Urban Malaria Transmission in Niamey, Niger: Species Diversity and Entomological Parameters of the Anopheles gambiae complex

Abstract

A comprehensive understanding of vector diversity, spatio-temporal distribution, and malaria transmission dynamics is fundamental for establishing effective vector control strategies. This study assessed entomological parameters across six sites in Niamey. Anopheles mosquitoes were collected using indoor residual spraying and CDC light traps during three seasons (rainy, cold, and hot). Specimens were identified morphologically and by PCR. Diversity was evaluated using ecological indices, while blood meal origin and Plasmodium infections were also detected by PCR. In total, 18,141 females Anopheles mosquitoes belonging to six species were collected: An. gambiae s.l., An. rufipes, An. funestus, An. pharoensis, An. nili, and An. ziemanni. An. gambiae s.l. was the predominant species complex, ranging from 96.62% to 99.68% across sites. Within the An. gambiae complex, two main species were identified: An. coluzzii (89.2%) and An. arabiensis (9.2%), along with 0.4% hybrids. These two anthropophagic species were the only ones found infected with Plasmodium, with infection frequencies varying by species, site, and season. The entomological inoculation rate (EIR) varied across sites, peaking during the rainy season (17.55 ib/p/m in Banigoungou versus 0.17 ib/p/m in Koira-Tegui) compared to lower values in the hot season (1.03 ib/p/m to 0.00). This study demonstrated that An. coluzzii and An. arabiensis are the principal malaria vectors in Niamey. Malaria transmission was found to be omnipresent, continuous, and particularly elevated during the rainy season and in riparian sites along the Niger River.

Share and Cite:

Salé, N.M., Iro, S.M., Issa, I., Hounkarin, Z.W., Djedanem, M., Souley, A.D., Amadou, S., Ahadji-Dabla, K.M., Doumma, A. and Ibrahim, M.L. (2026) Urban Malaria Transmission in Niamey, Niger: Species Diversity and Entomological Parameters of the Anopheles gambiae complex. Advances in Infectious Diseases, 16, 169-191. doi: 10.4236/aid.2026.161013.

1. Introduction

Culicidae represent a major concern for both human and animal health. In addition to the nuisance they cause during both day and night, mosquitoes are involved in the transmission of numerous pathogens. According to the World Health Organization (WHO), vector-borne diseases account for more than 17% of all infectious diseases worldwide [1]. Malaria remains by far the deadliest disease globally. The WHO World Malaria Report documented 282 million cases and 610,000 deaths worldwide in 2024 [2]. The African region continues to bear the greatest burden, accounting for 94% of cases and 95% of deaths globally [2].

Niger, malaria remains a major public health problem. According to the latest WHO report (2025), Niger is among the four countries worldwide that together accounted for more than half of global malaria deaths, with 5.6% attributed to Niger alone [2]. Malaria transmission in Niger is highly heterogeneous, stratifying the country into three epidemiological zones based on transmission intensity: hyper-endemic, meso-endemic, and hypo-endemic [3]. Anopheles gambiae s.l. is the principal malaria vector in Niger, while An. funestus plays a secondary role due to its limited geographical distribution [4] [5]. Other less common species such as An. pharoensis, An. nili, and An. ziemanni have also been suspected of contributing to malaria transmission in Niger [6].

Despite progress achieved through interventions such as the large-scale distribution of long-lasting insecticidal nets (LLINs) and seasonal malaria chemoprevention (SMC), the Nigerien population continues to pay a heavy toll. Malaria affects the entire country, including urban areas such as Niamey, where transmission appears to be influenced by urbanization and its associated factors, including overpopulation and anthropogenic activities.

Urban malaria has been the subject of several studies, and the general consensus has been that urbanization tends to reduce malaria transmission compared to rural areas, where environmental and ecological conditions are more favorable for vector development [7]. However, malaria transmission persists in several African cities [8]-[10] and in some cases reaches higher levels than in rural areas [10]. Moreover, within the same city, malaria transmission is influenced by the degree of urbanization, micro-ecological conditions, and overall living standards [11]. According to some authors, this situation is largely driven by rapid and unplanned urbanization, accompanied by exponential growth of urban populations. Studies conducted in the sub-region have shown that urbanization, as it occurs in these countries, contributes to the creation of new types of breeding sites to which Anopheles mosquitoes adapt [12] [13]. In addition, population growth is proportional to consumption needs, and to meet this increasing demand, communities are heavily engaged in urban agriculture. Unfortunately, while urban agriculture is promoted as a means to meet food needs and reduce poverty [14], it also contributes to sustaining malaria endemicity, even during unusual periods, by creating breeding sites favorable to vector development [15] [16]. Environmental modifications such as the establishment of irrigated or rice-growing perimeters may alter existing ecological settings and promote the reproduction of other mosquito species. At the local scale, this can lead to changes in the structure, diversity, distribution, and abundance of vectors [15] [17] [18].

The most recent entomological data on malaria transmission in Niamey date back more than a decade, with some studies conducted even before the period of major droughts, at a time when the city was smaller and less populated [6] [19] [20]. As urbanization continues and Anopheles vectors adapt to these changing environments, sustained surveillance and control of malaria in sub-Saharan Africa deserve particular attention in urban settings [7].

Against this backdrop of rapid and unplanned urbanization, the present study aimed to conduct entomological monitoring in order to: 1) assess the diversity, abundance, and spatio-temporal distribution of Anopheles species and their role in malaria endemicity and 2) evaluate malaria transmission across six sites in the city of Niamey, Niger.

