Novel Isolation and Identification Methods for Enterococcus Species and Their Distribution in the Human Oral Cavity
Osamu Tsuzukibashi1*orcid, Akira Fukatsu1, Takashi Tayama2, Keisuke Idei2, Keisuke Usuda2, Satoshi Uchibori3, Koji Umezawa4, Yukiko Iizuka5, Takashi Asano3, Masanobu Wakami3, Taira Kobayashi3, Hiroshi Murakami2, Masahiko Fukumoto1
1Department of Laboratory Medicine for Dentistry for the Compromised Patient, Nihon University School of Dentistry at Matsudo, Chiba, Japan.
2Department of Oral Implantology, Nihon University School of Dentistry at Matsudo, Chiba, Japan.
3Department of Fixed Prosthodontics, Nihon University School of Dentistry at Matsudo, Chiba, Japan.
4Department of Special Needs Dentistry, Nihon University School of Dentistry at Matsudo, Chiba, Japan.
5Department of Oral Surgery, Nihon University School of Dentistry at Matsudo, Chiba, Japan.
DOI: 10.4236/aim.2026.163007   PDF    HTML   XML   60 Downloads   298 Views  

Abstract

Purpose: In recent years, vancomycin-resistant Enterococcus (VRE) has spread worldwide, and the acquisition of resistance to antibiotics other than vancomycin has become a significant problem. While Enterococcus species have been considered part of the normal flora of the digestive tract, including the oral cavity, it remains unclear whether they are actually present in all human mouths and which species are detected. Therefore, this study aimed to develop selective media for reliable detection of Enterococcus species from various oral samples and to establish a highly accurate identification and detection method using multiplex PCR targeting five Enterococcus species. Using this method, we conducted a detailed investigation of the distribution of these organisms in the human oral cavity. Methods: Antimicrobial susceptibility testing using antibiotic discs was performed to develop selective media for the highly accurate detection of Enterococcus species in human oral samples. Additionally, Enterococcus species-specific primers for multiplex PCR identification were designed. Furthermore, the developed selective media and multiplex PCR method were used to investigate the distribution of Enterococcus species in 30 subjects and the emergence of vancomycin resistance in isolated strains. Conclusion: Enterococcus species were detected in 8 subjects (26.7%). Multiplex PCR-based bacterial species identification revealed that the Enterococcus isolates were E. faecalis, E. hirrae, E. casseliflavus, and E. durans. No VRE was detected.

Share and Cite:

Tsuzukibashi, O., Fukatsu, A., Tayama, T., Idei, K., Usuda, K., Uchibori, S., Umezawa, K., Iizuka, Y., Asano, T., Wakami, M., Kobayashi, T., Murakami, H. and Fukumoto, M. (2026) Novel Isolation and Identification Methods for Enterococcus Species and Their Distribution in the Human Oral Cavity. Advances in Microbiology, 16, 139-150. doi: 10.4236/aim.2026.163007.

1. Introduction

By 2025, the genus Enterococcus comprised a large taxonomic group consisting of 90 species and 3 subspecies (https://lpsn.dsmz.de/genus/enterococcus). Enterococci, ubiquitous in nature, are Gram-positive, catalase-negative, facultative anaerobic cocci belonging to the lactobacilli group. Enterococci are important not only because they are a leading cause of nosocomial infections, but also because they may have a significant role in dissemination and persistence of antimicrobial resistance [1] [2]. The widespread use and misuse of antimicrobials such as glycopeptides and aminoglycosides in human and livestock have resulted in the rapid increase of vancomycin and high-level gentamicin-resistance in Enterococcus strains [3]. Vancomycin-resistant enterococci (VRE) were first isolated from patients in 1988 in the United Kingdom and France [4]. Since then, VRE have spread to many other countries including Malaysia, through meat from livestock and humans [5] [6]. Vancomycin resistance in enterococci has been classified based on the gene sequence and resistance characteristics. The vanA-type strains are resistant to high levels of both vancomycin and teicoplanin antimicrobials (MIC ≥ 64 µg/ml and >16 µg/ml, respectively). vanB-type strains are resistant to a wide range of vancomycin concentrations (MIC between 4 and ≥1024 µg/ml) and are susceptible to teicoplanin. vanD-type strains are resistant to moderate levels of vancomycin (MIC 128 µg/mL) and susceptible to teicoplanin, while vanC, vanE, and vanG-type strains exhibit low-level resistance to vancomycin [4] [7].

