1. Introduction
Tick-borne zoonotic pathogens represent an increasing public health risk world-wide. In North America, an established population of blacklegged ticks, Ixodes scapularis (Acari: Ixodidae), is based on at least 6 ticks of a developmental life stage or at least two of the three host-seeking life stages in a single collection period [1]. Ixodes scapularis is known to harbor at least seven pathogens, namely Anaplasma phagocytophilum [2], Babesia microti [3], Babesia odocoilei [4] [5], Borrelia burgdorferi sensu lato (s.l.) complex [6], Borrelia miyamotoi [7], Ehrlichia muris eauclairensis [8], and the virus of Powassan Virus Disease [9]. These microorganisms are all pathogenic to humans. Of these 7 pathogens, the most recently discovered pathogen is B. odocoilei [4] [5]. Ixodes scapularis larvae, nymphs and females are ectoparasite during the tick bite, but after the blood meal, B. odocoilei is an endoparasite of red blood cells within the arterial system.
Babesia odocoilei (Apicomplexa: Piroplasmidae: Babesiidae) is an intracellular, red blood cell parasite. This piroplasmid is a sequestering Babesia sp., that is pathogenic to humans [4] [5]. This single-celled microbe is found across North America [10], the United Kingdom [11], and the European Union [12]. Babesia odocoilei is a virulent cousin of Plasmodium falciparum, the causative microorganism of malaria. This sequestering Babesia sp. is unique because it enables transovarial transmission (gravid female to eggs to larvae) [13] [14]. In Southern Ontario, B. odocoilei has been detected in unfed larvae of I. scapularis in the Rouge Valley, Toronto and at the Toronto Zoo [15]. These unfed larvae were infected with B. odocoilei.
Co-infections and polymicrobial infections are common in patients but infrequently reported [16]. Notably, four different pathogens have been detected in a single I. scapularis adult collected in Wisconsin [17]. In eastern and central North America, I. scapularis is the primary tick vector of B. odocoilei [18]. In California, B. odocoilei has been detected in the western blacklegged tick, Ixodes pacificus, in California [19]. Likewise, in B.C., B. odocoilei has been found in I. pacificus and I. scapularis [20].
Natural reservoir hosts of B. odocoilei are cervids (i.e., white-tailed deer, Odocoileus virginianus) [21]-[23]. Bovids (i.e., desert bighorn sheep, Ovis canadensis nelsoni) are also reservoirs [24] [25].
Babesia odocoilei has been detected in avian-transported larval and nymphal I. scapularis. Songbirds (Order: Passeriformes; Suborder: Passeri) play a key role in the wide dispersal of songbird-transported ticks especially during bidirectional migrations [26]-[34]. Additionally, B. odocoilei has been detected in the brachial blood of songbirds during the summer nesting period [33]. When juvenile I. scapularis molt to the next stage, transstadial passage (larva to nymph &/or nymph to adult) of B. odocoilel occurs [14]. In one cross-Canada study, scientists found that the natural ratio of B. odocoilei to B. microti in I. scapularis adults was 60:1 [10].
The present study set out 1) to determine the endemicity of I. scapularis in southern Wellington County, and 2) to find the prevalence of Borrelia burgdorferi s.l. Babesia odocoilei, Babesia microti, Anaplasma phagocytophilum, Borrelia miyamotoi, and Bartonella spp., in this area.
2. Materials and Methods
2.1. Tick Collection
Veterinarians and veterinary technicians collected ticks during the fall stage of the bimodal, questing activity period of I. scapularis adults. Tick-collecting kits were hand-delivered to veterinary clinics in southern Wellington County in late September 2025. These kits were collected in early December 2025. The collection period for this study was approximately 2.5 months. Each kit had a crate of 6 micro tubes containing 95% ethyl alcohol. Each micro tube had a label to record the collection data (host, geographic location, date collected). An Olympus SZX16 stereoscopic microscope was used to identify the ticks. Using taxonomic keys, tick nomenclature and tick identification were determined and confirmed [35]-[37]. Of note, the spirochetal bacterium, B. burgdorferi s.l. was previously detected in Centre Wellington [37].
