BEST3-Mediated Promotion of RANKL Expression in ST2 Cells

Abstract

Objective: Skeletal mandibular protrusion, is prevalent in the Japanese population. Despite therapeutic interventions during the developmental stages, some individuals experience recurrence from mandibular overgrowth. Therefore, it is imperative to identify the factors contributing to mandibular overgrowth. Recent studies have identified nonsynonymous mutations in BEST3 in Japanese patients with mandibular prognathism. However, the specific role of BEST3 in bone metabolism remains unclear. This study aimed to investigate the effect of BEST3 on bone differentiation. Mouse mesenchymal-derived ST2 cells were transfected with BEST3, and the expression of genes associated with mineralization, osteoblast differentiation, and osteoclast differentiation was analyzed. Methods: Mouse ST2 cells were maintained in RPMI1640 medium. Osteoblastic differentiation was induced using α-MEM supplemented with ascorbic acid and β-glycerophosphate. Mineralization was assessed by Alizarin Red S staining. A BEST3 expression vector (pBEST3) was constructed using cDNA derived from HEK293 cells and transfected with Xfect for transient overexpression. Gene expression was evaluated using RT-qPCR of total RNA, and RANKL expression was quantified by ELISA. Results: The overexpression of BEST3 did not influence osteoblast differentiation or mineralization. Furthermore, the expression of bone formation-related genes, including Bmp2, Bmp4, Alp, Col1a1, and Bglap, remained largely unaffected despite the overexpression of BEST3. In contrast, there was a significant upregulation in the expression of osteoclast differentiation factors, notably RANKL (Tnfsf11) and M-CSF (Csf1). Overexpression of BEST3 was correlated with increased RANKL protein levels. Conclusion: Overexpression of ectopic BEST3 in osteoblast-like ST2 cells promotes RANKL gene and protein expression.

Share and Cite:

Kosuda, K. , Maeda, T. , Yamanobe, S. and Kawanabe, H. (2026) BEST3-Mediated Promotion of RANKL Expression in ST2 Cells. CellBio, 15, 1-15. doi: 10.4236/cellbio.2026.151001.

1. Introduction

Skeletal mandibular prognathism is characterized by mesial positioning the mandibular first molar relative to the maxillary first molar. Angle Class III malocclusion is associated with numerous combinations of skeletal and dental morphological variations [1]. The prevalence of Angle Class III malocclusion in Caucasians ranges from 0.48% to 4% [2]; however, it exceeds 10% in Japanese individuals [3]. Angle Class III malocclusion can cause speech disorders and impaired mastication. Among adult patients with mandibular prognathism, occasional cases require orthodontic treatment alone, as well as orthognathic surgery [4]. Orthodontic treatment is frequently performed in adult patients with mandibular prognathism. For younger patients with mandibular prognathism, orthopedic treatment using appliances to restrict mandibular growth during the growth phase has been performed. However, in recent years, growth-inhibiting orthodontic treatment has been discouraged because of concerns regarding its impact on temporomandibular joint disorders. Due to genetic factors and other causes, the mandible may grow excessively, leading to the recurrence of mandibular prognathism in the late growth phase. Consequently, some patients may require orthognathic surgery. If orthodontists can predict whether a patient has strong risk factors for excessive mandibular growth, they may be able to select strategies for more effective treatment of mandibular prognathism [5]-[8].

Best vitelliform macular dystrophy (BVMD Best disease) is an autosomal dominant hereditary disorder discovered by Friedrich Best in 1905 and is characterized by the abnormal accumulation of lipofuscin within and beneath retinal pigment epithelial cells. Petrukhin et al. analyzed the best disease families and discovered in 1998 that the cause lies in the retina-specific gene VMD2, located on chromosome 11q13 [9]. VMD2 was renamed Bestrophin-1 (BEST1), and BEST2, BEST3, and BEST4 were identified through homology searches and organized into the Bestrophin family. The Bestrophin family comprises intracellular proteins and proteins detectable in the plasma membrane. They share a common structure, featuring a consensus sequence containing four transmembrane domains, and form pentamers that function on the membrane. Their common function is to act as Ca2+-dependent anion channels (e.g., for Cl−) [10]-[12].

BEST1 is an integral membrane protein primarily expressed in the retinal pigment epithelium (RPE) and localized in the basal lamina [13]. Within the RPE, BEST1 functions as both an anion channel and a regulator of intracellular calcium signaling [10]. Additionally, BEST1 is expressed in the brain and is involved in the transport of glutamate and GABA [14] [15]. On the other hand, BEST2 is known to be involved in the sweating mechanism [16] and the maintenance of intraocular pressure [17].