Accurate isolation and identification methods are essential for monitoring which species cause disease for therapeutic purposes. It is currently unclear whether Enterococcus species are part of the normal oral microbiota. Therefore, appropriate selective media are necessary to evaluate the oral distribution of Enterococcus species involved in nosocomial infections. Several selective media for these organisms have been developed for their isolation [8] [9]. Commercially available Enterococcosel agar (Becton Dickinson) is also usable. Selective media developed to date exhibit high selectivity for enterococci but may allow growth of some staphylococci, potentially leading to false positives. Most selective media use sodium azide as the selective agent; however, this substance is highly toxic to humans and can adversely affect health. Therefore, using these selective media in routine clinical testing and research may not be appropriate from both human health and environmental perspectives. Presently, the standard method for identification of enterococci is phenotypic characterization, primarily using biochemical tests [10]. Tests are usually performed in test tubes and may require significant amounts of time for preparation and interpretation of results. Furthermore, processing of large numbers of samples is inhibited by phenotypic characterization, as 10 or more tests may be necessary for differentiation of the species. Commercial identification kits, such as the API Rapid ID 32 Strep and BBL Crystal identification gram-positive ID kits, and automated identification systems, such as the VITEK gram positive identification system, are available for identifying enterococci to the species level [11]-[13]. These methods have been developed to allow rapid identification of enterococci based upon reactions to panels of biochemicals. Although the kits are cost-effective and results can be obtained in less than 24 h, there are concerns about the reliability of the kits [11] [14].

Previous studies [15] [16] have detected five Enterococcus species (E. faecium, E. faecalis, E. casseliflavus, E. hirrae and E. durans) from the human oral cavity. However, the detailed distribution of these Enterococcus species remains unclear. Furthermore, the vancomycin resistance status among oral isolates also remains unknown.

The objective of this study is to develop a novel selective medium for isolating Enterococcus species, establish a simple and more reliable testing method for identification at species level using multiplex PCR targeting five Enterococcus species detected in the human oral cavity, and evaluate the distribution of this microorganism in the oral cavity and its development of resistance to vancomycin.

2. Materials and Methods

2.1. Bacterial Strains and Culture Conditions

Bacterial strains were obtained from Japan Collection of Microorganisms (JCM; Japan), Center for Conservation of Microbial Genetic Resource, Gifu University (GTC; Japan), and American Type Culture Collection (ATCC; America). All bacterial strains used in the present study are listed in Table 1. Bacterial strains used in the present study were maintained by cultivating them on BactTM Brain Heart Infusion (BHI, Becton, Dickinson and Co., Sparks, MD, USA) and 1.5% agar (BHI agar). These organisms were cultured at 37˚C overnight under an aerobic condition.

Table 1. Recovery of Enterococcus species and other bacteria on BHI agar and OESM.

Species

Strain

BHI-Y

CFU/ml, ×108

OESM

CFU/ml, ×108

Recovery

(%)