2. Methodology

2.1. Study Design

This was a descriptive cross-sectional study, repeated every two months, aimed at assessing the diversity, abundance, and spatio-temporal distribution of Anopheles species and their involvement in the intensity of malaria transmission across selected sites in the city of Niamey.

2.2. Study Sites

This study was conducted throughout the year 2020 in Niamey, the capital city of Niger, located in the western part of the country (13˚30'49"N, 2˚06'35"E). The climate is tropical semi-arid, with an average annual rainfall of 540 mm occurring between June and October, peaking in August. Mean monthly temperatures vary considerably: January, the coolest month, records an average of 24.7˚C (min 17.1˚C, max 32.7˚C), while April, the hottest month, reaches an average of 34.8˚C (min 27.9˚C, max 46˚C).

Niamey is divided into two parts by the Niger River: the larger left bank and the right bank. In addition to the river, the city contains semi-permanent ponds. These water bodies provide opportunities for irrigated agriculture, particularly for riparian populations, in response to the growing demands of an exponentially increasing population. Agricultural practices vary across sites, including market gardening, arboriculture, and irrigated rice cultivation, thereby creating diverse agroecosystems. Rice cultivation is practiced yearround, though with reduced intensity during the hot season, which coincides with the river’s low water period. Irrigation, particularly for rice, is largely supported by motor pumps. During a single ricegrowing cycle, plots are often cultivated asynchronously, resulting in fields at different developmental stages. These practices contribute to environmental modifications that increasingly favor mosquito proliferation, especially Anopheles species.

For this study, six sites were selected. Five were riparian sites along the Niger River: upstream sites (Tondibiah and Goudel), central sites (Lamordé and Gamkallé), and a downstream site (Banigoungou). The sixth site, Koira-Tegui, was located away from the river and represented a non-riparian area (Figure 1).

Figure 1. Map of study sites [21].

2.3. Collection and Processing of Adult Mosquitoes

2.3.1. Collection, Identification, and Preservation of Mosquitoes

The study protocol was based on longitudinal entomological monitoring conducted from January to December 2020. Adult mosquito collection was performed using two sampling techniques, every two months, over two consecutive days at each study site. The first method involved pyrethrum spray collections (PSC) inside dwellings. This technique was applied in twenty randomly selected houses per site. Collections were carried out early in the morning, between 7:00 and 10:00 a.m., in designated rooms where white sheets were spread to cover the entire floor and beds. All openings were sealed, and the room was sprayed with pyrethroid-class insecticides, particularly targeting the ceiling where mosquitoes typically rest. After 15 minutes, the insecticide’s action time, the sheets were carefully retrieved, and knocked-down mosquitoes were collected using forceps and placed into Petri dishes labeled by house and site [22]. The second technique used CDC light traps. Eight traps were deployed in four randomly selected houses, with prior consent from the occupants. In each house, traps were placed both indoors and outdoors, suspended at a height of 1.5 meters. Traps were activated at 6:00 p.m. (sunset) and operated until 6:00 a.m. During this period, room lights were generally turned off, and mosquitoes were attracted by the incandescent bulb, then drawn in by the trap’s fan and deposited into the collection chamber [22].

At the end of each collection, the total number of sleepers present in each surveyed room was recorded. This information enabled us to assess aggressiveness as proposed by Williams and Pinto (see section 4: Data Analysis). The same houses were monitored throughout the study period, except in cases where a replacement was necessary due to unforeseen circumstances; in such cases, a neighboring house with similar structure was selected. Collected specimens were transported to the laboratory for identification. Using a stereomicroscope, mosquitoes were sorted by genus, sex, and species based on morphological criteria. Only female Anopheles mosquitoes were retained. Their physiological status was determined, and the proportion of blood-fed females was recorded during morphological identification [23]. Subsequently, unfed and gravid females were preserved in batches of ten in Eppendorf tubes containing silica gel and stored at −20˚C. Blood-fed females were individually preserved in 96-well plates until molecular analyses were performed.

2.3.2. Molecular Characterization

A subsample of 2243 Anopheles gambiae s.l. specimens was dissected into three parts: wings and legs for species identification within the An. gambiae complex; abdomen for determining the origin of the blood meal in engorged females; and head-thorax (along with whole specimens of other species) for detecting the presence of Plasmodium. DNA from all parts was extracted following the protocol described by Rudbeck and Dissing [24]. Species within the An. gambiae complex were identified using the SINE-PCR method, following the protocol established by Santolamazza et al. [25]. Infectivity was assessed using COX-I PCR, which targets the Plasmodium gene for sporozoite detection, as described by Echeverry et al. [26]. The origin of the blood meal was determined according to the protocol outlined by Kent and Norris [27]. The primers used for these PCR assays are listed in Table 1. At the end of each PCR reaction, products were electrophoresed on a 2% agarose gel, and DNA fragment sizes were visualized under ultraviolet light by comparing the resulting bands to a 100 bp molecular weight marker.

Table 1. Primers used for species identification, Plasmodium detection, and blood meal source determination by PCR.

Type of PCR

Primers Name

Sequence (5' → 3')

Species identification

200X6.1F

TCGCCTTAGACCTTGCGTTA

200X6.1R

CGCTTCAAGAATTCGAGATAC

Plasmodium detection

COX-IF

AGAACGAACGCTTTTAAACGCCTG

COX-IR

ACTTAATGGATATAAAGTCCATCCWGT

Blood meal origin

UnRev1025

GGTTGT/GCCTCCAATTCATGTTA

Human741F

GGCTTACTTCTCTTCATTCTCTCCT

2.4. Data Analysis

Collected data were initially entered into Microsoft Excel and subsequently transferred to SPSS for statistical analysis. The sample size used for species identification within the An. gambiae complex and for infectivity assessment was determined using the OpenEpi online tool: (https://www.openepi.com/SampleSize/SSPropor.htm) with a 95% confidence interval.

