1. Introduction
Antibiotics resistance is one of today’s major public health problems responsible for thousands of human fatalities annually [1]-[3].
However, the contribution of wildlife to the spread of antibiotics resistance among different hosts and ecosystems is significant [4] [5]. This wildlife is generally not exposed to clinically used antibiotics [6]. However, wild animals can become infected with antibiotic-resistant bacteria through contact with humans or the environment [7]. Thus, once these animals are contaminated, they can in turn become reservoirs and vectors for the transmission of highly pathogenic bacteria to humans [1] [8] [9]. Indeed, Enterobacteria seem to be more specifically adapted to humans or animals; some are responsible for human infections and sometimes very severe (typhoid fever, bacillary dysentery) in view of their continued resistance and virulence. One of the most striking developments in human and animal antibiotic resistance in recent decades has been the resistance of Enterobacteriaceae to the latest generation of beta-lactams and cephalosporins [10]. This resistance is mainly ensured by the production of extended-spectrum beta-lactamases (ESBL) and to a lesser extent plasmid cephalosporinases (AmpC). These enzymes confer high resistance to most therapeutic beta-lactams (with the notable exception of carbapenems). Their genes, mainly located on plasmids, spread easily between bacteria, thus increasing their resistance to antibiotics [11]-[13]. IMP, which stands for “active against imipenem” or “imipenemase,” is a class B bacterial ambler metabolo-bêta-lactamases that are often found in Pseudomonas aeruginosa but may also be found in enterobacteriaceae (also known as bacteria). There are at least 52 distinct variants in this diverse category of metallo-beta-lactamases (Logan and Weinstein, 2017). The New Delhi Metallo-β-lactamase-1 (NDM-1) presents a challenge in the treatment of bacterial infections by providing resistance to carbapenem antibiotics [14].
Indeed, antibiotic-resistant strains of Enterobacteriaceae have already been isolated from wildlife and, most notably, from bats [15]-[18]. Specimens of Escherichia coli bacteria isolated from insectivorous bats showed 15% resistance to MCA (amoxicillin + clavulanic acid) in surveys [19]. Since we share a common environment between animals and humans, bats usually roost near human dwellings; they are carriers of many microorganisms that are pathogenic to humans and animals [7]. Bat bacterium knowledge is still very scarce, but a few studies have indicated that bats are hosts of antimicrobial resistance and play an important role in the dispersion of resistance in the environment [15]. Worldwide, 32 studies on bacterial resistance in bats have been conducted between 1985 and 2021, including nine in Africa [16]. Among those studies that have already addressed the resistance of bacteria isolated from bats in Africa are: Antimicrobial resistance in Escherichia coli isolates from frugivorous (Eidolon helvum) and insectivorous (Nycteris hispida) bats in Nigeria [19]. However, in Burkina Faso, studies on bat and their pathogens are very fragmentary [20] [21] and no research has yet been conducted on the antibiotic resistance of bacteria in bats in Burkina Faso.
The objective of this survey is to evaluate the resistance of enterobacteria isolated from bats to three families of antibiotics and characterize blaIMP and blaNDM resistance genes in Enterobacteriaceae isolates from bats.
2. Materials and Methods
2.1. Ethics Statement
The code of ethics was obtained from the Ethics Committee on Animal Experimentation of the Joseph KI-ZERBO University (permit no. CODE AGREEMENT: CEEA-UJKZ/2021-04).
The authorization to collect bats was obtained through the implementation of the framework cooperation agreement between Joseph Ki-ZERBO University and the Ministry of the Environment, Green Economy and Climate Change (MEECVCC) (permit no. 21-091 MEECVCC/SG/DGEF/DFRC).
2.2. Study Area
This survey was conducted in six (06) cities in Burkina Faso and each city had several sampling points. The central region had seven sampling points as shown in Figure 1. These sites were chosen based on the presence of waterways, forest galleries, caves and abandoned houses, which are the bats’ preferred locations.
2.3. Sample Collection
Bats were captured using mist nets from December 2020 to September 2021. Mist nets were placed in several places (e.g., dwellings, vegetation galleries, along water points). Care was taken to free the bats, and particular attention was paid to wing clearances because bats enter the nets with their wings spread and then fold them back up. The nets were opened at nightfall from 6 pm to 5 am depending on the activity of the bats.