E. faecalis

JCM 5803T

4.5 ± 0.2a

4.4 ± 0.3

97.8

E. faecium

JCM 5804T

6.9 ± 0.2

6.8 ± 0.3

98.1

E. casseliflavus

JCM 8723T

4.5 ± 0.2

4.4 ± 0.3

99.1

E. durans

JCM 8725T

1.5 ± 0.2

1.5 ± 0.3

98.7

E. hirrae

JCM 8729T

5.1 ± 0.2

5.0 ± 0.3

98.1

E. avium

JCM 8722T

1.3 ± 0.2

1.3 ± 0.3

98.8

E. gallinarum

JCM 8728T

3.1 ± 0.2

3.0 ± 0.3

98.6

E. lactis

JCM 30200T

6.9 ± 0.2

6.8 ± 0.3

97.7

Staphylococcus aureus

JCM 20624T

8.2

0

0

Staphylococcus epidermidis

JCM 2414T

8.6

0

0

Streptococcus oralis

ATCC 35037T

3.8

0

0

Streptococcus salivarius

ATCC 10557T

1.3

0

0

Actinomyces naeslundii

ATCC 12104T

0.6

0

0

Corynebacterium matruchotii

ATCC 14266T

0.7

0

0

Corynebacterium durum

ATCC 33449T

0.8

0

0

Rothia dentocariosa

JCM 3067T

0.5

0

0

Rothia mucilaginosa

JCM 10910T

0.5

0

0

N. sicca

ATCC 29256T

0.3

0

0

aAve ± SD.

2.2. Development of New Selective Medium

2.2.1. Evaluation of Base Medium

BHI agar supplemented with 1% yeast extract (BHI-Y), BHI-Y supplemented with 5% sheep blood (BHI-Y blood), and Mitis Salivarius agar (MS agar, Becton, Dickinson and Co., Sparks, MD, USA) were examined as the base medium in the selective medium. Ten-fold dilutions of cultures were made in 0.9 ml of Tris-HCl buffer (0.05 M, pH 7.2) and aliquots of 0.1 ml were spread onto the test media. The plates inoculated with bacteria were cultured at 37˚C for 48 h under an aerobic condition. After cultivation, the number of colony-forming units (CFU)/ml was counted.

2.2.2. Susceptibility Tests

Preliminary studies of antibiotic selection were also performed using disk susceptibility tests (Sensi-Disk, Becton Dickinson Co., MD, USA). The microbroth dilution method was used for susceptibility testing [17].

2.3. Recovery of Enterococcus Species and Other Representative Bacteria

The recoveries of the Enterococcus reference strains and other representative bacteria were calculated as CFU/ml on selective medium and compared with those on BHI agar for total cultivable bacteria. All bacterial strains used in the present study are listed in Table 1.

All bacterial strains were pre-incubated in BHI broth at 37˚C overnight in an atmosphere of 5% CO2 in a CO2 incubator. Ten-fold dilutions of cultures were made in 0.9 ml of Tris-HCl buffer (0.05 M, pH 7.2) and aliquots of 0.1 ml were spread onto the test media. The plates inoculated with bacteria were cultured at 37˚C for 48 h under an aerobic condition. After cultivation, the number of CFU/ml was counted.

2.4. Clinical Samples

Thirty volunteers (17 men, 13 women; mean age 35 years, range 18 - 75 years) participated in the present study. They had no systemic disease and received no antibiotic therapy for at least 3 months. All participants were asked not to brush, rinse, or smoke immediately prior to the assessment and not to eat or drink for at least 2 h beforehand. In this study, participants’ oral health status (e.g., periodontal disease status, presence of active caries, history of endodontic treatment, denture use, smoking status) was not included as an analytical factor.

Paraffin-stimulated whole saliva samples were collected in a sterile microcentrifuge tube. All samples were dispersed by sonication for 30 s in an ice bath (50 W, 20 kHz, Astrason® System model XL 2020, NY, USA), and 0.1 ml of each was diluted and inoculated on BHI-Y and selective medium plates. The plates were cultured at 37˚C for 2 days in an atmosphere of 5% CO2 in a CO2 incubator. After cultivation, CFU/ml in each sample was calculated. The present study was conducted in accordance with the principles of the Declaration of Helsinki, and was approved by the Ethics Committee of Nihon University School of Dentistry at Matsudo, Japan (EC23-012). Participant consent was obtained by the researchers themselves verbally explaining the study details to participants and having them sign a consent form.

2.5. Species Identification of Enterococcus Strains Isolated from Clinical Samples

Twenty-four of the approximately 50 colonies that grew on the selective medium plate per subject were randomly isolated and subcultured, and their identity was then confirmed by a PCR analysis.