Ecological diversity indices were calculated to assess species diversity, including:

  • Species richness (S)

  • Relative abundance (Pi), where Pi = ni/N, with ni representing the number of individuals of a given species and N the total number of individuals across all species

  • Shannon-Wiener diversity index (H), calculated as H = −ΣPi × log(Pi)

  • Evenness index (E), calculated as E = H/Hmax

  • Simpson’s diversity index (D), calculated as D = 1/ΣPi

In accordance with the methodology proposed by Williams and Pinto [28], entomological indicators were also evaluated at all study sites, including: Anthropophily index.

  • (Ia): Corresponds to the proportion of female mosquitoes that have taken a blood meal from a human subject.

Ia= TotalnumberofAnophelesthathavetakenahumanbloodmeal  TotalnumberofengorgedAnophelesanalyzed

  • Human biting rate (ma): Corresponds to the average number of bites received per person per unit of time.

ma= TotalnumberofengorgedAnopheles  Totalnumberofhumansleepers ×Ia

  • Sporozoite index (Is): Number of Anopheles mosquitoes tested positive for sporozoites.

Is= TotalnumberofsporozoitepositiveAnopheles TotalnumberofAnophelesspecimensanalyzed

  • Entomological inoculation rate (EIR), calculated as EIR = Is × ma.

For statistical comparisons, the Kruskal-Wallis test was used to analyze seasonal variations in abundance, while the Chi-square test was applied to compare infection rates and anthropophily levels.

3. Results

3.1. Mosquito Composition and Density

A total of 22,340 female mosquitoes belonging to three genera (Anopheles, Culex, and Aedes) were collected during the study period. Anopheles was by far the most abundant genus, accounting for 81% of the total collection, followed by Culex (18%) and Aedes (1%). Overall, the seasonal distribution of these genera showed that Anopheles was markedly more abundant during the rainy season (63.81%) compared to the cold season (26.64%) and was least abundant in the hot season (9.55%). In contrast, Culex was most abundant in the cold season (69.19%), followed by the hot season (5.53%) and the rainy season (25.28%). Aedes mosquitoes were collected almost exclusively during the hot season (99.12%). Spatial distribution revealed that Anopheles was relatively more abundant in Banigoungou, Goudel, and Lamordé, wherea Culex predominated in Gamkallé, Koira-Tegui, and Tondibiah. Aedes was collected in only two sites, with higher abundance in Gamkallé and presence also in Koira-Tegui (Figure 2).

Figure 2. Distribution of mosquito genera: (a) Overall distribution of genera; (b) Seasonal distribution of genera and (c) Distribution across collection sites.

3.2. Diversity and Spatial Distribution of Anopheles Mosquitoes

A total of 18,141 females Anopheles specimens belonging to six species, An. gambiae s.l., An. rufipes, An. funestus, An. pharoensis, An. ziemanni, and An. nili, were collected across all study sites during the survey period. Pyrethrum spray collections (PSC) yielded 91% (n = 16,485) of the total catch, significantly higher than CDC light traps, which accounted for 9% (n = 1656) (p = 0.007) (Table 2). Among the six Anopheles species captured, An. gambiae s.l. was the most common and dominant across all sites, representing 99.61% (n = 18,071) of the total Anopheles catch, followed by An. rufipes at 0.26% (n = 47). The remaining species were more site-specific and included An. funestus (0.07%, n = 12), An. pharoensis (0.04%, n = 7), An. nili (0.01%, n = 2), and An. ziemanni (0.01%, n = 2). Anopheles abundance was highest in the peripheral districts of Banigoungou and Tondibiah, accounting for 80% (n = 14,520) and 7.8% (n = 1412) of the total catch, respectively. Lamordé ranked third with 6.0% (n = 1082), while Koira-Tégui recorded the lowest Anopheles abundance at 0.6% (n = 103). Relative abundance and species richness varied slightly across sites. Banigoungou exhibited the highest Anopheles species richness, with all six species present. An. gambiae s.l. was dominant at 99.7% (n = 14,473), followed by An. rufipes at 0.3% (n = 38). Goudel ranked second in species richness, with five species detected, including An. gambiae s.l. (99.1%, n = 765) and An. rufipes (0.4%, n = 3). Lamordé and Gamkallé showed the lowest species richness, each with two species and a strong predominance of An. gambiae s.l. (99.8%, n = 1080 and 99.6%, n = 251, respectively). Analysis of ecological indices including Shannon-Wiener diversity, evenness, and Simpson’s index revealed consistently low values across all sites, confirming the dominance of An. gambiae s.l. throughout the study area. However, some variation was observed, with the highest diversity indices recorded at Koira-Tégui, where non-gambiae species accounted for 3.88% of the catch, and the lowest at Lamordé, where An. gambiae s.l. was nearly exclusive (Table 3).

Table 2. Distribution of Anopheles species according to capture methods.

Capture Method

An. gambiae

An. pharoensis

An. rufipes

An. funestus

An. nili

An. ziemanni

Total per Method

Resting fauna

16,441

5

31

7

1

0

16,485

Light trap

1630

2

16

5

1

2

1656

Total per species

18,071

7

47

12

2

2

18,141

P-value

0.006**

0.396ns

0.000***

0.046*

0.205ns

0.025*

0.007**

*: significant test; **: very significant; ***: highly significant; ns: no significant.

Table 3. Diversity and spatial distribution of Anopheles.

