mL) and one sample loaded on a 12.5% SDS-PAGE (Figure 1). The selected clone expressed one protein with approximately 14 kDa (lanes 2 and 3). Two additional bands ranging from 17 to 19 kDa appear with higher intensity. Another bands around 28 - 32 kDa appear with lower intensity (lane 3). A commercial activin (R & D systems, USA) was loaded on the lane 4. From commercial sample, two bands, a weak of 14 kDa, and one of 23 kDa are in the region of the molecular mass of activin. A sample of the recombinant activin, containing 5 µg of protein was electrophoresed and blotted against a commercial anti-activin antibody. After blotting three immunoreactive bands with 14, 18 and 30 kDa were observed (Figure 2).

3.2. Purification of Recombinant Activin A

The purification of recombinant activin was performed on liquid chromatography FPLC system (Amersham Biosciences Corp, USA) using a biogel P-30 column. From the concentrated supernatant 2.0 milligrams protein were loaded onto column, eluted with 50 mM sodium phosphate buffer, pH 7.0 at 1 mL/min flow rate, monitored at 280 nm. Fractions of 1 mL were collected. The chromatographic profile presenting two peaks is in Figure 3. Fractions of each peak were pooled and loaded on a SDS-PAGE. Activin eluted in the first peak presenting only one 14 kDa band (Figure 4). From this chromatography it was recovered 1 mg of the recombinant protein.

Figure 1. Polyacrylamide gel electrophoresis (12.5%) of fermentation products. Lane 1: Bench mark protein ladder (Life Technologies, USA); lanes 2 and 3: 1 and 2 μg of recombinant protein; lane 4: 1 μg commercial activin (RD Systems).

Figure 2. Immunoblotting of the fermentation products using anti-activin antibody (RD Systems). Arrows indicate the immunoreactive bands.

Figure 3. Crude recombinant activin elution profile using biogel P-30 column (1 ´ 60 cm) sodium phosphate (50 mM), pH 7.0, was used for elution, 1 mL fractions were collected and the optical density (OD) monitored at 280 nm.

Figure 4. The electrophoretic pattern of purified recombinant activin in 12.5% SDS-PAGE. M, BenchMark protein ladder (Life Technologies, USA) and A, 1 μg sample from biogel P-30 chromatography.

3.3. Biological Activity

The purified recombinant protein was injected in prepuberty female Wistar rats at 1, 0.5, 0.1 μg/animal/day doses (n = 7 for each group). After three doses (three days injection), the rats were sacrificed and the body and ovarian mass determined. Figure 5 shows the results obtained after 0.1 μg dose. There was a significant increase in ovarian relative mass of rACT-treated group by comparing with the ovarian relative mass of control group.

3.4. Histological Analysis

Histological results are shown in Figure 6. It can be observed, in the slides ovaries of 0.1 μg treated animals, the presence of corpus luteum (Figure 6(A)), indicating that the recombinant protein has the capacity to interfere with follicular maturation even when administered at submicromolar doses. The ovaries of the control group had many developing follicles (Figure 6(B)).

Figure 5. Effect of 0.1 μg of purified protein (rACT) and saline on the weight of the ovaries.

Figure 6. Histological section of rat ovary treated with purified recombinant protein (0.1 μg rACT) (A) or saline (B). CL = corpus luteum. Magnification bar (horizontal blackline) = 50 µm.