The BEST3 gene (NM_032735.3) is located on chromosome 12, consisting of 10 exons and 9 introns [18]. The BEST3 protein (NP_116124.2) translated from this gene is approximately 76 kDa and has been confirmed to be expressed in many organs, including skeletal muscle, the brain, the thymus, the adrenal glands, and the stomach [19]. BEST3 differs from other members of the Bestrophin family in that it possesses a long intracellular C-terminus containing a region with a protein kinase G consensus sequence [10] and is ubiquitously distributed throughout various organs. In addition to its previously reported function as a Ca2+-dependent anion channel, BEST3 has been found to possess anti-apoptotic functions in arterial smooth muscle cells [20] and anti-inflammatory effects in endothelial cells [21]. Recently, whole-exome analysis of Japanese patients with mandibular prognathism revealed a non-synonymous single nucleotide variant (SNV) in the BEST3 gene [22]. However, the specific function of BEST3 in bone differentiation and metabolism remains unclear. Therefore, in this study, we investigated the effects of the BEST3 gene on the differentiation of undifferentiated mesenchymal cells using cultured mesenchymal cells as a model system.

2. Materials and Methods

2.1. Reagents

RPMI 1640 medium, simvastatin, and p3xFLAG-CMV-10 were purchased from Sigma-Aldrich (MO, USA); Minimum Essential Media Alpha (α-MEM) was purchased from MP Bio (CA, USA); and ascorbic acid and glycerol-2-phosphate were purchased from Wako Pure Chemical Industries (Tokyo, Japan). Fetal bovine serum (FBS) was obtained from Hyclone (UT, USA); Prime STAR GXL DNA Polymerase and Xfect Transfection Reagent were obtained from Takara Bio (Tokyo, Japan); High Capacity RNA-to-cDNA was obtained from Thermo Fisher Scientific (MA, USA); and GoTaq qPCR Master Mix was obtained from Promega (WI, USA).

2.2. Cell Culture and Differentiation Induction

Mouse ST2 cells were maintained in basic culture at 37˚C and 5% CO2. This culture was performed in 10 cm dishes, maintaining a cell density not exceeding 2 × 106 cells [23]. The medium consisted of RPMI 1640 supplemented with 10% FBS and was changed every 2 - 3 days. For osteoblast differentiation, α-MEM medium supplemented with 10% FBS, 50 μg/ml ascorbic acid, and 10 mM β-glycerophosphate was used, with 1 μM simvastatin added as a calcification promoter [24].

2.3. Measurement of Calcification

1 × 105 cells were seeded per well in a 24-well plate. After reaching confluence, the medium was changed to α-MEM and cultured further. After removing the medium, ST2 cells, were washed with Mg2+/Ca2+-free Dulbecco’s phosphate-buffered saline (PBS) and fixed in 70% ethanol for 1 hour. After washing three times with distilled water, the cells were stained with 40 mM Alizarin Red S (pH 4.2). The red-stained areas were identified as calcified deposits [25]. Two independent biological experiments were performed, and each biological replicate was analyzed using four technical replicates.

2.4. Construction of the BEST3 Expression Vector and Transfection

HEK293 cells were washed with PBS and then lysed inguanidine lysis buffer (4 M guanidine thiocyanate, 25 mM sodium citrate (pH 7.0), 0.5% sodium N-lauroylsarcosylate, 100 mM mercaptoethanol. Total RNA was extracted using the Acid Guanidinium Thiocyanate-Phenol-Chloroform Extraction (AGPC) method). This RNA was used to synthesize cDNA corresponding to the coding region of BEST3 (NM_032735.3) via reverse transcription using SuperScript IV Reverse Transcriptase. Following amplification with Prime STAR GXL DNA Polymerase, this was used as a template for cloning. This PCR product was cloned into p3 × FLAG-CMV-10 using the In-Fusion® Cloning Kit (Takara Bio) via the SLiCE (Seamless Ligation Cloning Extract) method to create the BEST3 expression vector (pBEST3) (Figure 1). An empty vector without the insert was used as the control (MOCK). Cell transfection was performed using the lipofection method with XfectTM Transfection Reagent. Furthermore, all experiments were conducted using transient expression systems without selecting stable vector-transfected cells [26].