Each individual was placed in a porous cotton bag and kept until the time of sampling. The risks of contamination were minimized as much as possible by using protective suits during the capture and handling of the bats. In order to identify bats, we determined weight, sex, and forearm length. Weight was measured with the pressure scale. Observation of the presence of male or female genitalia was used to determine the sex of the animal [22]. Bats were identified using the guide and identification key [23]-[25].
Figure 1. Site of capture of bats with the abundance of bats captured on each site.
2.4. Microbiology Analyses
Sterile swabs were used to collect oral and rectal samples from bats under aseptic conditions. Each swab was removed from its packaging without allowing the tip to come into contact with any surface, including gloves. Oral samples were collected by gently rotating the swab inside the oral cavity and behind the tongue. Rectal samples were obtained by carefully inserting the swab tip into the anus and gently rotating it against the mucosal surface for two to four circular motions. Excess fecal material was removed by gentle shaking before placing the swab into a cryovial containing transport medium.
Bacterial isolation was performed using selective and differential media. Swabs were inoculated onto URIselect, Hektoen, and Salmonella-Shigella (SS) agar plates and incubated at 37˚C for 24 h. Suspected colonies were subcultured for purification and identified using the API 20E system (bioMérieux, France).
Antimicrobial susceptibility testing was conducted using the disk diffusion method on Mueller-Hinton agar, in accordance with the guidelines of the Antibiogram Committee of the French Society of Microbiology (CA-SFM). The antibiotics tested included ceftriaxone (CRO; third-generation cephalosporin), amoxicillin-clavulanic acid (AMC; β-lactam), and imipenem (IMI; carbapenem).
A bacterial suspension was prepared from a pure colony in 5 mL of sterile physiological saline and adjusted to 0.5 McFarland turbidity. The suspension was evenly spread onto Mueller-Hinton agar plates (4 mm thickness). Antibiotic discs were aseptically placed on the agar surface at a minimum distance of 20 mm from each other. Plates were incubated at 37˚C for 18 - 24 h.
After incubation, inhibition zone diameters were measured using a calibrated ruler and interpreted according to CA-SFM breakpoints. Isolates were classified as susceptible (S), intermediate (I), or resistant (R). Detection of extended-spectrum β-lactamase (ESBL) production was performed using the double-disk synergy test, based on the interaction between clavulanic acid and third-generation cephalosporins [26].
Quality control for antimicrobial susceptibility testing was performed using reference strains, including Escherichia coli ATCC 25922 (susceptible control) and Klebsiella pneumoniae ATCC 700603 (ESBL-positive control), to validate test performance [13].
2.5. Molecular Analysis
For bacterial nucleic acid extraction, genomic DNA was extracted using the Sacace™ DNA-Sorb-B nucleic acid extraction kit (Version 2020, K-1-1/B/100) according to the manufacturer’s instructions. Real-time polymerase chain reaction (qPCR) was performed to detect two resistance-associated genes, bla_NDM and bla_IMP, which encode New Delhi metallo-β-lactamase and IMP-type metallo-β-lactamase, respectively.
Each PCR run included appropriate quality controls. DNA from known positive strains was used as a positive control (Escherichia coli ATCC 25922), while sterile distilled water was used as a negative control in place of template DNA to detect potential contamination and ensure the reliability of the amplification results (Table 1).
Table 1. Representation of the different primers for real-time PCR.
Genes |
Primers |
Sequences |
Size (bp) |
References |
blaIMP |
For |
5’ CATGGTTTGGTGGTTCTTGT 3’ |
488 |
[27] |
Rev |
5’ ATAATTTGGCGGACTTTGGC 3’ |
blaNDM |
For |
5’ CAGCACACT TCCTATCTC 3’ |
292 |
[27] |
Rev |
5’ CCGCAACCATCCCCTCTT 3’ |
2.6. Statistical Analyses
Statistical analyses were performed using R software (version 4.1.0). Data normality was assessed using the Shapiro-Wilk test and indicated that the variables were not normally distributed. Consequently, non-parametric statistical methods were applied.