Species

Banigoungou

Gamkallé

Goudel

Koira-Tegui

Lamordé

Tondibiah

ni (Pi)

ni (Pi)

ni (Pi)

ni (Pi)

ni (Pi)

ni (Pi)

An. gambiae s.l.

14,473 (99.68)

251 (99.6)

765 (99.09)

99 (96.12)

1080 (99.82)

1403 (99.36)

An. pharoensis

3 (0.02)

0 (0)

2 (0.26)

0 (0)

0 (0)

2 (0.14)

An. rufipes

38 (0.26)

1 (0.4)

3 (0.39)

2 (1.94)

2 (0.18)

1 (0.07)

An. funestus

3 (0.02)

0 (0)

1 (0.13)

2 (1.94)

0 (0)

6 (0.42)

An. nili

1 (0.01)

0 (0)

1 (0.13)

0 (0)

0 (0)

0 (0)

An. ziemanni

2 (0.01)

0 (0)

0 (0)

0 (0)

0 (0)

0 (0)

Total

14,520 (100)

252 (100)

772 (100)

103 (100)

1082 (100)

1412 (100)

Species richness (S)

6

2

5

3

2

4

Shannon index (H’)

0.011

0.002

0.004

0.017

0.001

0.003

Simpson index (D)

0.006

0.008

0.018

0.075

0.004

0.013

Evenness index (E)

0.013

0.006

0.006

0.035

0.003

0.005

Ni: total number of individuals, Pi: percentage of individuals;

3.3. Density and Seasonality of Anopheles Species across Sites

Across all sites, the overall abundance of Anopheles varied according to season. The Kruskal-Wallis test revealed that the seasonal variation in the abundance of An. gambiae s.l. was significant (p = 0.000). As shown in Table 4, in the majority of sites (4/6), An. gambiae s.l. was more abundant during the rainy season. Furthermore, its density decreased progressively from the rainy season to the cold season and was lowest in the hot season. Specifically, in Banigoungou, its density was 65.92% in the rainy season compared to 24.26% in the cold season (p = 0.6) and 9.82% in the hot season (p = 0.000). In Tondibiah, An. gambiae s.l. accounted for 68.14% in the rainy season, 20.88% in the cold season (p = 0.03), and 10.98% in the hot season (p = 0.000). In Goudel, its density was 63.53% in the rainy season, 33.86% in the cold season (p = 0.6), and 2.61% in the hot season (p = 0.000). At Koira-Tegui, An. gambiae s.l. reached 88.89% in the rainy season compared to 6.06% in the cold season (p = 0.07) and 5.05% in the hot season (p = 0.07). Conversely, in Lamordé and Gamkallé, An. gambiae s.l. was more abundant in the cold season than in the rainy season, with 53.15% versus 36.30% (p = 0.000) and 63.75% versus 34.66% (p = 0.1), respectively. Across all sites, An. gambiae s.l. persisted but remained underrepresented in the hot season, ranging from 1.59% in Gamkallé to 10.97% in Tondibiah. Similarly, An. rufipes was collected at all sites, with relatively higher density in Banigoungou and greater abundance in the rainy season compared to the cold and hot seasons (50% vs. 24.25% and 18.42%, respectively). The Kruskal-Wallis test revealed significant differences between its abundance in the hot and cold seasons (p = 0.02) and between the hot and rainy seasons (p = 0.000). However, no significant difference was detected between the cold and rainy seasons. Other species such as An. funestus, An. pharoensis, An. nili, and An. ziemanni were collected at very low densities, and their seasonal variation was not numerically clear. Nevertheless, the Kruskal-Wallis test showed that An. pharoensis, unlike An. funestus, An. nili, and An. ziemanni, varied significantly according to season (p = 0.016) (Table 4).

Table 4. Composition, distribution, and seasonal density of Anopheles species by site.

Study site

Season

Number and percentage (%) of collected Anopheles species

An.

gambiae

An.

pharoensi

An. rufipes

An. funestus

An. nili

An. ziemanni

Total per site/season

Banigoungou

Cold

3511 (24.26)

3 (100)

12 (31.58)

1 (33.33)

-

2 (100)

3529 (24.32)

Rainy

9540 (65.92)

-

19 (50)

1 (33.33)

1 (100)

-

9561 (65.84)

Hot

1422 (9.82)

-

7 (18.42)

1 (33.33)

-

-

1430 (9.84)

Total

14,473 (100)

3 (100)

38 (100)

3 (100)

1 (100)

2 (100)

14,520 (100)

Gamkallé

Cold

160 (63.75)

-

-

-

-

-

160 (63.49)

Rainy

87 (34.66)

-

1 (100)

-

-

-

88 (34.92)

Hot

4 (1.59)

-

-

-

-

-

4 (1.59)

Total

251 (100)

-

1 (100)

-

-

-

252 (100)

Goudel

Cold

259 (33.86)

1 (50)

3 (100)

1 (100)

1 (100)

-

265 (34.33)

Rainy

486 (63.53)

1 (50)

-

-

-

-

487 (63.08)

Hot

20 (2.61)

-

-

-

-

-

20 (2.59)

Total

765 (100)

2 (100)

3 (100)

1 (100)

1 (100)

-

772 (100)

Koira-Tegui

Cold

6 (6.06)

-

-

-

-

-

6 (5.83)

Rainy

88 (88.89)

-

-

-

-

-

88 (85.44)

Hot

5 (5.05)

-

2 (100)

2 (100)

-

-

9 (8.73)

Total

99 (100)

-

2 (100)

2 (100)

-

-

103 (100)

Lamordé

Cold

574 (53.15)

-

1 (50)

-

-

-

575 (53.14)

Rainy

392 (36.30)

-

-

-

-

-

392 (36.23)