3 × FLAG CMV10 possesses a CMV promoter that drives the transcription of downstream sequences in mammalian cells. We removed the 3 × FLAG sequence from this vector and ligated a 2,007 bp coding region of the human BEST3 gene (NM_032735.3) to generate pBEST3 (A), which was used in the experiments. Additionally, a construct derived from 3 × FLAG CMV10, with the 3 × FLAG sequence removed, was used as a control (MOCK [B]). The 3 × FLAG CMV10 vector contains a neomycin resistance cassette (Neo) for the selection of stably expressing cells. In this study, G418 antibiotics were not used and no specific cells were selected.

Figure 1. Vector map used for gene introduction.

2.5. Reverse-Transcription Quantitative Polymerase Chain Reaction (RT-qPCR)

After reverse transcription of total RNA using the High Capacity RNA-to-cDNA Kit, qPCR was performed using GoTaq qPCR Master Mix with the respective primers (Table 1). Detection was performed using a Thermal Cycler Dice Real Time System TP951 (Takara Bio) [27]. Three independent biological experiments were performed, and each biological replicate was analyzed using three technical replicates.

Table 1. Specific primers used for RT-qPCR.

Gene

Sequence (5'->3')

Product

BEST3

Forward

AGCTGCTGAC TACTGCATAC CCTCATTTC

247 bp

(NM_032735.3)

Reverse

GGCTGGGCTGAGGTCATCTCG

Bmp2

Forward

TGACTGGATCGTGGCACCTC

112 bp

(NM_007553.3)

Reverse

CAGAGTCTGCACTATGGCATGGTTA

Bmp4

Forward

AGCCGAGCCAACACTGTGAG

68 bp

(NM_007554.2)

Reverse

TCACTGGTCCCTGGGATGTTC

Bglap3

Forward

CTGAGTCTGACAAAGCCTTCA

137 bp

(NM_001305448.1)

Reverse

AGCAGGGTCAAGCTCACATA

Alp

Forward

AGCAGGGTCAAGCTCACATA

192 bp

(NM_007431.3)

Reverse

ATGGCCTGGTCCATCTCCAC

Col1a1

Forward

GACATGTTCAGCTTTGTGGACCTC

119 bp

(NM_007742.4)

Reverse

ATGGCCTGGTCCATCTCCAC

Col3a1

Forward

TGACTGTCCCACGTAAGCAC

105 bp

(NM_009930.2)

Reverse

GAGGGCCATAGCTGAACTGA

Tnfsf11

Forward

GTACTTTCGAGCGCAGATGGA

103 bp

(NM_011613.4)

Reverse

CGAGTCCTGCAAATCTGCGT

Tnfrsf11b

Forward

CACATTTGGCCTCCTGCTAATTC

107 bp

(NM_008764.4)

Reverse

ATGGCCTGGTCCATCTCCAC

Csf1

Forward

TAGACCAGGAACAGCTGGATGAT

111 bp

(NM_007778.4)

Reverse

TAGCATTGGGGGTGTTGTCTTTA

Actb

Forward

CATCCGTAAAGACCTCTATGCCAAC

171 bp

(NM_007393.5)

Reverse

ATGGAGCCACCGATCCACA

2.6. ELISA

ST2 cells, seeded at 4 × 105 cells per well in a 6-well plate and cultured for a specified period after transfection, were resuspended in 200 μL of RIPA buffer (50 mM Tris-HCl, pH 8.0; 150 mM NaCl; 0.5% sodium deoxycholate; 0.1% sodium dodecyl sulfate; 1.0% NP-40). The lysate was sonicated on ice, centrifuged at 2,000 × g at 4˚C for 1 minute, and the supernatant was used as the sample. The RANKL concentration in these samples was measured using a sandwich ELISA kit (Proteintech, Shanghai, China) [28]. ELISA was performed in two independent biological experiments, with each biological replicate analyzed in triplicate technical replicates.

2.7. Statistical Analysis

Statistical analyses were performed separately at each culture time point using one-way analysis of variance (ANOVA) followed by Scheffe’s post hoc test to compare the experimental groups. Statistical significance was set at P < 0.05.

3. Results

3.1. Effect of Calcification Granule Accumulation on Ectopic Overexpression of BEST3

We verified whether BEST3 is expressed in ST2 cells transfected with pBEST3. ST2 cells transfected with MOCK or pBEST3 were cultured for 48 h. Total RNA was extracted, and RT-qPCR was performed. Human BEST3 was not detected in MOCK-transfected cells. In cells transfected with pBEST3, amplification was observed, with a CT value of 20.05 ± 1.034. Since this value is approximately 2.6 times higher than the Actb CT value of 17.37 ± 0.241, it was determined that the gene expression level was approximately one-sixth that of Actb (Table 2 upper panel).