Comparisons among groups were conducted using the Kruskal-Wallis rank-sum test for continuous variables. Associations between categorical variables were assessed using Pearson’s Chi-squared test when expected cell frequencies were sufficient. For contingency tables with small sample sizes or expected counts below five, Fisher’s Exact Test was applied to ensure statistical validity.
Proportions and statistical comparisons were calculated using the tbl_summary and add_p functions of the gtsummary package. Standardized Pearson residuals derived from Chi-squared tests were computed to identify cells contributing most strongly to significant associations and were visualized using the assocplot function from the reprex package.
All statistical tests were two-tailed, and a p-value < 0.05 was considered statistically significant.
3. Results
3.1. Bat Diversity and Bacterial Resistance Patterns to three Families of Antibiotics
Of a total of 204 bats captured, 84 bats were positive for the presence of at least one enterobacterium with a prevalence of 41.17%. The infected bats were composed of six genera and nine species, including one frugivore (Epomophorus gambianus (Ogilby, 1835)) and eight insectivores (Hyposideros caffer (Sundevall, 1846)), Hyposideros jonesi Hayman, 1947, Mops condylurus (A. Smith, 1833), Mops midas (Sundevall, 1843), Mops pumilus (Cretzschmar, 1830), Pipistrellus nanulus (Peters, 1868), Rhinolophus alcyone Temminck, 1853, Scotophilus leucogaster (Cretzschmar, 1826). Of the nine bat species, 29 species of enterobacteria were isolated and tested with three families of antibiotics (Table 2).
Table 2. The different bacterial species with their resistance to CRO, AMC, IMI antibiotics isolated from bat species
Bats |
Bacteria species |
ANTIBIOTIC RESISTANCE |
CRO |
AMC |
IMI |
Epomophorus gambianus |
Escherichia coli |
R |
R |
S |
Klebsiella oxytoca |
R |
R |
S |
Citrobacter spp. |
S |
S |
S |
Proteus spp. |
S |
S |
S |
Escherichia coli |
R |
R |
S |
Proteus mirabilis |
S |
R |
S |
Salmonella paratyphi |
R |
R |
S |
Salmonella Typhi |
R |
R |
S |
Continued
|
Escherichia coli |
S |
S |
S |
Enterobacter cloacea |
S |
S |
S |
Citrobacter spp. |
S |
S |
S |
Shigella spp. |
R |
R |
S |
Salmonella spp. |
R |
R |
S |
Klebsiella spp. |
R |
S |
S |
Escherichia coli |
R |
S |
S |
Proteus spp. |
R |
R |
S |
Morganella morganii |
S |
S |
S |
Shigella spp. |
S |
R |
S |
Salmonella spp. |
R |
R |
S |
Escherichia coli |
S |
R |
S |
Klebsiella oxytoca |
S |
S |
S |
Mops midas |
Serratia spp. |
S |
S |
S |
Citrobacter spp. |
S |
S |
S |
Citrobacter spp. |
S |
S |
S |
Klebsiella spp. |
S |
S |
S |
Citrobacter braakii |
S |
S |
S |
Serratia liquefaciens |
S |
S |
S |
Salmonella paratyphi |
R |
R |
S |
Citrobacter spp. |
S |
R |
S |
Citrobacter freundii |
S |
S |
S |
Escherichia coli |
S |
R |
S |
Citrobacter braakii |
S |
S |
S |
Proteus vulgaris |
S |
S |
S |
Escherichia coli |
S |
S |
S |
Enterobacter sakazakii |
S |
S |
S |
Enterobacter aerogenes |
S |
S |
S |
Mops condylurus |