Hot

114 (10.55)

-

1 (50)

-

-

-

115 (10.63)

Total

1080 (100)

-

2 (100)

-

-

-

1082 (100)

Tondibiah

Cold

293 (20.88)

2 (100)

-

3 (50)

-

-

298 (21.10)

Rainy

956 (68.14)

-

1 (100)

3 (50)

-

-

960 (68.0)

Hot

154 (10.98)

-

-

-

-

-

154 (10.90)

Total

1403 (100)

2 (100)

1 (100)

6 (100)

-

-

1412 (100)

Overall total

18,071

7

47

12

2

2

18,141

3.4. Specific Composition and Distribution of Subspecies of the An. gambiae s.l. Complex

Out of 2243 specimens of An. gambiae s.l. examined for specific identification of complex members by PCR, 89.2% (n = 2000) were identified as An. coluzzii, 9.2% (n = 206) as An. arabiensis, 0.4% (n = 8) as hybrids, and 1.2% (n = 29) were not amplified. Figure 3 shows that the predominance of An. coluzzii extended across all study sites and throughout all seasons of the year (χ2 = 112.33; df = 20; p < 0.001). However, regardless of site, An. arabiensis was more abundant during the rainy season, with significantly higher predominance observed in Goudel (χ2 = 16.22; df = 6; p = 0.013) and Tondibiah (χ2 = 22.31; df = 8; p = 0.004) (Figure 3).

Figure 3. Spatiotemporal distribution of species within the An. gambiae complex.

3.5. Spatio-Temporal Assessment of Entomological Parameters Related to Malaria Transmission

3.5.1. Infection Rate of Anopheles with Plasmodium spp.

Table 5. Spatiotemporal distribution of Plasmodium falciparum infection rates in An. gambiae s.l.

Site

Rainy season

Cold season

Hot season

Tested (n)

Positive

(n)

IR % [95% CI]

Tested

(n)

Positive (n)

IR % [95% CI]

Tested

(n)

Positive

(n)

IR % [95% CI]

Tondibiah

176

9

5.1 [2.4 - 9.5]

145

3

2.1 [0.4 - 5.9]

118

2

1.7 [0.2 - 6.0]

Goudel

160

9

5.6 [2.6 - 10.4]

164

3

1.8 [0.4 - 5.3]

69

1

1.4 [0.0 - 7.0]

Lamordé

150

7

4.7 [1.9 - 9.3]

196

6

3.1 [1.1 - 6.5]

105

2

1.9 [0.2 - 6.7]

Gamkallé

85

3

3.5 [0.7 - 10.0]

156

3

1.9 [0.4 - 5.5]

4

0

0

Banigoungou

207

11

5.3 [2.7 - 9.3]

212

7

3.3 [1.3 - 6.7]

197

3

1.5 [0.3 - 4.4]

Koira-Tagui

88

2

2.3 [0.7 - 9/6]

6

0

0 [0.0 - 45.9]

5

0

0 [0.0 - 52.2]

Total

866

41

4.7 [3.5 - 6.5]

879

22

2.5 [1.6 - 3.8]

498

8

1.6 [0.7 - 3.1]

(n): nombre; IR = Infection Rate; CI = Confidence Interval.

Table 5 shows the Plasmodium infection rate detected in Anopheles across study sites during the three seasons of the year. Only An. gambiae s.l. was found infected with Plasmodium sporozoites throughout the study period. Overall, the Plasmodium infection rate in An. gambiae s.l. was 3.2% (n = 71; 95% CI: 2.5 - 4.0). This rate varied significantly by season, being highest during the rainy season at 4.8% (n = 42; 95% CI: 3.5 - 6.5), compared to 2.5% (n = 22; 95% CI: 1.6 - 3.8) in the cold season and 1.6% (n = 8; 95% CI: 0.7 - 3.2) in the hot season (χ2 = 12.6; df = 2; p = 0.002). By site, variability in infection rates was not significant, ranging from 3.4% (n = 21/616; 95% CI: 3.1 - 4.4) in Banigoungou, where the rate was highest, to 2.0% (n = 2; 95% CI: 0.7 - 8.6) in Koira-Tegui, where it was lowest (χ2 = 1.01; df = 5; p = 0.9). Similarly, seasonal variation across sites showed that infection rates during the rainy season ranged from 5.6% (n = 9/160; 95% CI: 0.2 - 10.4) in Goudel to 2.3% (n = 2/88; 95% CI: 0.7 - 8.0) in Koira-Tegui. In the cold season, the highest infection rate was observed in Banigoungou at 3.3% (n = 7/212; 95% CI: 1.3 - 6.7), while no infections were detected in Koira-Tegui. During the hot season, the highest infection rate was recorded in Lamordé at 1.9% (n = 2/105; 95% CI: 0.2 - 6.7), whereas no infections were detected in Gamkallé and Koira-Tegui. Overall analysis of infection rates within the An. gambiae complex showed that the infection rate was significantly higher in An. coluzzii compared to An. arabiensis (χ2 = 13.47; df = 4; p = 0.009).