Table 2. Ct values for BEST3 in RT-qPCR. upper panel.

upper panel

CT value

MOCK

pBEST3

BEST3

-

20.05 ± 1.034

Actb

17.49 ± 0.806

17.37 ± 0.241

lower panel

These cells were seeded at 1 × 105 cells per well in a 24-well multi-plate, and β-glycerophosphate and ascorbic acid were added, with simvastatin used as a calcification promoter. Alizarin Red S staining was performed after 21 days. In the absence of simvastatin, almost no calcified particle accumulation was observed in the MOCK-transfected cells. No accumulation of calcified particles was observed in cells expressing BEST3. The addition of 10−6 M simvastatin increased the number of calcification particles stained with Alizarin Red S. However, no significant change in the accumulation of calcification particles was observed in pBEST3-transfected cells compared to MOCK-transfected cells (Figure 2).

ST2 cells were cultured in a 24-well plate, and either MOCK or pBEST3 cells were introduced for 21-day culture period. During the 21-day culture period, 1 × 10−6 M simvastatin or solvent (70% ethanol) was added.

Figure 2. Alizarin Red S staining image on day 21 of culture.

3.2. Effects of BEST3 on the Expression of Early Osteoblast Differentiation Markers

The following experiment was conducted to verify whether the ectopic overexpression of BEST3 directly affected the early stages of osteoblast differentiation. ST2 cells were seeded at a density of 4 × 105 cells per well in a 6-well multi-plate. When cells reached 50% confluence, pBEST3 or MOCK (7.5 μg/well) was introduced. After reaching confluence, the medium was replaced with a medium containing β-glycerophosphate and ascorbic acid, and the cells were cultured for 6 days, with samples collected every 2 days. Total RNA was extracted from the samples using the AGPC method and subjected to qPCR analysis. In MOCK-transfected cells, Bmp2 gene expression increased approximately 200-fold by day 6 compared to day 0. However, BEST3 overexpression did not affect this increase (Figure 3A). Bmp4 expression showed no significant changes in MOCK-transfected cells until day 6. This was also observed in the cells transfected with pBEST3 (Figure 3B).

ST2 cells were cultured in 6-well plates and treated with MOCK or pBEST3 for 6 days. Cells were harvested every 2 d, and gene expression levels were detected by RT-qPCR. Results were normalized to Actb expression (n = 4). Statistical significance was set at P < 0.05.

Figure 3. Time-course gene expression changes of bone metabolism markers during early culture.

3.3. Effects of BEST3 on Gene Expression in the Bone Matrix

Gene expression of osteocalcin (Bglap3), a protein specific to hard tissues, increased in MOCK-transfected cells up to day 6 of culture. pBEST3 transfection did not significantly affect this increase (Figure 3C). Gene expression of tissue-nonspecific alkaline phosphatase (Alp) was significantly increased in MOCK-transfected cells on day 4 compared with that on day 0. In contrast, BEST3 overexpression did not result in a significant change compared to that on day 0, even on day 4 (Figure 3D). The expression of the gene for the pro-α1 chain of type I collagen (Col1a1), a major fibrous protein in bone, increased as culture progressed. Even when pBEST3 was introduced, there was no significant difference compared to the MOCK group (Figure 3E). Similarly, for the gene encoding the pro-α1 chain of type III collagen (Col3a1), BEST3 overexpression did not affect its expression levels (Figure 3F).

3.4. Effects of BEST3 on the Expression of Osteoclast Differentiation Markers

Overexpression of BEST3 significantly increased the expression level of the RANKL gene (Tnfsf11), an osteoclast differentiation and activation factor, up to day 16 of culture (Figure 4A). This change was maintained even after the addition of statins (Figure 4B). Expression of OPG (Tnfrsf11b), a decoy receptor for RANKL, was not affected by BEST3 overexpression (Figure 4C, Figure 4D). The expression level of the M-CSF gene significantly increased from day 4 to day 16 of culture following simvastatin addition, and BEST3 overexpression further enhanced this increase (Figure 4E, Figure 4F).

ST2 cells were cultured and treated with MOCK or pBEST3 for 24 days. Cells were harvested every 4 days, and gene expression levels were detected by RT-qPCR. Gene expression levels were normalized against Actb expression (n = 3). A - B: RANKL gene (Tnfsf11) expression; A: No simvastatin 1 × 10−6 M (Vehicle); B: Simvastatin 1 × 10−6 M (ST). C-D: OPG gene (Tnfrsf11b) expression; C: No simvastatin 1 × 10−6 M (Vehicle); D: Simvastatin 1 × 10−6 M (ST). E-F; M-CSF gene (Csf1) expression, E; No simvastatin 1 × 10−6 M added (Vehicle), F; Simvastatin 1 × 10−6 M added (ST). ***indicates p < 0.001 compared to MOCK, and * indicates p < 0.05 compared to MOCK (n = 3).