2.2. Molecular Analysis
All DNA extractions and PCRs were completed by Geneticks Inc. (Uxbridge, ON). Adult ticks were bisected longitudinally and homogenized by bead beating 400 µl of DNA/RNA shield (Zymo Research, Irvine, CA) with a mix of 2.3 mm and 0.1 mm Zirconia/Silica beads (BioSpec Products, Bartlesville, OK). Samples were subjected to two subsequent runs of 5 min at 2400 RPM in a Mini-Beadbeater-96 (BioSpec Products). Total nucleic acid was isolated from homogenized tick halves using the Quick-DNA/RNA Pathogen Miniprep (Zymo Research) following the manufacturer’s instructions.
A combination of real-time PCR and nested PCR assays were used for pathogen detection. The primers and probes used in this study are listed in Table 1. All samples were tested for the presence of Borrelia burgdorferi s.l. complex., Borrelia miyamotoi, Anaplasma phagocytophilum, Babesia microti, Babesia odocoilei, and Bartonella spp. All Borrelia testing was performed using real-time PCR in 30 µl reaction volumes using 15 µl of PC RBIO Probe Blue Mix (PCR Biosystems, London, UK). Subsequently, 800 nM of both forward and reverse primers, 250 nM of probe, and 10 µl of extracted total nucleic as template. Reactions were subjected to an initial denaturation of 8 min at 95˚C followed by 40 cycles at 95˚C for 10 sec and 60˚C for 30 sec. Real-time PCR reactions were performed using a Stratagene Mx3005P qPCR machine (Agilent Technologies, Mississauga, ON). To interpret qPCR results, the following algorithm was used: samples that tested positive for both Borrelia spp., and B. miyamotoi were considered positive for B. miyamotoi. Samples testing positive for Borrelia spp., but negative for B. miyamotoi, were considered positive for B. burgdorferi s.l. Samples that tested negative for both Borrelia spp. and B. miyamotoi were considered negative for all Borrelia spp.
Quality control measures were implemented at the diagnostic laboratory. Both engineering and processing controls were employed to identify and prevent aerosol contamination, and assure assay quality. Ticks were tested in batches of 15 - 20 samples at a time, with workspaces and instruments decontaminated with 0.5% sodium hypochlorite solution between each batch. Physically separated Biosafety cabinets (Class 2A) were used for DNA extraction, PCR master mix formulation, and sample loading. For each batch, no template control (NTC) reactions using Buffer TE pH 8.0 instead of template DNA were included for each PCR assay employed. A DNA extraction and amplification control were included for each sample targeting the “Folmer region” of the CO1 gene (https://pubmed.ncbi.nlm.nih.gov/7881515/). Any samples that failed to amplify the Folmer region, or any batches where the NTC was positive, were considered non-viable, and discarded or repeated. For any qPCR samples where the Cq value was above 35, results were verified using an nPCR assay targeting the Borrelia 23s intergenic spacer unit (https://pmc.ncbi.nlm.nih.gov/articles/PMC4001108/). All nPCR assays were confirmed using a proprietary multiplex qPCR developed by ThermoFisher (Mississauga, ON) for use at Geneticks Inc.
Table 1. Primers and Probes used to detect pathogens in lxodes scapularis ticks.