2.6. Design of Species-Specific Primers for Enterococcus Species

Design of species-specific primers for Enterococcus species was performed as described previously [18]. Briefly, the atpA gene sequences of E. faecium (accession no. AB594765), E. faecalis (AJ843301), E. casseliflavus (EU153590), E. hirrae (AJ843484) and E. durans (AJ843269) were obtained from the DNA Data Bank of Japan (DDBJ; https://www.ddbj.nig.ac.jp/services.html, Mishima, Japan), and a multiple sequence alignment analysis was performed with the CLUSTAL W program; i.e., the atpA gene sequences of five Enterococcus species were aligned and analyzed, respectively. Homology among the primers selected for each Enterococcus species and their atpA gene sequences was confirmed by a BLAST search.

2.7. Development of PCR Method Using Designed Primers

Bacterial cells were cultured in BHI supplemented with 0.5% yeast extract for 24 h, and 1 ml of the samples were then collected in microcentrifuge tubes and resuspended at a density of 1.0 McFarland standard (approximately 107 colony-forming units (CFU)/ml) in 1 ml of sterile distilled water. A total of 3.6 μl of the suspension was then used as a PCR template. The detection limit of PCR was assessed by serially diluting known numbers of bacterial cells in sterile distilled water and then subjecting each suspension to PCR. The multiplex PCR mixture contained 0.2 μM of each primer, 10 μl of 2 × MightyAmp Buffer Ver.3 (Takara Bio Inc., Shiga, Japan), 0.4 μl of MightyAmp DNA Polymerase (Takara), and 5 μl of the template in a final volume of 20 μl. PCR reactions were performed in a DNA thermal cycler (Applied Biosystems 2720 Thermal Cycler; Applied Biosystems, CA, USA). PCR conditions included an initial denaturation step at 98˚C for 2 min, followed by 30 cycles consisting of 98˚C for 10 s and 68˚C for 1 min. PCR products were analyzed by 2.0% agarose gel electrophoresis before being visualized by electrophoresis in 1× Tris-borate-EDTA on a 2% agarose gel stained with ethidium bromide. A 100-bp DNA ladder (Takara Biomed, Shiga, Japan) was used as a molecular size marker. All experiments were performed in triplicate.

2.8. Antimicrobial Susceptibility of Isolated Enterococcus Strains

The screening of antimicrobial susceptibility of isolated Enterococcus strains was performed by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) [19].

3. Results

3.1. Development of Selective Medium

3.1.1. Selection of Base Medium

The selection of a base medium for the growth of Enterococcus species was performed. Enterococcus species grew well on MS agar as same as BHI-Y and BHI-Y blood (data not shown). To inhibit the growth of Gram-positive bacteria except genera Enterococcus and Streptococcus, and Gram-negative bacteria, MS agar was ultimately selected as the base medium.

3.1.2. Susceptibility to Antibiotics

Enterococcus species exhibited resistance to sodium chloride, trimethoprim-sulfamethoxazole combination (ST), 2,3,5-Triphenyltetrazolium Chloride (TTC), and oxacillin. The minimal inhibitory concentrations (MICs) of sodium chloride, ST, TTC, and oxacillin for Enterococcus were more than 90 mg/ml, 1000 μg/ml, 1000 μg/ml, and 2 μg/ml, respectively.

3.1.3. Composition of New Selective Medium

The new selective medium, designated oral Enterococcus selective medium (OESM), was composed of the following (per liter): 90 g of MS agar, 30 g of sodium chloride, 10 mg of colistin, 500 mg of ST, 180 mg of TTC, and 0.5 mg of oxacillin. Antibiotics, i.e., colistin, ST, TTC, and oxacillin were added after the base medium had been sterilized and cooled to 50˚C.

3.1.4. Recovery of Enterococcus Species and Inhibition of Other Representative Bacteria on Selective Medium

Table 1 shows the recovery of some Enterococcus reference strains on OESM relative to BHI-Y. The growth recoveries of the Enterococcus reference strains on ABSM were between 97.7% and 99.1% (average 98.4%) that on BHI-Y.

Table 1 also shows the inhibition of other representative bacteria except Enterococcus species on OESM relative to BHI-Y. The growth of other representative bacteria was markedly inhibited on the selective medium.