Yersinia enterocolitica |
S |
S |
S |
Salmonella Typhi |
R |
R |
S |
Proteus mirabilis |
S |
R |
S |
Salmonella spp. |
S |
R |
S |
Klebsiella spp. |
R |
R |
S |
Yersinia spp. |
S |
S |
S |
Hafnia alvei |
S |
S |
S |
Escherichia coli |
S |
R |
S |
Escherichia coli |
S |
S |
S |
Klebsiella planticola |
S |
S |
S |
Citrobacter spp. |
S |
S |
S |
Enterobacter spp. |
S |
R |
S |
Continued
|
Salmonella spp. |
R |
R |
R |
Salmonella paratyphi A |
R |
R |
R |
Proteus vulgaris |
S |
S |
S |
Escherichia coli |
R |
S |
S |
Enterobacter cloacea |
S |
S |
S |
Escherichia coli |
S |
S |
S |
Escherichia coli |
S |
S |
S |
Salmonella spp. |
S |
R |
S |
Serratia spp. |
S |
S |
S |
Mops pumilus |
Escherichia coli |
R |
R |
S |
Scotophilus leucogaster |
Klebsiella spp. |
S |
S |
S |
Citrobacter spp. |
S |
S |
S |
Escherichia coli |
S |
S |
S |
Escherichia coli |
S |
S |
S |
Klebsiella spp. |
S |
S |
S |
Salmonella spp. |
R |
R |
S |
Escherichia coli |
S |
R |
S |
Escherichia coli |
S |
S |
S |
Citrobacter spp. |
S |
S |
S |
Klebsiella oxytoca |
R |
R |
S |
Salmonella paratyphi |
S |
R |
S |
Enterobacter spp. |
S |
S |
S |
Escherichia coli |
S |
S |
S |
Escherichia coli |
R |
R |
S |
Escherichia coli |
S |
S |
S |
Hyposideros caffer |
Salmonella spp. |
S |
R |
S |
Escherichia coli |
R |
R |
S |
Escherichia coli |
R |
R |
S |
Hyposideros jonesi |
Klebsiella spp. |
R |
R |
S |
Salmonella spp. |
R |
R |
S |
Pipistrellus nanulus |
Salmonella paratyphi A |
R |
R |
S |
Providencia rettgeri |
S |
S |
S |
Enterobacter cloacea |
S |
S |
S |
Rhinolophus alcyone |
Escherichia coli |
R |
R |
S |
Escherichia coli |
R |
R |
S |
Citrobacter spp. |
R |
R |
S |
Of all the bacteria isolated from bats in Burkina Faso, the majority are sensitive to third generation cephalosporins (CRO), betalactamines (AMC) and almost totally to carbapenems (IMI). There is no difference in resistance and susceptibility of the bacteria between AMC and CRO. The table below shows that 35% of the bacterial species are resistant to 3rd generation cephalosporins, 46% are resistant to betalactam (AMC) and 2.4% are resistant to carbapenems (Figure 2).
Figure 2. Percentage of bacterial profiles according to the three families of antibiotics.
Resistance to CRO was observed in 11 species of bacteria and was 100% in Salmonella Typhi and Salmonella paratyphi A. 13 species showed resistance with AMC and this resistance was 100% in six species, namely Proteus mirabilis, Salmonella Typhi, Salmonella paratyphi, Salmonella paratyphi A, Salmonella spp., and Shigella spp. With IMI, resistance was only observed in two species, Salmonella spp. and Salmonella paratyphi A and it was 100%. (Table 3). Thus, it is clear from Figure 3 that two species of bacteria are resistant to all three families of antibiotics and these are Salmonella spp. and Salmonella paratyphi A. Two species are resistant only to CRO and 13 species only to AMC (Table 3).
Table 3. Abundance and percentage of resistance of bacterial species to the three antibiotic families.