Genus/Species |
Gene |
PCR Type |
Primer Name |
Sequence (5'-3') |
Amplicon Size |
Reference |
Borrelia spp. |
23s IGS |
qPCR |
Bb23Sf |
cgagctcttaaaagggcgatttagt |
75 |
[38] |
Bb23Sr |
gcttcagcctggccataaatag |
Bb23SProbe |
FAM-apatgtggtagacccgaagccgagtgc-ECLIPSE |
Borrelia miyamotoi |
flaB |
qPCR |
flaBf |
agcacaagcttcatggacattga |
102 |
[39] |
flaBr |
gagctgcttgagcaccttctc |
flabProbe |
FAM-tgtggtgtcaaatcaggatgaagca-ECLIPSE |
Anaplasma phagocytophilum |
msp2 |
Nested PCR |
AnaP44OutL1-F |
GTAGAAGAAACCGCCCTAAT |
850 |
[40] |
AnaP44OutL1-R |
TCTATGTTGGTTTGGATTACAG |
MSP3F |
CCAGCGTTTAGCAAGATAAGAG |
334 |
[41] |
MSP3R |
GCCCAGTAACAACATCATAAGC |
Babesia microti |
18s rRNA |
Nested PCR |
Babs1 |
CTTAGTATAAGCTTTTATACAGC |
238 |
[42] |
Bab4 |
ATAGGTCAGAAACTTGAATGATACA |
Bab2 |
GTTATAGTTTATTTGATGTTC |
155 |
Bab3 |
AAGCCATGCGATTCGCTAAT |
Babesia odocoilei |
18s rRNA |
Nested PCR |
Bab306R_RCF |
TTTCTGCGTCACCGTATT |
331 |
[43] |
BabGenInR2 |
ACGACGGTATCTGATCGTCT |
311 |
[40] |
odo563 |
CCGTATTTTGACTTTTGTCGACTGT |
BabGenInR1 |
TCTGATCGTCTTCGATCCCC |
Bartonella spp. |
RibC |
Nested PCR |
RibC-1F |
CGGATATCGGTTGTGTTGAA |
309 |
[44] |
RibC-1R |
CATCAATRTGACCAGAAACCA |
RibC-2F |
GCATCAATTGCGTGTTCA |
185 |
RibC-2R |
CCCATTTCATCACCCAAT |
Note: Reference numbers for Table 1 are as follows: Borrelia spp. [38], Borrelia miyamotoi [39], Anaplasma phagocytophilum [40] [41], Babesia microti [42], Babesia odocoilei [43] [40]; Bartonella spp. [44].
3. Result
3.1. Tick Collection
In all, 96 Ixodes scapularis ticks were collected at 19 veterinary clinics in southern Wellington County during the fall questing period (26 September to 5 December 2025). For the purpose of this study, Centre Wellington was combined with the townships in southern Wellinton County. In total, 96 I. scapularis ticks were collected from 75 hosts (domestic dogs, Canis lupus familiaris, 55; domestic cats, Felis catus, 13; humans, Homo sapiens, 4; and horses, Equus caballus, 3).
One I. scapularis female had a co-infection of B. burgdorferi s.l. and A. phagocytophilum.
Relapsing fever (Borrelia hermsii) was not detected; it is normally found in far-western North America.
3.2. Molecular Analysis
The infection prevalences of the four tick-borne zoonotic pathogens was Borrelia burgdorferi s.l., 24/96 (25%), B. odocoilei, 15/96 (16%) and A. phagocytophilum1/96 (1%). Babesia microti, Borrelia miyamotoi, Bartonella spp. were not detected.
Overall, we found 16 areas in southern Wellington County with the number of established populations of I. scapularis as follows: Erin, 7; Guelph/Eramosa, 2; Guelph, 1; Puslinch, 1; and Centre Wellington, 5.
4. Discussion
The epicentre of an established population may be less than a hectare, but white-tailed deer and songbirds can play a pivotal role in wide dispersal of B. odocoilei-infected I. scapularis ticks. In this study, both domestic dogs and domestic cats played a focal role; they had outside activity. The Ontario Provincial Police state that the number of deer strikes in the study area increased from the previous year. Since deer are reservoirs of B. odocoilei, there is most likely an increase in the prevalence of B. odocoilei In I. scapularis. Patients are becoming increasingly dissatisfied that clinicians are side-stepping the diagnosis of tick-borne zoonotic diseases. To better understand the pathophysiology of B. odocoilei, we gleaned information from the scientific literature on veterinary Babesia and Plasmodium falciparum malaria.
4.1. Development of Fibrin-Bonded Entanglements
When I. scapularis larvae, nymphs, and females parasitize a person, kinetes quickly convert to sporozoites, and then change to trophozoites, and onward to infective merozoites. During this process, fibrinogen converts to fibrin in the blood stream, and adheres to the endothelium cells. This attachment process is called cytoadherence [45]. In synonymy, fibrin binds with uninfected red blood cells (uRBCs) and infected red blood cells (iRBCs). All together (fibrin, iRBCs. uRBCs), these fibrin-bonded entanglements set up in the capillaries and post-capillary venules, and begin the implementation of sequestration [46]. With these preliminary steps, pathogenesis is underway. As a result, patients have reduced circulation, and encounter unrelenting fatigue.