Figure 4. Time-course gene expression changes of factors influencing osteoclast differentiation following pBEST3 introduction.

3.5. Effect of BEST3 on RANKL Protein Expression

Finally, ELISA was performed to confirm whether BEST3-induced Tnfsf11 expression altered the protein translation levels. Consistent with the changes in mRNA levels, the introduction of pBEST3 significantly increased total cellular RANKL by approximately fourfold by day 14 of culture (Figure 5).

ST2 cells were cultured in 6-well multi-plates and transfected with MOCK or pBEST3, then cultured for 21 days. Cells were harvested every 7 days, washed with PBS, lysed in 200 μL of RIPA buffer, sonicated, and the supernatant was used for RANKL ELISA. ***indicates p < 0.001 compared to MOCK (n = 4).

Figure 5. Effect of pBEST3 transfection on RANKL protein expression.

4. Discussion

A whole-exome analysis of Japanese patients with skeletal mandibular prognathism reported the presence of a nonsynonymous single-nucleotide variant of BEST3 [22]. BEST3 mRNA undergoes various alternative splicing processes [18] [21] [29]-[32]. Among these variants, some lack an ion-conducting domain and their functions remain unknown. Thus, the functional implications of the L606I variant discovered by Kajii et al. [22] remain unclear. Therefore, we conducted this study to test the hypothesis that BEST3 itself may exert some influence on bone formation and metabolism. Human BEST3 cDNA was overexpressed in mouse ST2 cells, because few established human mesenchymal cell lines reproducibly undergo osteoblastic differentiation and mineralization while retaining the characteristics of multipotent undifferentiated mesenchymal cells.

Transient forced expression of pBEST3 leads to ectopic expression of BEST3. This represents approximately one-sixth of the expression level of Actb, which is known to be expressed at relatively high levels, indicating that BEST3 was ectopically expressed at a lower level than Actb (Table 2). One possible concern was that the detected BEST3 amplification reflected amplification of endogenous mouse Best3. This possibility was considered unlikely, because no amplification was observed in the MOCK control group, even after 65 cycles of qPCR. Moreover, the antisense primer shared only 42.9% sequence homology with mouse Best3, making amplification of the endogenous mouse transcript highly improbable (Table 2, lower panel). Overexpression of BEST3 neither promoted calcification in ST2 cells cultured for 3 weeks in α-MEM medium supplemented with β-glycerophosphate and ascorbic acid nor suppressed the promotion of calcification induced by simvastatin (Figure 2). These results suggest several possible explanations. (1) BEST3 drives factors that both induce and suppress calcification accumulation. (2) Although BEST3 induces (or suppresses) the expression of osteoblast differentiation factors, its transient expression prevents maintenance of this phenotype until calcified granules accumulate. (3) BEST3 did not affect ST2 differentiation. To investigate these possibilities, we monitored the gene expression of BMP-2 and BMP-4 [33], proteins that play central roles in bone differentiation, every other day until day 6 of culture—a time point known to maintain sufficient expression even with transient gene transfection (Figure 3A, Figure 3B). The results showed that BEST3 did not cause any significant changes in the expression of Bmp2 or Bmp4. This was also true for the gene expression of osteocalcin [34], a bone-specific non-fibrillar protein (Figure 3C), alkaline phosphatase (Figure 3D), and the pro-α-chain genes of type I and type III collagen (Figure 3E, Figure 3F). These results suggest that the ectopic overexpression of BEST3 does not affect ST2 cell differentiation.