3.5.2. Trophic Preference: Anthropophilic Rate in An. gambiae s.l.

The anthropophilic index was determined from a total of 1449 blood-fed abdomens of An. gambiae s.l.. As shown in Table 6, overall and across all sites and seasons, An. gambiae s.l. was significantly more anthropophagic (72.6%; n = 1052; 95% CI: 61.8 - 85.7) than zoophagic (27.4%; n = 397; 95% CI: 23.6 - 31.2) (χ2 = 120.09; df = 4; p < 0.001). The anthropophilic rate varied significantly by season. It was lower during the cold season (67.2%; n = 305/454; 95% CI: 59.8 - 82.4) compared to the hot season (79%; n = 282/357; 95% CI: 68.6 - 86.7) and the rainy season (72.9%; n = 465/638; 95% CI: 62.5 - 86.6) (χ2 = 120.1; df = 4; p < 0.001). This significant seasonal variation was observed across all sites: Tondibiah (χ2 = 80.14; df = 4; p < 0.001), Goudel (χ2 = 47.60; df = 4; p < 0.001), Lamordé (χ2 = 57.74; df = 4; p < 0.001), Gamkallé (χ2 = 14.52; df = 4; p = 0.006), Banigoungou (χ2 = 45.46; df = 4; p < 0.001), and Koira-Tegui (χ2 = 80.14; df = 4; p < 0.001). Overall analysis of blood meal origin within the An. gambiae s.l. complex showed that An. coluzzii was significantly more anthropophagic than An. arabiensis, which exhibited a stronger tendency toward zoophagy (χ2 = 37.12; df = 8; p < 0.001).

Table 6. Evaluation of the anthropophilic rate in An. gambiae s.l. according to sites and seasons.

Site

Rainy season

Cold season

Hot season

Tested (n)

SH

Ia % [95% CI]

Tested (n)

SH

Ia % [95% CI]

Tested (n)

SH

Ia % [95% CI]

Tondibiah

145

91

62.8 [54.3 - 70.6]

49

29

59.2 [44.2 - 73.0]

69

49

71 [58.8 - 81.3]

Goudel

100

91

91.0 [83.6 - 95.8]

45

38

84.5 [70.5 - 93.5]

22

22

100 [84.5 - 100]

Lamordé

91

78

85.7 [76.8 - 92.2]

57

45

78.9 [66.1 - 88.6]

69

49

90.8 [81.0 - 96.5]

Gamkallé

33

32

97.0 [84.2 - 99.9]

91

80

87.9 [79.4 - 93.8]

0

0

0

Banigoungou

207

114

55.1 [48.2 - 62.0]

212

113

53.3 [46.3 - 60.2]

197

162

82.2 [76.1 - 87.3]

Koira-Tagui

62

59

95.1 [86.5 - 99.0]

0

0

0

0

0

0

Total

638

465

72.9 [62.5 - 86.6]

454

305

67.2 [59.8 - 82.4]

357

282

79.0 [68.6 - 86.7]

(n): Number of blood-fed females examined, SH: Human blood meals detected, Ia: Anthropophilic index (%), 95% IC: 95% confidence interval.

3.5.3. Entomological Inoculation Rate (EIR)

Table 7 presents the variation in the entomological inoculation rate (EIR). On average, the EIR ranged from 3.52 infective bites per person per month (ib/p/m) during the rainy season to 0.62 ib/p/m and 0.22 ib/p/m during the cold and hot seasons, respectively. Across study sites, the highest EIR was recorded in Banigoungou with 17.55 ib/p/m, followed by Goudel with 1.46 ib/p/m and Tondibiah with 1.07 ib/p/m. The lowest EIR was observed in Koira-Tegui with 0.17 ib/p/m. During the cold and hot seasons, Banigoungou and Lamordé recorded the highest transmission rates, with 2.72 ib/p/m and 0.44 ib/p/m in the cold season, and 1.03 ib/p/m and 0.12 ib/p/m in the hot season, respectively.

Table 7. Seasonal variation of entomological inoculation rates (EIR) of An. gambiae s.l..

Sites

Rainy season

Cold season

Hot season

An. gambiae s.l.

An. gambiae s.l.

An. gambiae s.l.

ma

IR

EIR/month

ma

IR

EIR/month

ma

IR

EIR/month

Banigoungou

11.01

0.05

17.55

2.74

0.03

2.72

2.26

0.02

1.03

Gamkallé

0.19

0.04

0.20

0.47

0.02

0.27

0.00

0.00

0.00

Goudel

0.87

0.06

1.47

0.32

0.02

0.18

0.13

0.01

0.06

Koira-Tegui

0.25

0.02

0.17

0.00

0.00

0.00

0.00

0.00

0.00

Lamordé

0.41

0.05

0.58

0.48

0.03

0.44

0.20

0.02

0.12

Tondibiah

0.69

0.05

1.07

0.20

0.02

0.12

0.25

0.02

0.13

Seasonal mean EIR

2.24

0.05

3.52

0.70

0.02

0.62

0.47

0.01

0.22

ma: aggressiveness (mean biting rate per person per night), IR: infection rate, EIR/month: entomological inoculation rate per month.

4. Discussion

This prospective longitudinal study assessed the diversity of Anopheles mosquitoes, their spatiotemporal distribution, and malaria infection rates across five riparian sites along the Niger River and one nonriparian site within the city of Niamey. The study highlighted the seasonal and relative abundance of Anopheles species and evaluated their role in malaria transmission within the six sites of Niamey.

The results demonstrated the presence of three mosquito genera Anopheles, Culex, and Aedes, collected across all study sites. Anopheles was the most abundant genus and was recorded throughout all seasons of the year, with sitespecific variations in abundance. This finding contrasts with entomological studies conducted in other African cities, which reported relatively higher densities of Culicinae compared to Anophelinae [29]. The predominance of Anopheles fauna in Niamey may account for the high malaria transmission observed in the city. Culex was the second most abundant genus. This result differs from those reported by Labbo et al. [30] who, in a study conducted in two districts of Niamey, found Culex to be more abundant. Such discrepancies may be explained by differences in the geographical positioning of collection sites, which likely represent distinct ecological systems depending on whether they are located in the city center or peripheral areas. In contrast, our findings are consistent with those of Kwi et al. [31] and Traoré et al. [32]. Aedes was the least represented genus. Its low abundance may be partly attributed to the capture time intervals and collection techniques employed, which may not have been optimal for Aedes sampling, as well as to the agro-ecosystems selected for the present study. Nevertheless, the detection of Culex and Aedes mosquitoes should alert public health authorities, as these genera are responsible for the transmission of arboviral diseases such as yellow fever, dengue, and Rift Valley fever, which are frequently misdiagnosed as malaria.