4. Discussion

The P. pastoris yeast is an efficient expression system for the production of a variety of heterologous proteins. The use of P. pastoris for the production of recombinant activin was already described by others [25] [26] ; however, the protocol presented here is less consuming time with better yield. The expression of activin A was performed using similar protocols described previously [27] [28] with some modifications. Hollow fiber system was used for concentration and dialysis of the protein. The product was purified in just one chromatographic step, using gel filtration on FPLC system. Some authors [25] [29] used affinity chromatography which makes the process much more laborious and expensive. The activin A process of production and purification presented in this work consists of a fast, efficient and cost-effective methodology for the production and purification of the protein. Higher capacity columns may be used to facilitate the purification procedure. Taking into account the results from SDS-PAGE, we may conclude that the recovery of the activin in the biogel P-30 chromatography was around 70%. The SDS-PAGE for the crude material showed one strong band around 18 kDa, the same molecular mass of one immunoreactive by using the commercial anti-activin antibody. We believe that this protein may be an aggregate involving the activin and an activin degradation product. Taking into account these data, around 100 mg of pure activin can be obtained by our protocol, which finishes with 4 L fermentation. To determine the biological activity of the rACT, it was used different doses of the protein in the crude and purified conditions; however, it is presented only data obtained with the purified protein. All animals of rACT-treated group presented increased ovarian mass, including that treated with crude protein at higher doses (5 μg/animal/day) with similar results (data not shown). These results evidence that rACT produced is in the active form since it stimulated the development, growth and maturation of ovarian follicles and thus the increase in ovarian mass. This increase seems to be related to the accumulation of follicular fluid during follicle maturation process in folliculogenesis. This process is mediated primarily by gonadotropic hormones, local development and growth factors that participate in autocrine and paracrine regulation in these events [30] -[32] . Activin is one of these growth factors. The increase in ovarian mass after treatment with activin A was observed in rodents and showed their autocrine and paracrine role in the structural and functional development of follicles [31] [33] [34] . Another evidence came from histological analysis of ovaries. The results showed the presence of corpus luteum, indicating that ovulation had previously occurred whereas rats of control group showed no ovulation. The premature ovulation in female rats after three days of treatment with rACT showed that some follicles started early ovulation, in agreement with previously result [33] . The mechanism by which activin A promotes premature ovulation is unknown. A hypothesis is related to the ability of activin A to increase the expression levels of FSH and LH hormones during folliculogenesis [35] [36] . The FSH actions are involved in development and growth of follicles, estrogen production stimulation and oocytes maturation. The specific activity of the FSH beta chain promoter is mainly regulated by activin and also presents a key role in the transcription activation of FSH gene encoding [37] -[39] . Activin A maintains FSH expression levels increased and maintains FSH receptors active in vitro even in absence of this hormone [18] .

Activin A also promotes increase in LH expression and may regulate the production of LH, controlling LH beta subunit expression [40] [41] . The main function of LH refers to the maturation of ovarian follicles after ovulation, corpus luteum formation and progesterone synthesis. FSH and LH levels increment induced by activin A, in vivo, could explain the increase in premature ovulation observed in rodents [33] . Another hypothesis is that premature superovulation caused by activin A is a direct action within the formation follicles. In vivo experiment [42] showed that systemic administration of activin A in hypophysectomized rats stimulated growth of small follicles indicating that this event occurred in the absence of FSH. Therefore, FSH alone failed to cause granulosa cells proliferation in hypophysectomized rats and activin directly organized follicular development and increased estradiol production. These studies showed that activin acts not only in the pituitary but also in the ovarian tissue. The effect of FSH on the growth of the ovarian follicle in vivo appears to be not direct but mediated by paracrine and autocrine ovarian factors [43] [44] . These studies suggest that activin can be such factor. This proves the activin ability to stimulate follicles production in different in vivo and in vitro studies, featuring paracrine and autocrine regulation of this protein in process of folliculogenesis [40] [44] . Studies have shown that activin participate not only in the early development of the follicle, but also in all stages of follicular development and luteal activity [45] . The activin A transcripts and receptors are expressed in all follicular stages and in the corpus luteum [46] . These data reinforce the regulatory role of the protein since the process of folliculogenesis until luteal activity.

Acknowledgements

This work was supported by Conselho Nacional de Pesquisa (CNPq) and Fundação de Amparo a Pesquisa do Estado de São Paulo(FAPESP).