We investigated how BEST3 expression affects the differentiation and activation of osteoclasts, which regulate bone mass changes in vivo [35]. BEST3 overexpression in ST2 cells significantly induced the expression of Tnfsf11, a gene encoding RANKL (Figure 4A, Figure 4B). However, it had little effect on the expression of Tnfrsf11b, which encodes OPG (Figure 4C, Figure 4D). Even after the addition of simvastatin, no significant changes in Tnfsf11 and Tnfrsf11b expression were observed. In contrast, the gene expression of Csf1, the gene encoding M-CSF, showed almost no change with pBEST3 introduction in the absence of simvastatin (Figure 4E), but increased significantly on days 8 - 12 in the presence of simvastatin compared to the absence of simvastatin, and pBEST3 introduction further accentuated this (Figure 4F). A possible explanation for this is that BEST3, like simvastatin, may inhibit the prenylation of Rho to the cell membrane [36]; however, since it did not promote Bmp2 expression (Figure 3A), this possibility appears extremely unlikely. Furthermore, changes in Tnfsf11 and Csf1 expression induced by BEST3 overexpression appeared from day 8 of culture. This suggests the following possibilities: 1: Ectopically overexpressed BEST3 acts on something, which indirectly promotes the expression of Tnfsf11 and Csf1. 2: The decline in transiently overexpressed BEST3 triggers the promotion of Tnfsf11 and Csf1 expression. These mechanisms remain unclear. However, it is clear that BEST3 expression in osteoblasts promotes, at a minimum, the expression of RANKL. Importantly, the increase in Tnfsf11 expression without a corresponding increase in Tnfrsf11b expression is expected to increase the functional RANKL/OPG ratio, thereby favoring osteoclast differentiation and activation. Furthermore, the concomitant increase in Csf1 expression would be expected to further promote osteoclastogenesis by supporting the survival, proliferation, and differentiation of osteoclast precursor cells. Taken together, these findings suggest that, if similar changes occur in vivo, BEST3 overexpression may create a microenvironment favorable for osteoclast formation and bone remodeling. Further research is needed to determine whether this is associated with the genetic factors underlying skeletal mandibular prognathism.

The gene transfer method used in this study was transient transfection rather than stable transfection. Successful BEST3 overexpression was confirmed by RT-qPCR at 48 h after transfection. In proliferating cells, transiently transfected plasmids generally produce maximal mRNA and protein expression within 24 - 72 h after transfection, after which expression gradually declines and is typically lost within approximately 7 days as the plasmid is diluted during cell division [37]. Because we did not directly monitor the duration of BEST3 overexpression throughout the differentiation period, the persistence of transgene expression beyond the early post-transfection phase remains unknown and should be considered a limitation of this study. Nevertheless, the delayed changes in Tnfsf11 and Csf1 expression observed in the present study suggest that transient BEST3 overexpression may initiate downstream regulatory events rather than directly maintaining their expression.

5. Conclusion

Overexpression of ectopic BEST3 in osteoblast-like ST2 cells promotes RANKL gene and protein expression.

Acknowledgements

We express our sincere gratitude to the faculty of the Department of Growth and Developmental Dentistry (Division of Orthodontics) for their guidance throughout the study.

This study was approved by the Ohu University Genetic Recombination Safety Committee (2022001-3) and was conducted in accordance with the Ohu University Regulations on the Safety Management of Genetic Recombination Experiments.