Entomological monitoring identified six Anopheles species: An. gambiae s.l., An. rufipes, An. funestus, An. pharoensis, An. nili, and An. ziemanni. Across all sites, An. gambiae s.l. was the predominant species. Previous entomological studies conducted in Niamey reported the presence of these species and confirmed the predominance of An. gambiae s.l. [5] [6] [30]. This strong predominance of An. gambiae s.l. has also been documented in other countries of the sub-region [32]-[39]. Species distribution analysis showed that only An. gambiae s.l. and An. rufipes were present across all sites. An. funestus, once abundant and considered an efficient malaria vector, disappeared from Niamey in the 1970s following the destruction of its larval habitats under the combined influence of drought and agricultural intensification [6]. The species reappeared in 2004 [40] and was later reported with particularly high abundance in certain localities of the country [41] but it has struggled to re-establish in Niamey despite the presence of favorable ecological conditions. Banigoungou was the only site where all six species were recorded, and it exhibited particularly high abundance of all species, followed by Tondibiah and Lamordé. The lowest Anopheles density was observed in Koira-Tegui, a peripheral non-riparian site. This finding corroborates Julvez et al. [6], who noted that, unlike Sudanian cities, peripheral districts of Niamey located far from the river tend to record relatively low Anopheles densities. Overall, the diversity, species distribution, and variation in relative abundance of Anopheles mosquitoes appear to result from the interplay of specific ecological factors in each district [31] [37] [38] [42]. Among these ecological drivers, anthropogenic activities such as urban agriculture, particularly irrigated rice cultivation, are frequently cited [37] [43]. In addition to ecological factors influencing the development of immature stages, several authors have highlighted the role of housing characteristics in adult mosquito abundance. Indeed, rudimentary human dwellings have been shown to harbor more Anopheles than modern housing structures [44] [45].

This study demonstrated that the diversity and abundance of Anopheles species varied significantly across seasons. Overall, the highest abundance of Anopheles was recorded during the rainy season, while the lowest was observed in the hot season. This finding corroborates results obtained by Salako et al. in Benin [46], and Zogo et al. in Côte d’Ivoire [36], who reported a decline in Anopheles density from the rainy to the dry season. The increased abundance of Anopheles during the rainy season can be attributed to the availability, abundance, and particularly the quality of larval habitats. Indeed, breeding sites of this species are known to increase in number and productivity during the rainy season but tend to decrease during the dry season [38]. Our observations are consistent with those reported by [37] [38]. However, when rainfall becomes excessive, some breeding sites may become flooded, washed out, and larvae carried away by water currents [47]. This phenomenon may explain the higher abundance of An. gambiae s.l. recorded during the cold season in Lamordé and Gamkallé compared to the rainy season. In contrast, the densities of An. rufipes decreased during both the cold and hot seasons relative to the rainy season.

The largest proportion of all Anopheles species was collected through indoor residual spraying (90.87%). This yield contrasts with the findings by [30] [34], who reported higher efficiency using CDC light traps. The reduced effectiveness of light traps observed in our study may be attributed to a shift in mosquito resting behavior, from exophilic to endophilic, as noted by Thabet et al. in Nigeria [48]. These results support the potential relevance of applying indoor residual spraying (IRS) as a vector control strategy in Niamey.

This study also showed that the An. gambiae complex was represented by two species, An. coluzzii and An. arabiensis, along with a few hybrids across all sites. An. coluzzii was the predominant species at all sites and during all seasons of the year, whereas An. arabiensis was relatively more abundant during the rainy season. No An. gambiae sensu stricto was detected in any season across the study sites. The predominance of An. coluzzii has previously been reported in Niger [4] and in other countries of the sub-region [35] [37] [48] [49]. This predominance is thought to be linked to the species’ preference for specific breeding habitats, most often large anthropogenic permanent or semi-permanent sites such as irrigated rice fields [50]. Moreover, An. coluzzii appears to have a strong adaptive capacity, as studies have shown that the species can colonize polluted water bodies during the dry season in Niger [42]. This adaptability may explain its consistent presence across all seasons. In contrast, the relatively low frequency of An. arabiensis may be due to ecological conditions unfavorable to its reproduction. Indeed, An. arabiensis, like An. gambiae, has long been considered a species of arid zones [48] typically exploiting temporary sunlit natural habitats dependent on rainfall for reproduction [35] [50]. The scarcity, irregularity, and decline of rainfall, combined with high temperatures, likely limit the persistence of such natural habitats in Niamey, thereby hindering the development of these species. This may explain the progressive regression of An. gambiae, which is closely associated with these habitats, in favor of An. coluzzii, which shows increasing adaptability [4]. Several other studies have reported the disappearance of An. gambiae, notably in Chad [51] and northern Nigeria, which share a climate similar to that of Niger [52]. Furthermore, detailed studies conducted in Mali have demonstrated that the adaptability of An. coluzzii is associated with specific chromosomal inversions that appear to confer traits enabling the exploitation of both flooded or irrigated areas and arid environments [53]. According to these authors, the persistence of An. coluzzii during the dry seasons (cold and hot) is strongly linked to this adaptive factor. Finally, the failure of PCR amplification in some samples was likely due to misidentification of mosquitoes at the morphological level and/or degradation of DNA quality associated with storage [54].