Once a capillary is clogged, the fibrin-bonded entanglement becomes a self-perpetuating, and self-protective housing. In time, multiple occlusion containments throughout the body are able to shut down the body systems.
Sequestering Babesia spp. are noted for clogging capillaries, and slowing the function of mitochondria—the body’s energy factories. Because of the perpetual presence of B. odocoilei toxins, production of ATP is dramatically reduced. Mental and physical activities greatly exhaust the availability of ATP. During sleep and rest, patients rejuvenate somewhat with ATP, but after awakening, activity promptly utilizes ATP. Thus, ongoing fatigue is a common pattern in patients with human babesiosis caused by B. odocoilei [4] [5] [10] [20] [47].
4.2. Persistence and Chronicity of the Lyme Disease Bacterium
Both persistence and chronicity of B. burgdorferi s.l. and B. odocoilei have been confirmed in the human body. In particular, B. burgdorferi s.l. has diverse forms, and hides in different deep-seated tissues (i.e., scar tissue, bone, eye, brain, neuronal and glial cells) [48] [49]. Left untreated or undertreated, this bacterium becomes chronic [48] [49]. Many studies and animal models show that persistence is the direct cause of B. burgdorferi s.l. [49]. Some pathologists and clinicians consider persistence and chronicity are one-in-the-same. We believe that persistence leads to chronicity. The authors currently have a list of 362 peer-reviewed scientific articles on the persistence and chronicity of B. burgdorferi s.l. These citations confirm persistence and chronicity of Lyme disease caused by B. burgdorferi s.l. Similarly, the authors have documented persistence and chronicity of human babesiosis caused by B. odocoilei in 15 citations. Both B. burgdorferi s.l. and B. odocoilei are pleomorphic and have diverse forms.
4.3. Comprehensive Testing and Treatment
Accurate testing and treatment is of utmost importance. Based on the present study, 40% of the I. scapularis infections would be missed if clinicians only tested and treated the Lyme disease bacterium. In the case of B. odocoilei, delayed testing and treatment could result in a lifetime of suffering―an education and career loss―an agonizing future.
4.4. Zoonoses in Established Populations of Ixodes scapularis
People from urban areas (e.g., Kingston, Toronto, Montreal), where I. scapularis are endemic, take their tick-infested dogs to rural areas, such as southern Wellington County. In the new area, fully engorged I. scapularis drop to the ground, and molt to the next life stage. They then parasitize other hosts, including people. In the fall, residents may return to the same area to enjoy parkland and fall colours, and acquire the next developmental life stage of the tick. When they bring their tick-infested dog on their return visit to the same area, the likelihood of forming an established population increases.
Epidemiologically, in Huronia, scientists found that 71% of the I. scapularis adults, which were parasitized by domestic dogs and feral cats, were infected with B. odocoilei [30]; none was infected with B. burgdorferi s.l. Researchers of the present study, found that 16% of the fall-collected I. scapularis were infected with B. odocoilei. Symptoms are listed as early-onset and late-onset stages in Table 2.
4.5. Symptoms of Human Babesiosis Caused by Babesia odocoilei
Table 2. Symptoms related to human babesiosis caused by Babesia odocoilei.