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

References

[1] Xue, F., Wong, R.W. and Rabie, A.B. (2010) Genes, Genetics, and Class III Malocclusion. Orthodontics & Craniofacial Research, 13, 69-74.[CrossRef] [PubMed]
[2] Emrich, R.E., Brodie, A.G. and Blayney, J.R. (1965) Prevalence of Class I, Class II, and Class III Malocclusions (Angle) in an Urban Population an Epidemiological Study. Journal of Dental Research, 44, 947-953.[CrossRef] [PubMed]
[3] Nakasima, A., Ichinose, M. and Nakata, S. (1986) Genetic and Environmental Factors in the Development of So-Called Pseudo-and True Mesioclusions. American Journal of Orthodontics and Dentofacial Orthopedics, 90, 106-116.[CrossRef] [PubMed]
[4] Szuhanek, C., Gâdea Paraschivescu, E., Sişu, A.M. and Motoc, A. (2011) Cephalometric Investigation of Class III Dentoalveolar Malocclusion. Romanian Journal of Morphology and Embryology, 52, 1343-1346.
[5] Ikuno, K., Kajii, T.S., Oka, A., Inoko, H., Ishikawa, H. and Iida, J. (2014) Microsatellite Genome-Wide Association Study for Mandibular Prognathism. American Journal of Orthodontics and Dentofacial Orthopedics, 145, 757-762.[CrossRef] [PubMed]
[6] Stiles, K.A. and Luke, J.E. (1953) The Inheritance of Malocclusion Due to Mandibular Prognathism. Journal of Heredity, 44, 241-245.[CrossRef]
[7] Kraus, B.S., Wise, W.J. and Frei, R.H. (1959) Heredity and the Craniofacial Complex. American Journal of Orthodontics, 45, 172-217.[CrossRef]
[8] Mossey, P.A. (1999) The Heritability of Malocclusion: Part 1—Genetics, Principles and Terminology. British Journal of Orthodontics, 26, 103-113.[CrossRef] [PubMed]
[9] Bakall, B., Marknell, T., Ingvast, S., Koisti, M.J., Sandgren, O., Li, W., et al. (1999) The Mutation Spectrum of the Bestrophin Protein—Functional Implications. Human Genetics, 104, 383-389.[CrossRef] [PubMed]
[10] Hartzell, H.C., Qu, Z., Yu, K., Xiao, Q. and Chien, L. (2008) Molecular Physiology of Bestrophins: Multifunctional Membrane Proteins Linked to Best Disease and Other Retinopathies. Physiological Reviews, 88, 639-672.[CrossRef] [PubMed]
[11] Qu, Z. and Hartzell, H.C. (2008) Bestrophin Cl− Channels Are Highly Permeable to HCO− 3. American Journal of Physiology-Cell Physiology, 294, C1371-C1377.[CrossRef] [PubMed]
[12] Xiao, Q., Hartzell, H.C. and Yu, K. (2010) Bestrophins and Retinopathies. Pflügers Archiv-European Journal of Physiology, 460, 559-569.[CrossRef] [PubMed]
[13] Marmorstein, A.D., Marmorstein, L.Y., Rayborn, M., Wang, X., Hollyfield, J.G. and Petrukhin, K. (2000) Bestrophin, the Product of the Best Vitelliform Macular Dystrophy Gene (vmd2), Localizes to the Basolateral Plasma Membrane of the Retinal Pigment Epithelium. Proceedings of the National Academy of Sciences, 97, 12758-12763.[CrossRef] [PubMed]
[14] Jo, S., Yarishkin, O., Hwang, Y.J., Chun, Y.E., Park, M., Woo, D.H., et al. (2014) GABA from Reactive Astrocytes Impairs Memory in Mouse Models of Alzheimer's Disease. Nature Medicine, 20, 886-896.[CrossRef] [PubMed]
[15] Lee, S., Yoon, B.E., Berglund, K., Oh, S., Park, H., Shin, H., et al. (2010) Channel-Mediated Tonic GABA Release from Glia. Science, 330, 790-796.[CrossRef] [PubMed]
[16] Cui, C.Y., Childress, V., Piao, Y., Michel, M., Johnson, A.A., Kunisada, M., et al. (2012) Forkhead Transcription Factor FoxA1 Regulates Sweat Secretion through Bestrophin 2 Anion Channel and Na-K-Cl Cotransporter 1. Proceedings of the National Academy of Sciences, 109, 1199-1203.[CrossRef] [PubMed]
[17] Bakall, B., McLaughlin, P., Stanton, J.B., Zhang, Y., Hartzell, H.C., Marmorstein, L.Y., et al. (2008) Bestrophin-2 Is Involved in the Generation of Intraocular Pressure. Investigative Opthalmology & Visual Science, 49, 1563-1570.[CrossRef] [PubMed]
[18] Luck, K., Kim, D.K., Lambourne, L., Spirohn, K., Begg, B.E., Bian, W., et al. (2020) A Reference Map of the Human Binary Protein Interactome. Nature, 580, 402-408.[CrossRef] [PubMed]
[19] Tsunenari, T., Sun, H., Williams, J., Cahill, H., Smallwood, P., Yau, K.W., et al. (2003) Structure-Function Analysis of the Bestrophin Family of Anion Channels. Journal of Biological Chemistry, 278, 41114-41125.[CrossRef] [PubMed]