3.2. PCR Method for Identifying Five Enterococcus Species

3.2.1. Primer Design

The specific primer set covering the upstream region of the atpA gene sequence of five Enterococcus species was designed in the present study (Table 2). The amplicon size of E. faecium, E. faecalis, E. casseliflavus, E. hirrae and E. durans was 169 bp, 255 bp, 345 bp, 563 bp and 718 bp, respectively.

Table 2. Locations and sequences of species-specific primers for the atpA gene of five Enterococcus species.

Species

Primername

Sequence

Product

size (bp)

E. faecium

EFCIF

AGAGGCCTTGATCGGACGGG

169 bp

EFCIR

AAGGGCGTCGATCGCTTTTAGC

E. faecalis

EFCAF

GGAAGCAACAGCTCCCGGTGTTA

255 bp

EFCAR

ACGAAGTGTCTCTACTTGGTTACGA

E. casseliflavus

ECF

CGGCGATGCATTAATTGGCCG

345 bp

ECR

CGGCGTAATGTTTCTACTTGTGC

E. hirrae

EHF

TGGGTTAGGAGAAATCGTTACAGAT

563 bp

EHR

GTTTTGCCGCACGTTCTAGTAAACG

E. durans

EDF

TGCAACAGACAAGGCTCGTCC

718 bp

EDR

CCCAGCGTCAACAGCTGGTC

3.2.2. PCR Condition

A multiplex PCR method for identifying five Enterococcus species successfully amplified DNA fragments of each expected size (Figure 1). The detection limit was assessed in the presence of titrated bacterial cells, and the sensitivity of the PCR assay was between 5 × 1 and 5 × 10 CFU per PCR template (5.0 μl) for the E. faecalis-specific primer set with strain JCM 5803 (data not shown).

3.3. Clinical Examination

The detection frequencies of Enterococcus species in the saliva samples from thirty healthy subjects are shown in Table 3. Enterococcus species were detected in eight saliva samples (26.7%). In positive samples, the mean number of this microorganism and its proportion relative to the total bacterial number were 7.4 × 102 CFU/ml and 0.0003%, respectively. VRE was not detected in any of the samples. Table 4 shows the distribution of detected Enterococcus species at species level. E. faecalis was the most common, followed by E. hirrae, E. durans, and E. casseliflavus in that order.

Figure 1. Multiplex PCR assay for detecting five Enterococcus species. The primer mixture contained EFCIF, EFCIR, EFCAF, EFCAR, ECF, ECR, EHF, EHR, EDF, and EDR. Lanes: 1, E. faecium JCM 5804; 2, E. faecalis JCM 5803; 3, E. casseliflavus JCM 8723; 4, E. hirrae JCM 8729; 5, E. durans JCM 8725; 6, E. avium JCM 8722; 7, E. gallinarum JCM 8728; 8, E. lactis JCM 30200. M, molecular size marker (100-bp DNA ladder).

Table 3. Detection frequency of Enterococcus species in the saliva samples.

No. of Enterococcus positive samples

(%, frequency)

n = 30

No. of VRE positive samples

(%, frequency)

n = 30

No. of total bacteria

(CFU/ml)

No. of Enterococcus

(CFU/ml)

Enterococcus/totalbacteria

(%)

8 (26.7)

0 (0)

2.1 × 108

7.4 × 102

0.0003

Table 4. Distribution of detected Enterococcus species at species level.

No. of Enterococcipositive samples n = 30

E.

faecalis

E.

faecium

E.

casseliflavus

E.

durans

E.

hirrae

8

6

0

1

2

4

In the initial isolation, Enterococcus genus colonies on OESM generally exhibited a circular, smooth appearance. The colony color was reddish-purple. Therefore, on OESM, they could be distinguished from other bacteria based on colony morphology. The average colony size of Enterococcus species on OESM was 1.2 mm in diameter (Figure 2).

Figure 2. Appearance of Enterococcus colonies on OESM. (a) E. faecalis colonies on OESM inoculated with a saliva sample. (b) Stereomicroscope image of E. faecalis colony on OESM.