Early onset of symptoms that commonly occur in the first 6 months |
cognitive decline |
unrelenting fatigue/low stamina |
poor balance/clumsiness |
being in daze |
lack of reading comprehension |
ischemic (slow blood circulation) |
extra thirst |
sleep disturbance/insomnia |
mood changes, ambivalence |
anxiety, fearfulness |
profound inflammation |
head pressure/headaches |
urinary hesitation |
constipation, lethargic bowels |
numbness in fingers/face |
difficult remembering |
unsteady gait, lack of balance |
anhedonia (inability to feel joy) |
cognitive impairment |
air hunger/shortness of breath |
hampered reading retention |
panic attack/feel scared |
sore eyes/unexplained pain |
liver ache (especially at night) |
fluctuation of emotions |
disorientation/delirium |
headaches/head pressure |
joint pain/ muscle ache |
pathogen-induced depression |
irritability/aggression/rage |
weird/wild dreams |
sluggishness in head |
loss of interest in hobbies |
nausea/abdominal pain |
hyperacoustic (sensitive to noise) |
chills/heat & cold intolerance |
Late-onset of symptoms that typically occurs after 6 months |
muscle weakness |
ticked off, disgusted |
dyslexia (trouble reading & writing) |
chronic encephalitis |
dizziness/blurred vision |
vasculopathy in blood vessels |
dementia/memory loss |
nervousness/dystonia |
white matter hyperintensities |
severe hemolysis |
peripheral neuropathy |
difficult walking/motion sickness |
coma/seizures/stroke |
intolerance to physical activity |
suicidal/homicidal ideation |
hallucination/nightmare |
intolerance of mental exertion |
restless legs/muscle spasms/shakes |
Note: Clinicians are often labelling human babesiosis caused by B. odocoilei with an assortment of different diseases, such as ME/chronic fatigue syndrome, Alzheimer’s disease, fibromyalgia, multiple sclerosis, POTS, dementia, neuropsychiatric disease, psychotic depression, and more.
4.6. Chronicity of Human Babesiosis Caused by Babesia odocoilei
Some healthcare providers consider persistence and chronicity one-in-the-same. Because of the adaptability and persistence of B. odocoilei, chronicity is very prevalent. Babesiosis sneaks in slowly as the parasitemia level increases, and this piroplasmid becomes established in capillaries as fibrin-bonded entanglements infecting more and more red blood cells. In the early stage, when the parasitemia level of B. odocoilei is building, it can cause considerable fatigue, muscle ache, body pain, and disorientation. In the later stage, dementia, cognitive impairment, major depression, and difficulty walking can occur. As a persistent infection, this newly-discovered, babesial zoonosis becomes long-lasting and deep-rooted in the human arterial system. In time, this intracellular parasite instigates a lingering, life-long, and incurable disease.
4.7. Ticks Are Nature’s Unsanitary Syringes
Babesia odocoilei is stored in the salivary glands of the I. scapularis tick. At the initial stage of the tick bite, kinetes leave the salivary glands, and surges forward into the hypostome, and directly into the blood stream of the host. In I. scapularis females, B. odocoilei is stored in both the salivary glands and the ovaries. A fully engorged gravid female can transmit B. odocoilei to humans and then deposit a mass of infected eggs on the forest floor. One month after egg laying starts, these eggs can become B. odocoilei- infected larvae that promptly start host-seeking activities. This area becomes a danger zone because this leaflitter habitat is covered with a thousand B. odocoilei-infected larvae. Any child that crawls or lays on the ground in one of these endemic areas is sure to contract human babesiosis caused by B. odocoilei [4] [5]. Whenever a fully engorged, gravid I. scapularis female is infected with B. odocoilei, this babesial infection will be maintained to the next generation. As long as a fully engorged, gravid female is infected with B. odocoilei, a new generation of I. scapularis infected with B. odocoilei will be maintained and, therefore, B. odocoilei can be propagated, ad infinitum. This area where eggs were laid presents a genuine health risk in the woods.
4.8. Transovarial Transmission in Toronto
Although we did not find B. odocoilei-infected I. scapularis larvae in southern Wellington County, as our study focused on adult I. scapularis. Milne et al. [15] collected unfed I. scapularis larvae in Toronto, and these larvae were infected with B. odocoilei. Transovarial transmission (gravid female to eggs to larvae) is ongoing in Toronto. Flagging around oak trees in early August is a potential way to collect them.
If I. scapularis females are infected with B. odocoilei, they typically pass infective kinetes to the eggs and, subsequently, to hatching larvae, and onward to suitable hosts (e.g., songbirds, humans). The larvae do not have to bite an infected host to become infected. Transovarial transmission is a unique way to transmit B. odocoilei for many generations.