NOTES

*Corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

[1] Ling, N., et al. (1986) Pituitary FSH Is Realeased by a Heterodimer of the β-Subunits from the Two Forms of Inhibin. Nature, 321, 779-782.
http://dx.doi.org/10.1038/321779a0[CrossRef] [PubMed]
[2] Vale, W., Hsueh, A., Rivier, C. and Yu, J. (1990) Theinhibin/Activin Family of Hormones and Growth Factors. Handbook of Experimental Pharmacology, 95, 211-248.
http://dx.doi.org/10.1007/978-3-642-74781-6_8[CrossRef]
[3] Nakamura, T., et al. (1992) Isolation and Characterization of Native Activin B. Journal of Biological Chemistry, 267, 16385-16389.
[4] Burger, H.G. and Igarashi, M. (1988) Inhibin: Definition and Nomenclature, including Related Substances. Endocrinology, 122, 1701-1702.
http://dx.doi.org/10.1210/endo-122-4-1701[CrossRef] [PubMed]
[5] Roberts, V.J., Peto, C.A., Vale, W. and Sawchenko, P.E. (1992) Inhibin/Activin Subunits Are Co-Stored with FSH and LH in Secretory Granules of the Rat Anterior Pituitary Gland. Neuroendocrinology, 56, 214-224.
http://dx.doi.org/10.1159/000126231[CrossRef] [PubMed]
[6] Luisi, S., Florio, P., Reis, F.M. and Petraglia, F. (2001) Expression and Secretion of Activin-A: Possible Physiological and Clinical Implications. European Journal of Endocrinolgy, 145, 225-236.
http://dx.doi.org/10.1530/eje.0.1450225[CrossRef] [PubMed]
[7] Jones, R.L., et al. (2002) Expression of Activin Receptors, Foliistatin and Betaglycan by Human Endometrial Stromal cells Consist with a Role for Activins during Decidualization. Molecular Human Reprodroduction, 8, 363-374.
http://dx.doi.org/10.1093/molehr/8.4.363[CrossRef] [PubMed]
[8] Hongisto, H., Mikhailova, A., Hiidenmaa, H., Ilmarinen, T. and Skottman, H. (2012) Low Level of Activin Secreted by Fibroblast Feeder Cells Accelerates Early Stage Differentiation of Retinal Pigment Epitelial Cells from Human Pluripotent Stem Cells. Stem Cell Discovery, 4, 176-186.
http://dx.doi.org/10.4236/scd.2012.24022[CrossRef]
[9] Hübner, G., Alzheimer, C. and Werner, S. (1999) Activin A: A Novel Player in Tissue Repair Process. Histology and Histopathology, 14, 295-304.
[10] Smith, J.C., Price, B.M., Van Nimmen, K. and Huylebroeck, D. (1990) Identification of a Potent Xenopus Mesoderm-Inducing Factor as a Homologue of Activin A. Nature, 345, 729-731.
http://dx.doi.org/10.1038/345729a0[CrossRef] [PubMed]
[11] Maeshima, K., Maeshima, A., Hayashi, Y., Kishi, S. and Kojima, I. (2004) Crucial Role of Activin A in Tubulogênesis of Endothelial Cells Induced by Vascular Endothelial Growth Factor. Endocrinology, 145, 3739-3745.
http://dx.doi.org/10.1210/en.2004-0213[CrossRef] [PubMed]
[12] Werner, S. and Alzheimer, C. (2006) Roles of Activin in Tissue Repair, Fibrosis, and Inflammatory Disease. Cytokine & Growth Factor Reviews, 17, 157-171.
http://dx.doi.org/10.1016/j.cytogfr.2006.01.001[CrossRef] [PubMed]
[13] Chen, A.E., Borowiak, M., Sherwood, R.I., Kweudjeu, A. and Melton, D.A. (2013) Functional Evaluation of ES Cell-Derived Endodermal Populations Reveals Differences between Nodal and Activin A-Guided Differentiation. Development, 140, 675-686.
[14] Suszko, M.I., Balkin, D.M., Chen, Y. and Woodruff, T.K. (2005) Smad3 Mediates Activin-Induced Transcription of Follicle-Stimulating Hormone Beta-Subunit Gene. Molecular Endocrinology, 19, 1849-1858.
http://dx.doi.org/10.1210/me.2004-0475[CrossRef] [PubMed]
[15] Knight, P.G. and Glister, C. (2006) TGF-Beta Superfamily Members and Ovarian Follicle Development. Reproduction, 132, 191-206.
http://dx.doi.org/10.1530/rep.1.01074[CrossRef] [PubMed]
[16] Woodruff, T.K., Lyon, R.J., Hansen, S.E., Rice, G.C. and Mather, J.P. (1990) Inhibin and Activin Locally Regulate Rat Ovarian Folliculogenesis. Endocrinology, 127, 3196-3205.