4. Discussion

Enterococci are increasingly recognized as a cause of nosocomial infections such as endocarditis, bacteremia, urinary tract infections, and neonatal sepsis [20]. While enterococci are used as an indicator of fecal contamination, they have also been shown to cause human infections, particularly in hospital-associated patients [21]. Furthermore, the widespread use and misuse of antimicrobial agents, such as glycopeptides and aminoglycosides, in humans and livestock has led to a rapid increase in Enterococcus strains exhibiting vancomycin resistance and high levels of gentamicin resistance. Some studies have confirmed that E. faecalis is the dominant species in teeth with failed root canal treatment [22] [23]. Endodontic infections are polymicrobial, consisting of obligate anaerobes and facultative anaerobes [24]. However, few studies have properly investigated the distribution of Enterococcus species and VRE in the human oral cavity. This is due to the lack of established methods for reliably isolating Enterococcus species from human oral samples and for accurately identifying them at the species level. Therefore, this study aimed to develop a novel selective medium for isolating Enterococcus species, establish a simple and reliable identification method using multiplex PCR, and investigate the distribution of these microorganisms in the oral cavity and their resistance to vancomycin.

In the present study, we designed species-specific primers with the already mentioned means, for the identification at the species level of Enterococcus species with a PCR method. These primers were able to distinguish Enterococcus species at the species level and did not display cross-reactivity with each other. Moreover, we developed a multiplex PCR method with the ability to Enterococcus identify and differentiate species at the species level using only each one PCR tubes per sample. Species-specific primers for five Enterococcus species were designed based on the sequences of atpA gene. Moreover, the PCR method in the present study directly uses bacterial cells with MightyAmp DNA Polymerase Ver.3 (Takara) and is completed within approximately 2 hours.

A useful selective medium for isolating Enterococcus species may contribute to the correct and rapid diagnosis of infectious diseases caused by this microorganism. Several selective media for Enterococcus species have been developed [9] [10]. Commercially available Enterococcosel agar (Becton Dickinson) is also usable. Some selective media cannot completely inhibit the growth of fungi or Gram-positive cocci such as staphylococci other than enterococci, significantly inhibit the growth of certain Enterococcus species, and are difficult to prepare. Additionally, Enterococcosel agar medium is less selective for human saliva specimens than for fecal specimens. The genus Enterococcus was formerly classified within the genus Streptococcus, and Enterococcus species grow well on MS agar. The novel selective medium OESM uses MS agar as its base medium. In the present study, Enterococcus species were more resistant to 30 g of sodium chloride, colistin, ST, TTC, and oxacillin than other representative microorganisms. The growth of other representative bacteria and fungi was inhibited by the addition of 30 g of sodium chloride, 10 mg of colistin, 500 mg of ST, 180 mg of TTC, and 0.5 mg of oxacillin to MS agar. All of the Enterococcus reference strains and isolates tested grew well on the new selective medium, designated as OESM, while the growth of other bacteria was markedly inhibited (Table 1). Moreover, OESM allowed for the identification of Enterococcus species by its characteristic colony morphology. OESM exhibits high selectivity for enterococci, eliminating the possibility of false positives or false negatives.

In the previous study, the prevalence of enterococci was 18% in diluted saliva samples [25]. In this study, Enterococcus species were detected in 8 of 30 saliva samples (26.7%), which was similar to previous study result. Furthermore, in the results of this case, the proportion of Enterococcus species within the total bacterial count was significantly low (0.0003%). This result indicate that Enterococcus species were found at a very low level in the oral cavity and this organism in oral cavity is probably of exogenous origin. The source of the enterococci found in the oral cavity is thus still unclear. Among the genus Enterococcus, E. faecalis and E. faecium represent approximately 90% of clinical isolates belonging to this genus [2]. In this study, the most frequently isolated species was E. faecalis, followed by E. hirrae, E. durans, and E. casseliflavus; however, E. faecium was not isolated. The distribution of Enterococcus species in the human oral cavity may be highly diverse. Furthermore, no VRE was detected in any of the specimens in this study. These results may be due to the fact that this study involved healthy subjects, utilized saliva samples, or that the number of isolates examined was small.