Because larvae are very tiny (0.75 mm), they are hard to see. Children laying on the ground in wooded areas are prime targets for B. odocoilei-infected I. scapularis larvae. This scenario can generate a public health crisis.
4.9. Migratory Songbirds Disperse Ticks
Neotropical passerines play a pivotal role in the widespread dispersal of I. scapularis larvae and nymphs [50] [51]. These long-distance migrants transport ticks as far south as the northern part of South America [50] [51]. Not only are passerines heavily involved in the wide dispersal of songbird-transported tick, these ground-foraging passerines are implicated in the enzootic cycle of at least 7 different pathogens. When people are bitten, they are involved with an epizootic cycle. Of note, agrologists recently discovered I. scapularis parasitizing avian and mammalian hosts in B.C. [52] [53]. During northward spring migration, scientists have collected juvenile I. scapularis on ground-frequenting songbirds, nation-wide, as far north, and as far west as northwestern Alberta [26] [27] [50] [51].
Notably, scientists detected B. burgdorferi s.l., B. odocoilei, and A. phagocytophilum in brachial blood of songbirds during the nesting period [33]. Juvenile I. scapularis have the potential to contract tick-borne zoonotic pathogens from songbirds. In fact, researchers have found that the American robin, Turdus migratorius, is a reservoir-competent bird species that transmits the Lyme disease bacterium to juvenile I. scapularis [54] [55].
4.10. Treatment Obstacles
Penetration of capillaries that are occluded is the major obstacle in the treatment of human babesiosis caused by Babesia odocoilei [4] [5]. Alarmingly, they can form self-contained, self-perpetuating hideaways that can live on indefinitely. Fibrinolytics (e.g. nattokinase, serrapeptase, lumbrokinase) loosen fibrin from the endothelium, and iRBCs, and uRBCs. Fibrinolytics allow antibabesials to act more effectively. Because human babesiosis caused by B. odocoilei is persistent, this sequestering Babesia sp. is very recalcitrant to treat. Early testing and prompt treatment are paramount.
5. Conclusion
We discovered 16 established populations of I. scapularis ticks in southern Wellington County. Collectively, these established populations harbour B. burgdorferi s.l., 24/96 (25%); B. odocoilei, 15/96 (16%); and A. phagocytophilum, 1/96 (1%). These microorganisms are all pathogenic to humans. Clinicians must be schooled in these pathogens, and ticks removed from patients must be tested for these three tick-borne zoonotic diseases. Whenever patients have been visiting a wooded area during temperate months (above 0˚C, no snow cover), they must realize that they face questing ticks—an environmental hazard. Human babesiosis caused by B. odocoilei is pathogenic to humans. Based on this flagship study, clinicians who only test for the Lyme disease bacterium, would miss 40% of the tick-borne zoonotic pathogens. Clinicians who diagnose and treat tick-borne zoonotic diseases must have a full understanding of the pathology of this apicomplexan parasite and, subsequently, realize that these microorganisms can cause an energy-draining, insidious zoonoses.
Authors’ Contributions
Conceptualization and design: JDS and CMS. Collection and methodology: JDS. Formal analysis: JDS and CMS. Drafting of manuscript: JDS and CMS. Accuracy of data: JDS and CMS. Both authors read and approved the final version of this manuscript.
Acknowledgments
Ethical approval is not required to remove ticks from mammalian hosts. This article is dedicated to the memory of the late Dr. Laverne Kindree and his wife Mrs. Norma Kindree (101 in 2026) of Squamish, BC. During the late 1980s and 1990s, Dr. and Mrs. Kindree were forerunners in trailblazing, pioneering research and, at the same time, support clinical acumen of tick-borne zoonotic diseases in BC. We are most grateful to their daughter, Ms. Diane Kindree, who has honored her parents by being a philanthropic contributor to this milestone study.
We thank veterinarians and veterinary technicians for collecting ticks for this study. For computer graphics and graphic design, we thank Glenn Funk. We sincerely thank Justin Wood at Geneticks Inc. for testing the ticks.