Bacteria |
CRO |
AMC |
IMI |
R |
S |
R |
S |
R |
S |
Klebsiella oxytoca |
2 (66, 66) |
1 (33, 33) |
2 (66, 66) |
1 (33, 33) |
0 (0) |
3 (100) |
Morganella morganii |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
Acinobacter baumaani |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
Acinobacter calcoaceticus, |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
Acinotobacter spp. |
1 (33, 33) |
2 (66, 66) |
1 (33, 33) |
2 (66, 66) |
0 (0) |
3 (100) |
Citrobacter braakii |
0 (0) |
2 (100) |
0 (0) |
2 (100) |
0 (0) |
2 (100) |
Citrobacter freundii |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
Citrobacter spp. |
1 (11, 11) |
8 (88, 88) |
2 (22, 22) |
7 (77, 77) |
0 (0) |
9 (100) |
Enterobacter aerogenes |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
Continued
Enterobacter cloacea |
0 (0) |
3 (100) |
0 (0) |
3 (100) |
0 (0) |
3 (100) |
Enterobacter sakazakii |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
Enterobacter spp. |
0 (0) |
2 (100) |
1 (50) |
1 (50) |
0 (0) |
2 (100) |
Escherichia coli |
10 (41, 66) |
14 (58, 33) |
12 (50) |
12 (50) |
0 (0) |
24 (100) |
Hafnia alvei |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
Klebsiella planticola |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
Klebsiella spp. |
3 (50) |
3 (50) |
2 (33, 33) |
4 (66, 66) |
0 (0) |
6 (100) |
Proteus mirabilis |
0 (0) |
2 (100) |
2 (100) |
0 (0) |
0 (0) |
2 (100) |
Proteus spp. |
1 (50) |
1 (50) |
1 (50) |
1 (50) |
0 (0) |
2 (100) |
Proteus vulgaris |
0 (0) |
2 (100) |
0 (0) |
2 (100) |
0 (0) |
2 (100) |
Providencia rettgeri |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
Salmonella paratyphi |
2 (66, 66) |
1 (33, 33) |
3 (100) |
0 (0) |
0 (0) |
3 (100) |
Salmonella paratyphi A |
2 (100) |
0 (0) |
2 (100) |
0 (0) |
2 (75) |
1 (25) |
Salmonella spp. |
5 (62, 5) |
3 (37, 5) |
8 (100) |
0 (0) |
1 (12, 5) |
7 (87, 5) |
Salmonella Typhi |
2 (100) |
0 (0) |
2 (100) |
0 (0) |
0 (0) |
2 (100) |
Serratia liquefaciens |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
Serratia spp. |
0 (0) |
2 (100) |
0 () |
2 (100) |
0 (0) |
2 (100) |
Shigella spp. |
1 (50) |
1 (50) |
2 (100) |
0 (0) |
0 (0) |
2 (100) |
Yersinia enterocolitica |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
Yersinia spp. |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
0 (0) |
1 (100) |
![]()
Figure 3. Distribution of the number of bacterial species according to their resistance to the three families of antibiotics.
3.2. Resistance Profile of Bacteria to the Three Families of Antibiotics According to Bat Species
When evaluating the bacterial resistance profile of bat species to Ceftriaxone, the presence of variability within bat species (p < 0.05) was found. Indeed, the species R. alcyone, M. pumilus and H. jonesi are the bat species that harboured bacteria that were all resistant to Ceftriaxone and therefore to third-generation cephalosporins (Table 4).
Table 4. Bacterial resistance profile of bat species in relation to Ceftriaxone.
Characteristic |
R, N = 291 |
S, N = 551 |
Overall, N = 841 |
p-value2 |
Bats |
|
|
|
0.042 |
Epomophorus gambianus |
11 (38%) |
10 (18%) |
21 (25%) |
|
Hyposideros caffer |
2 (6.9%) |
1 (1.8%) |
3 (3.6%) |
|
Hyposideros jonesi |
2 (6.9%) |
0 (0%) |
2 (2.4%) |
|
Mops condylurus |
5 (17%) |
16 (29%) |
21 (25%) |
|
Mops midas |
1 (3.4%) |
14 (25%) |
15 (18%) |
|
Mops pumilus |
1 (3.4%) |
0 (0%) |
1 (1.2%) |
|
Pipistrellus nanulus |
1 (3.4%) |
2 (3.6%) |
3 (3.6%) |
|
Rhinolophus alcyone |
3 (10%) |
0 (0%) |
3 (3.6%) |
|
Scotophilus leucogaster |
3 (10%) |
12 (22%) |
15 (18%) |
|
1n (%); 2Kruskal-Wallis rank sum test.
Across all bat species, there was no difference in the resistance of their bacteria to amoxicillin plus clavulanic acid (p > 0.05). However, species such as Hyposideros caffer, Hyposideros jonesi, Mops pumilus and Rhinolophus alcyone harboured bacterial species that were all 100% resistant to amoxicillin and clavulanic acid (Table 5).
Table 5. Bacterial resistance profile of bat species in relation to amoxicillin and clavulanic acid.