http://dx.doi.org/10.1210/endo-127-6-3196[CrossRef] [PubMed]
[17] Vale, W., Bilezikjian, L.M. and Rivier, C. (1994) Reproductive and Other Roles of Inhibins and Activins. In: The Physiology of Reproduction, 2nd Edition, Raven Press Ltd., New York, 1861-1878.
[18] Li, R., Phillips, D.M. and Mather, J.P. (1995) Activin Promotes Ovarian Follicle Development in Vitro. Endocrinology, 136, 849-856.
[19] Mader, A., Chromikova, V. and Kunert, R. (2013) Recombinant IgM Expression in Mammalian Cells: A Target Protein Challenging Biotechnological Production. Advances in Bioscience and Biotechnology, 4, 38-43.
[20] Damasceno, L.M., Huang, C. and Batt, C.A. (2012) Protein Secretion in Pichia pastoris and Advances in Protein Production. Applied Microbiology and Biotechnology, 93, 31-39.
[21] Shibui, T., Bando, K. and Misawa, S. (2013) High-Level Secretory Expression, Purification, and Characterization of an Anti-Human Her II Monoclonal Antibody, Trastuzumab, in the Methylotrophic Yeast Pichia pastoris. Advances in Bioscience and Biotechnology, 4, 640-646.
http://dx.doi.org/10.4236/abb.2013.45084[CrossRef]
[22] Zapatero-Caballero, H., Sanchez-Franco, F., Fernandez-Mendez, C., García-San Frutos, M., Botella-Cubells, L.M. and Fernandez-Vazquez, G. (2004) Gonadotropin-Releasing Hormone Receptor Gene Expression during Pubertal Development of Female Rats. Biology of Reproduction, 70, 348-355.
http://dx.doi.org/10.1095/biolreprod.103.020818[CrossRef] [PubMed]
[23] Chen, Y., Cino, J., Hart, G., Freedman, D., White, C. and Ko-mives, E.A. (1997) High Protein Expression in Fermentation of Recombinant Pichia pastoris by a Fed-Batch Process. Process Biochemistry, 32, 107-111.
http://dx.doi.org/10.1016/S0032-9592(96)00052-0[CrossRef]
[24] Bradford, M.M. (1976) A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Analytical Biochemistry, 72, 248-254.
http://dx.doi.org/10.1016/0003-2697(76)90527-3[CrossRef] [PubMed]
[25] Papakonstantinou, T., Harris, S.J., Fredericks, D., Harrison, C., Wallace, E.M. and Hearn, M.T.W. (2009) Synthesis, Purification and Bioactivity of Recombinant Human Activin A Expressed in the Yeast Pichia pastoris. Protein Expression and Purification, 64, 131-138.
http://dx.doi.org/10.1016/j.pep.2008.10.020[CrossRef] [PubMed]
[26] Fredericks, D., Clay, R., Warner, T., O’Connor, A., Kretser, D.M. and Hearn, M.T.W. (2010) Optimization of the Expression of Recombinant Human Activin A in the Yeast Pichia pastoris. Biotechnology Progress, 26, 372-383.
http://dx.doi.org/10.1002/btpr.304[CrossRef] [PubMed]
[27] Cereghino, G.P., Cereghino, J.L., Ilgen, C. and Cregg, J.M. (2002) Production of Recombinant Proteins in Fermenter Cultures of the Yeast Pichia pastoris. Current Opinion in Biotechnology, 13, 329-332.
http://dx.doi.org/10.1016/S0958-1669(02)00330-0[CrossRef]
[28] Cregg, J.M., Cereghino, J.L., Shi, J. and Higgins, D.R. (2000) Recombinant Protein Expression in Pichia pastoris. Molecular Biotechnology, 16, 23-52.
http://dx.doi.org/10.1385/MB:16:1:23[CrossRef]
[29] Pangas, S.A. and Woodruff, T.K. (2002) Production and Purification of Recombinant Human Inhibin and Actvin. Journal of Endocrinology, 172, 199-210.
http://dx.doi.org/10.1677/joe.0.1720199[CrossRef] [PubMed]
[30] Hirshfield, A.N. (1991) Development of Follicles in the Mammalian Ovary. International Review of Cytology, 124, 43-101.
http://dx.doi.org/10.1016/S0074-7696(08)61524-7[CrossRef]
[31] Richards, J.S., Russell, D.L., Ochsner, S., Hsieh, M., Doyle, K.H., Falender, A.E., Lo, Y.K. and Sharma, S.C. (2002) Novel Signaling Pathways that Control Ovarian Follicular Development, Ovulation, and Luteinization. Recent Progress in Hormone Research, 57, 195-220.