[20] Jiang, L., Liu, Y., Ma, M.M., Tang, Y.B., Zhou, J.G. and Guan, Y.Y. (2013) Mitochondria Dependent Pathway Is Involved in the Protective Effect of Bestrophin-3 on Hydrogen Peroxide-Induced Apoptosis in Basilar Artery Smooth Muscle Cells. Apoptosis, 18, 556-565.[CrossRef] [PubMed]
[21] Song, W., Yang, Z. and He, B. (2014) Bestrophin 3 Ameliorates TNFα-Induced Inflammation by Inhibiting NF-κB Activation in Endothelial Cells. PLOS ONE, 9, e111093.[CrossRef] [PubMed]
[22] Kajii, T.S., Oka, A., Saito, F., Mitsui, J. and Iida, J. (2019) Whole-Exome Sequencing in a Japanese Pedigree Implicates a Rare Non-Synonymous Single-Nucleotide Variant in BEST3 as a Candidate for Mandibular Prognathism. Bone, 122, 193-198.[CrossRef] [PubMed]
[23] Maeda, T., Kawane, T. and Horiuchi, N. (2003) Statins Augment Vascular Endothelial Growth Factor Expression in Osteoblastic Cells via Inhibition of Protein Prenylation. Endocrinology, 144, 681-692.[CrossRef] [PubMed]
[24] Maeda, T., Matsunuma, A., Kurahashi, I., Yanagawa, T., Yoshida, H. and Horiuchi, N. (2004) Induction of Osteoblast Differentiation Indices by Statins in MC3T3‐E1 Cells. Journal of Cellular Biochemistry, 92, 458-471.[CrossRef] [PubMed]
[25] Maeda, T., Matsunuma, A., Kawane, T. and Horiuchi, N. (2001) Simvastatin Promotes Osteoblast Differentiation and Mineralization in MC3T3-E1 Cells. Biochemical and Biophysical Research Communications, 280, 874-877.[CrossRef] [PubMed]
[26] Hatori, T., Maeda, T., Suzuki, A., Takahashi, K. and Kato, Y. (2023) SPARC Is a Decoy Counterpart for c-Fos and Is Associated with Osteoblastic Differentiation of Bone Marrow Stromal Cells by Inhibiting Adipogenesis. Molecular Medicine Reports, 27, Article No. 50.[CrossRef] [PubMed]
[27] Sumida, R., Maeda, T., Kawahara, I., Yusa, J. and Kato, Y. (2019) Platelet-Rich Fibrin Increases the Osteoprotegerin/Receptor Activator of Nuclear Factor-κB Ligand Ratio in Osteoblasts. Experimental and Therapeutic Medicine, 18, 358-365.[CrossRef] [PubMed]
[28] Maeda, T., Suzuki, A., Yuzawa, S., Baba, Y., Kimura, Y. and Kato, Y. (2015) Mineral Trioxide Aggregate Induces Osteoblastogenesis via Atf6. Bone Reports, 2, 36-43.[CrossRef] [PubMed]
[29] Marquardt, A., Stöhr, H., Passmore, L.A., Krämer, F., Rivera, A. and Weber, B.H. (1998) Mutations in a Novel Gene, VMD2, Encoding a Protein of Unknown Properties Cause Juvenile-Onset Vitelliform Macular Dystrophy (Best’s Disease). Human Molecular Genetics, 7, 1517-1525. [Google Scholar] [CrossRef] [PubMed]
[30] Stöhr, H., Marquardt, A., Nanda, I., Schmid, M. and Weber, B.H.F. (2002) Three Novel Human VMD2-Like Genes Are Members of the Evolutionary Highly Conserved RFP-TM Family. European Journal of Human Genetics, 10, 281-284.[CrossRef] [PubMed]
[31] Qu, Z.Q., Yu, K., Cui, Y.Y., Ying, C. and Hartzell, C. (2007) Activation of Bestrophin Cl– Channels Is Regulated by C-Terminal Domains. Journal of Biological Chemistry, 282, 17460-17467.[CrossRef] [PubMed]
[32] Marsey, L.L. and Winpenny, J.P. (2009) Bestrophin Expression and Function in the Human Pancreatic Duct Cell Line, CFPAC‐1. The Journal of Physiology, 587, 2211-2224.[CrossRef] [PubMed]
[33] Reddi, A.H. (1994) Bone and Cartilage Differentiation. Current Opinion in Genetics & Development, 4, 737-744.[CrossRef] [PubMed]
[34] Burnier, J.P., Borowski, M., Furie, B.C. and Furie, B. (1981) Gamma-Carboxyglutamic Acid. Molecular and Cellular Biochemistry, 39, 191-207.[CrossRef] [PubMed]
[35] Hofbauer, L.C., Khosla, S., Dunstan, C.R., Lacey, D.L., Boyle, W.J. and Riggs, B.L. (2000) The Roles of Osteoprotegerin and Osteoprotegerin Ligand in the Paracrine Regulation of Bone Resorption. Journal of Bone and Mineral Research, 15, 2-12.[CrossRef] [PubMed]
[36] Matsunuma, A., Kawane, T., Maeda, T., Hamada, S. and Horiuchi, N. (2004) Leptin Corrects Increased Gene Expression of Renal 25-Hydroxyvitamin D3-1α-Hydroxylase and-24-Hydroxylase in Leptin-Deficient, ob/ob Mice. Endocrinology, 145, 1367-1375.[CrossRef] [PubMed]
[37] Subramanian, S. and Srienc, F.J. (1996) Quantitative Analysis of Transient Gene Expression in Mammalian Cells Using the Green Fluorescent Protein. Journal of Biotechnology, 49, 137-151.[CrossRef] [PubMed]

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.