Effects of bar-transgenic rice on the intestinal microflora of the mice (Mus musculus) ()
1. INTRODUCTION
Genetically modified organisms (GMO) are a group of organisms whose genomes have been altered using genetic modification. The cultivated area of transgenic herbicide-resistant crop is the largest among transgenic plants. Genetic modification has brought enormous economic and social values. However, since the emergence of genetic modification, there have been several controversies on the effect of transgenic crops and derived products on human health. These controversies continue to be a worldwide concern. With increased cultivation area and transgenic rice output, assessing the safety of transgenic rice is very necessary [1-3], especially toxicological assessments [4-13].
Intestinal microflora has important effects on immunity, disease prevention and treatment, digestion, absorption, and metabolism [14]. Diet composition can affect the number and type of bacteria in intestinal microflora because diets are the source of final metabolic substrates for intestinal microflora [15,16]. Therefore, intestinal microbial diversity reflects the quality of diets. The effects of different diets on intestinal microbes have been extensively studied. For example, the bacterial communities in the colon and feces of pigs fed with whole crop rice, the development of a bacterial community in the feces of weaning piglets, and the bacterial community and diversity in the gastrointestinal tract layer have been studied by Wang et al. [17], Zhu et al. [18], and Ni et al. [19] using denaturing gradient gel electrophoresis (DGGE). Molecular biotechnology has several advantages over traditional methods used to analyze intestinal microflora. For instance, polymerase chain reaction (PCR) coupled with DGGE can completely and accurately analyze microbial community structure and diversity. Thus, PCRDGGE has been widely used over the past few years. However, there have only been a few studies on the effects of Bar-transgenic rice on intestinal bacterial microflora that used DGGE. The effects of Bar-transgenic rice on intestinal microflora were investigated in the present study using DGGE, which provided scientific and objective bases in assessing the safety of transgenic rice.
2. MATERIALS AND METHODS
2.1. Materials and Treatments
A total of 100 6-week-old SPF-grade Mus musculus [Number of Animal License: SCXK (Xiang) 2009-0004] weighing 18 g to 22 g were purchased from Hunan Slca Jingda Experimental Animal Center Company, Limited. The mice were randomly divided into five groups. Five diets (Table 1) that met or exceeded the minimum nutrient requirements were fed to the mice. The ingredient and composition of the five experimental diets were almost identical, except for rice content. The experimental design is given in Table 2.
Each group contained 10 male and 10 female mice. Five groups of mice were fed with routine feed [20] [Production License: SCXK (Xiang) 2009-0009] for 3 days to 5 days before the start of the experiment. They were fed with five experimental diets, namely, two doses of genetically modified (GM) Bar68-1 rice, two doses of D68 (non-GM) rice, and routine feed for 180 days. The mice were kept under standard environmental conditions (temperature between 22˚C and 25˚C, humidity between 50% to 60%, and luminosity of 15 lx to 20 lx) with free access to food and water. After 90 days, the parental generation (P) produced the first filial generation (F1). Each generation was fed for 180 days. On the 180th day, five mice from each group were randomly sampled, and their intestinal contents were collected for DNA isolation. All animal experiments were performed in accordance with the Guidelines for Use of Experimental Animals established by the College of Life Science, Hunan Normal University.
Bar-transgenic rice Bar 68 - 1 (Production License: Agriculture Basic Security Examination [2006] No.060) and the corresponding non-transgenic rice D68 were obtained from the Research Institute of Subtropical Agricultural Ecology of Chinese Academy of Science. All ingredients were mixed in certain proportions and then rolled into a root-shaped formula feed (diet) at the Animal Feed Manufacturer of Central South University.
2.1.1. Intestinal Samples
Five mice from each group were randomly sampled and sacrificed. After sterilizing the body surface with 70% alcohol, the mice were dissected under sterile conditions. All ileal and cecal luminal contents of the sacrificed mice were collected into sterile plastic tubes and thoroughly mixed as previously described [19,21]. The intestinal contents were snap-frozen in liquid nitrogen and stored at –70˚C until analysis.
2.1.2. DGGE Preparation
The reagent was placed into 15-mL clean EP tubes in succession. Low and high concentrations of the denaturing gradient gel solution were then prepared (Table 3).
2.2. Methods
2.2.1. Sample Pretreatment
After the samples were thawed at room temperature, 2 g