Characteristic |
R, N = 391 |
S, N = 451 |
Overall, N = 841 |
p-value2 |
Bats |
|
|
|
0.081 |
Epomophorus gambianus |
12 (31%) |
9 (20%) |
21 (25%) |
|
Hyposideros caffer |
3 (7.7%) |
0 (0%) |
3 (3.6%) |
|
Hyposideros jonesi |
2 (5.1%) |
0 (0%) |
2 (2.4%) |
|
Mops condylurus |
9 (23%) |
12 (27%) |
21 (25%) |
|
Mops midas |
3 (7.7%) |
12 (27%) |
15 (18%) |
|
Mops pumilus |
1 (2.6%) |
0 (0%) |
1 (1.2%) |
|
Pipistrellus nanulus |
1 (2.6%) |
2 (4.4%) |
3 (3.6%) |
|
Rhinolophus alcyone |
3 (7.7%) |
0 (0%) |
3 (3.6%) |
|
Scotophilus leucogaster |
5 (13%) |
10 (22%) |
15 (18%) |
|
1n (%); 2Kruskal-Wallis rank sum test.
As for imipenem, the leading carbapenem, there was no variability between bat species in terms of resistance. However, it appears that only the bacterial species isolated from Mops condylurus showed resistance to this family of antibiotics (Table 6).
Table 6. Bacterial resistance profile of bat species according to Imipenem.
Characteristic |
R, N = 21 |
S, N = 821 |
Overall, N = 841 |
p-value2 |
Bats |
|
|
|
0.7 |
Epomophorus gambianus |
0 (0%) |
21 (26%) |
21 (25%) |
|
Hyposideros caffer |
0 (0%) |
3 (3.7%) |
3 (3.6%) |
|
Hyposideros jonesi |
0 (0%) |
2 (2.4%) |
2 (2.4%) |
|
Mops condylurus |
2 (100%) |
19 (23%) |
21 (25%) |
|
Mops midas |
0 (0%) |
15 (18%) |
15 (18%) |
|
Mops pumilus |
0 (0%) |
1 (1.2%) |
1 (1.2%) |
|
Pipistrellus nanulus |
0 (0%) |
3 (3.7%) |
3 (3.6%) |
|
Rhinolophus alcyone |
0 (0%) |
3 (3.7%) |
3 (3.6%) |
|
Scotophilus leucogaster |
0 (0%) |
15 (18%) |
15 (18%) |
|
1n (%); 2Kruskal-Wallis rank sum test.
3.3. Relationship between Bacterial Resistance to Antibiotics and the Sex of Their Hosts
The analyses show that the resistance of bacteria to the three families of antibiotics is not related to the sex of the bats. Indeed, the Pearson’s Chi-squared test showed an absence of significant difference (p > 0.05). However, there was a strong tendency for bacteria isolated from female bats to be resistant to CRO (CRO residues = 1.12) and IMI (IMI residues = 0.13), whereas bacteria isolated from males showed a strong tendency for resistance to AMC (AMC residues = 1.38) (Figure 4).
Figure 4. Residues and number of observations of resistance to the three families of antibiotics of isolated bacteria according to the sex of the bats with Pearson’s Chi-squared test.
Among the 30 specimens of ROC-resistant bacteria, 43% and 57% were from female and male bats, respectively. Of the 40 specimens of AMC-resistant bacteria, 52% and 48% were from female and male bats, respectively. The two IMI-resistant bacteria were only isolated from female bats (Figure 5).
Figure 5. Percentage of bacterial resistance to the three families of antibiotics according to the sex of the bats.
Figure 6 shows the percentage of metallo-betalactamase (NDM) and Imipenemase (IMP) resistance genes in the population of bacterial strains. The NDM gene is abundant, with a rate of 97%, compared with 3% for the IMP gene.
Figure 6. Percentage of resistance genes according to their occurrence.
4. Discussion
This survey confirms the bacterial richness of bats in Africa. Indeed, 29 species of enterobacteria were isolated from 84 bat specimens. This confirms the results of several authors [15] [28] [29]. Enterobacteriaceae closely related to humans were isolated in this study, such as Salmonella, Shigella, and Yersinia. These bacteria are known to be responsible for several public health problems [28] [30] [31]. The presence of such bacterial richness in bats could be explained by their cohabitation with humans and also with wild birds which are known to be very rich in bacteria [32] [33]. The Enterobacteriaceae isolated in this study showed variability in resistance to the presence of the three families of antibiotics. The rate of resistance to CRO, AMC and IMI were 35% and 46%, respectively and 2.4%. Thus, this resistance of enterobacteria could be due to several factors. Indeed, the cohabitation between bats, wild birds and humans is a factor that favours resistance to antibiotics. [34] has shown that animals harbouring antibiotic-resistant Enterobacteriaceae are more frequently found in animals from the most anthropised sites. Various studies have shown the role of wild birds as a reservoir of antibiotic resistance. For example, migratory animals could contribute to the long-distance spread of antibiotic resistance in bats [15]. Recent findings suggest that wild animals may play a role in the origin of antibiotic resistance [15] [35] [36].