http://dx.doi.org/10.1210/rp.57.1.195[CrossRef] [PubMed]
[32] Wang, W., Tang, Y., Ni, L., Jongwutiwes, T., Liu, H. and Rosenwaks, Z. (2012) A Modified Protocol for in Vitro Maturation of Mouse Oocytes from Secondary Preantral Follicles. Advances in Bioscience and Biotechnology, 3, 57-74.
[33] Erickson, G.F., Kokka, S. and Rivier, C. (1995) Activin Causes Premature Superovulation. Endocrinology, 136, 4804-4813.
[34] Cossigny, D.A., Findlay, J.K. and Drummond, A.E. (2012) The Effects of FSH and Activin A on Follicle Development in Vitro. Reproduction, 143, 221-229.
http://dx.doi.org/10.1530/REP-11-0105[CrossRef]
[35] Ethier, J.F. and Findlay, J.K. (2001) Roles of Activin and Its Signal Transduction Mechanisms in Reproductive Tissues. Reproduction, 121, 667-675.
http://dx.doi.org/10.1530/rep.0.1210667[CrossRef] [PubMed]
[36] Suszko, M.I., Lo, D.J., Suh, H., Camper, S.A. and Woodruff, T.K. (2003) Regulation of the Rat Follicle-Stimulating Hormone Beta-Subunit Promoter by Activin. Molecular Endocrinology, 17, 318-332.
http://dx.doi.org/10.1210/me.2002-0081[CrossRef] [PubMed]
[37] Burger, L.L., Haisenleder, D.J., Dalkin, A.C. and Marshall, J.C. (2004) Regulation of Gonadotropin Subunit Gene Transcription. Journal of Molecular Endocrinology, 33, 559-584.
http://dx.doi.org/10.1677/jme.1.01600[CrossRef] [PubMed]
[38] Gregory, S.J., Lacza, C.T., Detz, A.A., Xu, S., Petrillo, L.A. and Kaiser, U.B. (2004) Synergy between Activin A and Gonadotropin-Releasing Hormone in Transcriptional Activation of the Rat Follicle-Stimulating Hormone Beta Gene. Molecular Endocrinology, 19, 237-254.
http://dx.doi.org/10.1210/me.2003-0473[CrossRef] [PubMed]
[39] Lamba, P., Santos, M.M., Philips, D.P. and Bernard, D.J. (2006) Acute Regulation of Murine Follicle-Stimulating Hormone Beta Subunit Transcription by Activin A. Journal of Molecular Endocrinology, 36, 201-220.
http://dx.doi.org/10.1677/jme.1.01961[CrossRef] [PubMed]
[40] Thackray, V.G., Mellon, P.L. and Coss, D. (2010) Hormones in Synergy: Regulation of the Pituitary Gonadotropin Genes. Molecular and Cellular Endocrinology, 314, 192-203.
[41] Bernard, D.J. and Tran, S. (2013) Mechanisms of Activin-Stimulated FSH Synthesis: The Story of a Pig and a FOX. Biology of Reproduction, 88, 78.
http://dx.doi.org/10.1095/biolreprod.113.107797[CrossRef] [PubMed]
[42] Doi, M., Igarashi, M., Hasegawa, Y., Eto, Y., Shibai, H., Miura, T. and Ibuki, Y. (1992) In Vivo Action of Activin-A on Pituitary-Gonadal System. Endocrinology, 130, 139-144.
[43] Woodruff, T.K. and Mather, J.P. (1995) Inhibin, Activin and the Female Reproductive Axis. Annual Review of Physiology, 57, 219-244.
http://dx.doi.org/10.1146/annurev.ph.57.030195.001251[CrossRef] [PubMed]
[44] Gajewska, A., Siawrys, G., Bogacka, I., Przala, J., Lerrant, Y., Counis, R. and Kochman, K. (2002) In Vivo Modulation of Follicle-Stimulating Hormone Release and Beta Subunit Gene Expression by Activin A and the GnRH Agonist Buserelin in Female Rats. Brain Research Bulletin, 58, 475-480.
http://dx.doi.org/10.1016/S0361-9230(02)00821-3[CrossRef]
[45] Thomas, F.H., Armstrong, D.G. and Telfer, E.E. (2003) Activin Promotes Oocyte Development in Ovine Preantral Follicles in Vitro. Reproductive Biology and Endocrinology, 1, 76.
[46] Silva, J.R., van den Hurk, R., van Tol, H.T.A., Roelen, B.A.J. and Figueiredo, J.R. (2004) Gene Expression and Protein Localisation for Activin-A, Follistatin and Activin Receptors in Goat Ovaries. Journal of Endocrinology, 183, 405-415.
http://dx.doi.org/10.1677/joe.1.05756[CrossRef] [PubMed]

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.