Table 1. Ingredients and composition of the experimental diets (%, dry weight).
of the intestinal contents were suspended in 1.5 mL of 0.2 mol/L sterile PBS (pH 7.4), followed by 5 min vortexing in a 2-mL tube. The suspension was centrifuged at 500 r/min for 10 min, and the supernatant was collected in new sterile EP tubes. About 1 mL sterile PBS was added to the pellets and vortexed for 5 min. The suspension was centrifuged at 12,000 r/min for 5 min, and the supernatant was also collected in a new tube. The two sets of supernatant were mixed and the mixture was centrifuged at 500 r/min for 6 min to remove coarse particles. The cells in the supernatant were collected and washed twice with PBS by centrifuging at 12,000 r/min for 5 min. The supernatant was stored in 1 mL PBS at –70˚C.
2.2.2. Genomic DNA Extraction
Genomic DNA was isolated from the samples as previously described [22] with some modifications according to the specification in the DNA extraction kit, and was then stored at –20˚C.
2.2.3. Amplification of Genomic DNA by PCR
The V3 region of 16S rDNA was amplified by PCR using primers specific for the bacteria. In the present study, a pair of primers was designed for PCR by Sangon Biotech (Shanghai) Company, Limited. The oligonucleotides used were as follows: the upstream primer was HAD-1- GC-F(5’-CGCCCGGGGCGCGCCCCGGGCGGGGCG GGGGCACGGGGGGACTCCTACGGGAGGCAGCA G-3’); and the downstream primer was HAD-2-R(5’-GT ATTACCGCGGCTGCTGGCA-3’).
PCR was performed using a PCR kit (MBI Fermentas) in a 30-μL flask containing 3.5 μL of the template DNA (50 ng/μL), 20.0 μL ddH2O, 1.0 μL dNTP (10 mmol/L), 3.0 μL of 10× buffer, 1.0 μL of each primer, and 0.5 μL Taq DNA polymerase (2.5 U/μL, Mg2+ plus).
The reaction was denatured at 95˚C for 5 min, followed by 35 cycles of 30 s at 95˚C, 30 s at 56˚C, 40 s at 72˚C, and an extension of 10 min at 72˚C. The PCR products were separated using 1.5% agarose gel.
2.2.4. DGGE
After visual confirmation of the PCR products using agarose gel electrophoresis, DGGE was performed using the BioRad Dcode system as previously described [23]. Up to 35% to 65% linear DNA-denaturing gradients were formed in 8% polyacrylamide gels using a Bio-Rad Gradient Former to separate the PCR fragments. Bacterial V3 16S PCR products were loaded in each lane, and electrophoresis was performed in 1× TAE Buffer at 60˚C at 100 V for 16 h to 18 h. The denaturing gradient was parallel to the direction of electrophoresis. After electrophoresis, the gels were silver-stained and scanned using a ChemiDoc XRS system (Image lab software version 3.0) (BioRad). Each individual amplicon was then visualized as a distinct band representing at least one bacterial species on the gel.
2.2.5. Identification of Dominant Microflora in Mouse Intestines
The DGGE objective gels were cut using a disposable operation blade and collected into 1.5-mL sterile EP tubes (enzyme free). After the gels were pounded, 20 μL ddH2O was added and the mixture was kept overnight at 4˚C. PCR was performed on the template objective gels using HAD-1-GC-F and HAD-2-R primers under the same reaction conditions stated in Section 2.2.3. After the PCR products were separated by electrophoresis on 1.5% agarose gel, the objective fragments were purified with Wizard SV Gel and PCR Clean-Up System (Promega) and sequenced by BGI (Beijing). The sequence data were analyzed, and a basic local alignment search tool (http://www.ncbi.nlm.nih.gov/BLAST/) search was performed to identify the sequences.

Table 3. Composition and content of the denaturing gradient gel solution.
2.2.6. Data Analysis
Quantity One (Version 4.4) (BioRad) was used to analyze PCR-DGGE banding patterns by measuring the migration distance and band intensity within each gel lane. This information was then used to analyze the banding patterns by measuring the community diversity, including band number and Sorenson’s pairwise similarity (Cs).
The data were expressed as mean ± SD. The statistical significance (P < 0.05) of difference between the means was determined using ANOVA with SPSS (Version 17.0).
Sorenson’s pairwise similarity (Cs) was estimated using the formula below:

where a is the number of total bands in the PCR-DGGE pattern for one sample, b is the number of total bands in the PCR-DGGE pattern for another sample, and j is the number of common bands shared by both samples.
3. RESULTS AND ANALYSIS
3.1. Genomic DNA and PCR Products
The DNA was first checked for integrity by electrophoresis analysis on 1.5% agarose gel, and then quantified using a spectrophotometer (Thermo). DNA bands amplified by the primers appeared clear and bright. The purity and quality of the DNA obtained by this method were satisfactory. The ratio of OD260 to OD280 was between 1.75 and 1.83.
After the V3 region of the 16S rDNA was amplified by PCR, the evaluated PCR products by electrophoresis were as expected. The size of the amplified fragments of the 16S rDNA ranged from 200 bp to 500 bp (Figure 1).
3.2. Effect of Bar-Transgenic Rice on Band Numbers of 16S rDNA Using PCR-DGGE
As shown in Figure 2, many bands were obtained after DGGE. These bands had different magnitudes and mobilities. The resulting DGGE band numbers were counted (Figure 2). The effects of Bar-transgenic rice on band numbers in each sample using PCR-DGGE were compared with each other (Table 4). In P and F1, the band numbers did not differ (P > 0.05) among Groups 1, 3 and 5, and did not differ (P > 0.05) among Groups 2, 4 and 5.
3.3. Effect of Bar-Transgenic Rice on Sorenson’s Pairwise Similarity Coefficient (Cs)
The effect of Bar-transgenic rice on 16S rDNA PCRDGGE banding patterns was further assessed by comparing the Sorenson’s pairwise similarity coefficient (Cs) of each group, as presented in Tables 5 and 6. As shown in Table 5, the Cs values ranged from 87% to 91%. The higher the Cs values, the higher the homogeneity. In P and F1, intergroup Cs values did not differ (P > 0.05) among Groups 1, 3 and 5, and did not differ (P > 0.05) among Groups 2, 4 and 5 (Table 6). This result indicated a higher homogeneity among groups.
3.4. Dominant Microflora in Mouse Intestines
The 11 dominant microflora were identified as follows:

Lanes 1-5: Groups 1-5 of P; Lanes 1’-5’: Groups 1-5 of F1; M: DNA marker (from below to above) ranging from 200, 300, 500, 750, 1000 to 2000 bp.
Figure 1. PCR products separated on 1.5% agarose gel.

Table 4. Effect of Bar-transgenic rice on band numbers using PCR-DGGE.

Table 5. Sorenson’s pairwise similarity coefficients (Cs) of intestinal microflora in mice/%.

Figure 2. PCR-DGGE bands in mouse intestinal samples.

Table 6. Comparison of intergroup sorenson’s pairwise similarity coefficient (Cs).
1-Lactobacillus gasseri; 2,3-Uncultured bacterium; 4- Lactobacillus johnsonii; 5-Staphylococcus lentus; 6-Staphylococcus cohnii; 7-Lactobacillus intestinalis; 8-Lactobacillus murinus; 9-Uncultured bacterium; and 10- Staphylococcus schleiferi.
4. DISCUSSION
Since the first time DGGE was applied in investigating the microbial community structure by Muyzer et al. in 1993, it has been widely used in every field in molecular microbial ecology. DGGE has now become one of the main methods in studying the microbial community structure.
PCR-DGGE banding profiles are different among individuals due to individual differences among hosts, and this finding has already been reported [18,21,24]. Genomic DNA was isolated from the mixed intestinal contents of five mice from each group in the present study to eliminate the sample differences, which was noted by Gong, et al. [21]. Thus, the mixed samples in the present study are more representative of the actual intestinal contents.
In a general way, the number of samples should be as large as possible. With the disadvantages limits of samples quantity, there were only five samples from each group in this study. It was not enough and worth the further improvement.
The higher the number of DGGE bands, the more abundant the mouse intestinal microbial species. PCRDGGE banding profiles of genomic DNA of intestinal microbial species obtained in the present study have complicated quantities and locations, which reflect the diversity of intestinal microbes in mice. Upon detailed analysis, the chief reason behind this complexity is that the main component of the diets is grain (rice and wheat) that contains more cellulose. The cellulose is decomposed by a large numbers of intestinal microorganisms. Thus, the intestine becomes the place of growth and reproduction of microorganisms. However, intestinal microbes and their metabolites affect nutrient digestion and absorption, energy balance, immunologic function, and other important physiological activities. Intestines and microbes keep and maintain a mutualistic relationship, which results from mutual selection and adaptation between the host and intestinal microbes in the course of long-term coevolution.
The dominant microfloras were identified, and the dominant genera were Lactobacillus, Staphylococcus and Clostridium, among others. These genera are microflora normally found in mammalian intestines, which is consistent with the results of Zhu [25].
The experimental results show that the diversity of intestinal microbes in mice fed with GM Bar68-1 rice is the same as that in mice fed with D68 (non-GM) rice. Moreover, the homogeneity of intestinal microbes in mice fed with GM Bar68-1 rice is higher compared with the mice fed with D68 (non-GM) rice. The effect of Bartransgenic rice on the intestinal microflora is considered insignificant due to the following reasons:
1) The bialaphos resistance gene is derived from Streptamyces hygroscopicus, and its expression products are phosphinthricin acetyltransferase (PAT). PAT acetylizes the free amino of phosphinothricin (PPT), which is the main component of glufosinate in herbicides. However, PAT cannot restrain the activity of glutamine synthetase. Thus, PAT can induce transgenic crops to become resistant to herbicide, and the toxicity caused by glufosinate is eliminated [26]. S. hygroscopicus, which are a part of the biosphere, are widespread in nature. In Streptomyces, a few strains are related to the pathogens of human beings, animals, and plants.
2) PAT, which is expressed by the Bar gene, can disappear from the digestive juices and has no homology with known toxalbumin. Moreover, PAT does not have any features of allergen, such as heat stability, digestive stability, absent glycosylation site, and so on. Thus far, no study has reported on the toxicity of homologs in the acetyltransferase family and PAT on human beings and animals.
3) The amount of PAT expressed in plants is very low. Thus, PAT is relatively safe compared with other allergens [27].
5. ACKNOWLEDGEMENTS
We thank Dr. Xiao Guoying of the Research Institute of Subtropical Agricultural Ecology of the Chinese Academy of Science for providing the Bar-transgenic rice, and Dr. Tang Xiangshan of the Research Institute of Subtropical Agricultural Ecology of the Chinese Academy of Science for his insights and invaluable assistance.
NOTES