We developed the selective medium OESM to isolate Enterococcus species from various specimens. OESM exhibits high selectivity for Enterococcus species and is useful for evaluating the distribution and role of this microorganism in humans and various animals, as well as its antimicrobial resistance.

5. Conclusion

The novel selective medium (OESM) and our PCR method as isolation and identification methods, respectively, for Enterococcus species may contribute to the diagnosis of actinomycosis as well as eye infection such as keratitis and canaliculitis, dental caries, endodontic infections, osteomyelitis of the sternum, and infective endocarditis, which are caused by this organism.

Authors’ Contributions

Tsuzukibashi O, Fukatsu A, Tayama T, Idei K, Usuda K, Uchibori S, Umezawa K, Iizuka Y and Asano T corrected the data. Tsuzukibashi O, Fukatsu A, Wakami M, Murakami H, Kobayashi T and Fukumoto M drafted and wrote the manuscript. The concept of this manuscript was devised by Tsuzukibashi O. All authors read and approved the final manuscript.

Conflicts of Interest

The authors declare that there is no conflict of interest.

References

[1] Moellering, R.C. (1992) Emergence of Enterococcus as a Significant Pathogen. Clinical Infectious Diseases, 14, 1173-1178.[CrossRef] [PubMed]
[2] Murray, B.E. (1990) The Life and Times of the Enterococcus. Clinical Microbiology Reviews, 3, 46-65.[CrossRef] [PubMed]
[3] Phillips, I., Casewell, M., Cox, T., De Groot, B., Friis, C., Jones, R., Nightin gale, C., Preston, R. and Waddell, J. (2003) Does the Use of Antibiotics in Food Animals Pose a Risk to Human Health? A Critical Review of Published Data. Journal of Antimicrobial Chemotherapy, 53, 28-52.[CrossRef] [PubMed]
[4] Cetinkaya, Y., Falk, P. and Mayhall, C.G. (2000) Vancomycin-Resistant Enterococci. Clinical Microbiology Reviews, 13, 686-707.[CrossRef] [PubMed]
[5] Fisher, D.A., Lin, R., Chai, L., Kumarasinghe, G., Singh, K. and Tambyah, P.A. (2005) Vancomycin-Resistant Enterococci in a Singapore Teaching Hospital Prior to 2005. Singapore Medical Journal, 46, 311-312.
https://scholarbank.nus.edu.sg/handle/10635/130498
[6] Raja, N.S., Karunakaran, R., Ngeow, Y.F. and Awang, R. (2005) Community-Acquired Vancomycin-Resistant Enterococcus faecium: A Case Report from Malaysia. Journal of Medical Microbiology, 54, 901-903.[CrossRef] [PubMed]
[7] Depardieu, F., Bonora, M.G., Reynolds, P.E. and Courvalin, P. (2003) The VanG Glycopeptide Resistance Operon from Enterococcus faecalis Revisited. Molecular Microbiology, 50, 931-948.[CrossRef] [PubMed]
[8] Facklam, R.R. (1973) Comparison of Several Laboratory Media for Presumptive Identification of Enterococci and Group D Streptococci. Applied Microbiology, 26, 138-145.[CrossRef] [PubMed]
[9] Efthymiou, C.J. and Joseph, S.W. (1974) Development of a Selective Enterococcus Medium Based on Manganese Ion Deficiency, Sodium Azide, and Alkaline pH. Applied Microbiology, 28, 411-416.[CrossRef] [PubMed]
[10] Facklam, R.R. and Collins, M.D. (1989) Identification of Enterococcus Species Isolated from Human Infections by a Conventional Test Scheme. Journal of Clinical Microbiology, 27, 731-734.[CrossRef] [PubMed]
[11] Garcia-Garrote, F., Cercenado, E. and Bouza, E. (2000) Evaluation of a New System, VITEK 2, for Identification and Antimicrobial Susceptibility Testing of Enterococci. Journal of Clinical Microbiology, 38, 2108-2111.[CrossRef] [PubMed]