Moreover, even insects that are part of the diet of insectivorous bats may have a role in the bacterial resistance of bats through the presence of resistance genes in their microbiota according to [15].
We found low resistance of bacteria to IMI compared to the other two antibiotics. This could be explained by the absence of a resistance gene developed for this family of antibiotics.
Imipenem, a member of the broad-spectrum Carbapenem family, is known to be highly effective against bacteria [37]. Furthermore, it is difficult to implicate the nature of the medium in this explanation because the same bacteria isolated from bats in the same medium showed resistance to CRO and AMC.
The percentage of E. coli resistance was highest with all three antibiotics. Our results are similar to those of [38] who found that the genus Pteropus carried E. coli resistant to amoxicillin, carbapenems (blaNDM-5) and fluoroquinolone was detected in one E. coli isolate, and two isolates were resistant to third generation cephalosporins (blaCTX-M-27etampC).
Two species of bacteria, Salmonella spp. and Salmonella paratyphi A. were resistant to all three families of antibiotics. This resistance of the two salmonella species could be due to the pollution of the bats’ living environments and the development of resistance genes. Four species of this genus were isolated during this study. This genus, in addition to having a high capacity for resistance, is very present in bats and wildlife. Although bacterial resistance to antibiotics may be caused by anthropogenic pollution, However, heavy metals or biocides can also contribute to the selection of bacterial resistance [6]. The Kruskal Wallis test showed that the resistance of the bacteria is not related to the host species of the bats that harbour them. Indeed, bats live in colonies and often share the same biotopes.
Bacterial resistance was highest in bacteria isolated from Epomophorus gambianus species. This resistance was present in all three families of antibiotics. This result can be explained by the promiscuity of this bat species with humans. Indeed, in addition to being the most abundant bat species in Burkina Faso, it has a wide distribution [20]. Because of its frugivorous diet, it is present on trees such as mango and fig trees in search of fruit. The same trees are heavily exploited by humans so this could lead to transfer of resistance genes. Indeed, anthropogenic inputs into the environment can serve as sources of antimicrobial resistant bacteria and alter the ecology and population dynamics of wild animals [38]. Pearson’s Chi-squared test showed that the sex of bats is not a parameter that influences the resistance of bacteria to antibiotics. Of course, male and female bats live together and reproduce, so they share the same bacteria and therefore the same resistance genes. However, it has been found that bacteria isolated from female bats have an easy resistance to AMC and IMI. Although male and female bats share the same ecological niches, females possess hormones that help them to be more resistant to the presence of pathogens. Thus, these same hormones could contribute to the birth of resistance genes.
The phenotypic expressions in relation to antibiotics led us to verify the presence or absence of two resistance genes responsible for the production of beta-lactamase enzymes: NDM (New Delhi Metallo-beta-lactamase) and IMP (imipenimase). Our results show that the NDM gene is highly present (97 %) in all strains, and is predominantly dominated by E. coli, unlike the IMP gene (3 %). Our results are similar to those of [7] Benavides et al., (2022) who found a high genetic distribution of betalactamases in bat populations. This similarity could be explained by the fact that pathogens are transmitted and conserved between wild animals, especially bats, due to their gregarious nature.
5. Conclusion
From this survey, which is the first in Burkina Faso, it was found that bats in Burkina Faso harbour enterobacteria with variable resistance patterns depending on the bat species and antibiotics. Of the 29 species of enterobacteria isolated from bats, Salmonella typhi and Salmonella paratyphi A showed resistance to all three antibiotics. The sex of the bats does not seem to be a factor influencing the resistance of their bacteria to antibiotics. Our results reinforce the need to monitor antimicrobial resistance in wildlife, in their environment and also to study the anthropogenic actions on this wildlife.