[12] Hamilton-Miller, J.M.T. and Shah, S. (1999) Identification of Clinically Isolated Vancomycin-Resistant Enterococci: Comparison of API and BBL Crystal Systems. Journal of Medical Microbiology, 48, 695-696.[CrossRef] [PubMed]
[13] Sadar, H.S., Biedenbach, D. and Jones, R.N. (1995) Evalution of Vitek and API 20S for Species Identification of Enterococci. Diagnostic Microbiology and Infectious Disease, 22, 315-319.[CrossRef] [PubMed]
[14] Deasy, B.M., Rea, M.C., Fitzgerald, G.F., Cogan, T.M. and Beresford, T.P. (2000) A Rapid PCR Based Method to Distinguish between Lactococcus and Enterococcus. Systematic and Applied Microbiology, 23, 510-522.[CrossRef] [PubMed]
[15] Komiyama, E.Y., Lepesqueur, L.S.S., Yassuda, C.G., Samaranayake, L.P., Parahitiyawa, N.B., Balducci, I., et al. (2016) Enterococcus Species in the Oral Cavity: Prevalence, Virulence Factors and Antimicrobial Susceptibility. PLOS ONE, 11, e0163001.[CrossRef] [PubMed]
[16] Ferrari, P.H.P., Cai, S. and Bombana, A.C. (2005) Effect of Endodontic Procedures on Enterococci, Enteric Bacteria and Yeasts in Primary Endodontic Infections. International Endodontic Journal, 38, 372-380.[CrossRef] [PubMed]
[17] Hirasawa, M. and Takada, K. (2002) Susceptibility of Streptococcus mutans and Streptococcus sobrinus to Cell Wall Inhibitors and Development of a Novel Selective Medium for S. sobrinus. Caries Research, 36, 155-160.[CrossRef] [PubMed]
[18] Fukatsu, A., Tsuzukibashi, O., Suzuk, H., Asaka, K., Ono, Y., Fuchigami, M., et al. (2021) One-Step Multiplex PCR for Simultaneous Detection and Identification of Eight Medically Important Candida Species. Open Journal of Stomatology, 11, 14-24.[CrossRef]
[19] Giske, C.G., Turnidge, J., Cantón, R. and Kahlmeter, G. (2022) Update from the European Committee on Antimicrobial Susceptibility Testing (EUCAST). Journal of Clinical Microbiology, 60, e00276-21. [Google Scholar] [CrossRef] [PubMed]
[20] Schaberg, D.R., Culver, D.H. and Gaynes, R.P. (1991) Major Trends in the Microbial Etiology of Nosocomial Infection. The American Journal of Medicine, 91, S72-S75.[CrossRef] [PubMed]
[21] Rocas, I., Siqueirajr, J. and Santos, K. (2004) Association of Enterococcus faecalis with Different Forms of Periradicular Diseases. Journal of Endodontics, 30, 315-320.[CrossRef] [PubMed]
[22] Hancock, H.H., Sigurdsson, A., Trope, M. and Moiseiwitsch, J. (2001) Bacteria Isolated after Unsuccessful Endodontic Treatment in a North American Population. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology, 91, 579-586.[CrossRef] [PubMed]
[23] Sundqvist, G., Figdor, D., Persson, S. and Sjögren, U. (1998) Microbiologic Analysis of Teeth with Failed Endodontic Treatment and the Outcome of Conservative Re-treatment. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology, 85, 86-93.[CrossRef] [PubMed]
[24] Fabricius, L., Dahlén, G., Holm, S.E. and Möller, A.J.R. (1982) Influence of Combinations of Oral Bacteria on Periapical Tissues of Monkeys. European Journal of Oral Sciences, 90, 200-206.[CrossRef] [PubMed]
[25] Zhu, X., Wang, Q., Zhang, C., Cheung, G.S.P. and Shen, Y. (2010) Prevalence, Phenotype, and Genotype of Enterococcus faecalis Isolated from Saliva and Root Canals in Patients with Persistent Apical Periodontitis. Journal of Endodontics, 36, 1950-1955.[CrossRef] [PubMed]

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.