To determine the involvement of vector species and characterize malaria transmission levels across all sites, female Anopheles mosquitoes were individually analyzed by PCR for the detection of Plasmodium sporozoites. The results showed that only the An. gambiae complex (An. coluzzii and An. arabiensis) was implicated in malaria transmission in the study sites. Thus, An. gambiae s.l. emerges as the principal malaria vector in Niamey. Previous studies conducted in Niger have similarly identified An. gambiae s.l. as the main malaria vector [4] [41] in line with findings from other countries in the sub-region [35]-[37]. Across all sites, specimens of An. coluzzii and An. arabiensis were found infected with sporozoites, with infection rates varying significantly between the two species of the An. gambiae complex. Studies conducted in the sub-region have documented the involvement of both species in malaria transmission in areas where they occur in sympatry [48] [55]. Furthermore, investigations in Niger and Nigeria have shown that Plasmodium infection rates are significantly higher in An. coluzzii than in An. arabiensis, a difference likely attributable to the predominance of An. coluzzii over An. arabiensis [4] [48]. However, a study conducted in Burkina Faso, in an area where both species were equally abundant, demonstrated no significant difference in infection rates between them [55]. Between sites, Plasmodium infection rates were highest in Banigoungou, followed by Lamordé and Tondibiah, while the lowest was recorded in Koira‑Tegui. Overall, infection rates peaked during the rainy season and were lowest in the hot season, although this difference was not statistically significant. This non-significant variation suggests that vector competence was relatively homogeneous across sites and that infection rates were simply proportional to vector abundance, corroborating the observations of Zogo et al. [36]. Notably, neither An. funestus, An. pharoensis, nor An. rufipes tested positive for infection. Yet, An. funestus and An. pharoensis have previously been incriminated in malaria transmission in certain localities of Niger [41]. Elsewhere, An. funestus has been identified as a major vector due to its strong anthropophilic behavior, which enhances its efficiency in malaria transmission [56] [57]. In contrast, An. rufipes has never been implicated in malaria transmission in Niger. This species has long been suspected of playing no role in malaria transmission, largely due to its predominantly zoophilic rather than anthropophilic behavior [58]. However, recent studies have demonstrated its vectorial role, notably in Cameroon [59] and Zambia [56].

The analysis of host preference revealed that, regardless of site, An. gambiae s.l. exhibited a tendency toward anthropophily (preference for feeding on humans). This tendency was significantly higher during the hot season and in sites other than Banigoungou and Tondibiah. Such variation may be attributable to species behavior or host accessibility. Indeed, the peak of anthropophily coincides with the hot season, when populations tend to remain outdoors for extended periods and/or sleep outside, thereby increasing host accessibility. A study conducted in Côte d’Ivoire demonstrated that An. gambiae s.l. species live longer during the dry season than in the rainy season [37]. This increased longevity may partly explain the elevated anthropophily observed in the hot season, as older females are more numerous and more active in seeking blood meals [60]. The lower anthropophily rates observed in Banigoungou and Tondibiah may be explained, on the one hand, by the greater availability of alternative hosts, particularly large ruminants such as cattle present in these sites [61]. On the other hand, the high level of individual protection among populations in these areas, exposed to persistent Culicidae aggressiveness, through the use of bed nets during the rainy season may also account for the reduced anthropophily. Within the An. gambiae complex, An. coluzzii was found to be more anthropophagic than An. arabiensis, which displayed a stronger tendency toward zoophagy. This observation supports our findings and may further explain the differences in infection rates previously mentioned between the two species. The highly anthropophagic behavior of An. coluzzii observed in this study corroborates results already reported in Niger [4] and Ghana de [47].

Similar to infection rates, the entomological inoculation rate (EIR) varied according to seasons and sites. Across all sites, the highest EIR was recorded during the rainy season, while the lowest was observed in the hot season. Between sites, Banigoungou, Tondibiah, and Lamordé exhibited the highest EIR values, whereas Koira-Tegui recorded the lowest. These findings indicate that malaria transmission in Niamey remains perennial, although it is more intense during the rainy season and varies spatially across neighborhoods. The variation in malaria transmission observed between sites in Niamey may be explained by differences in the abundance of An. gambiae s.l., the principal vector, driven by the bio-ecological characteristics previously described. Sites with the highest EIR also recorded relatively higher abundances of An. gambiae s.l.. Similar observations have been reported in Burkina Faso and Côte d’Ivoire [35] [38]. This pattern also aligns with studies on urban malaria, which established a gradient of transmission depending on whether neighborhoods are peripheral or centrally located [11]. According to Klinkenberg et al. [62] sites located near agricultural zones are more exposed to Anopheles bites than those farther away, thereby presenting a higher risk of malaria infection, with irrigated rice cultivation being particularly associated with transmission [43]. Indeed, Doannio et al. [63] demonstrated that malaria transmission rates in their study area were synchronized with the rice growth cycle. Furthermore, seasonal variation in transmission may be influenced by environmental temperature, which during the cold or hot seasons may fall below or exceed the optimal range for malaria transmission [64] contributing to the observed seasonality [38].

5. Conclusion

This study revealed the presence of six Anopheles species in Niamey: An. gambiae s.l., An. rufipes, An. funestus, An. pharoensis, An. ziemanni, and An. nili. An. gambiae s.l. was the most abundant vector, although subject to spatiotemporal variability. Malaria transmission was continuous throughout the year, with varying intensities depending on sites and seasons. Transmission was essentially sustained by An. coluzzii, the predominant species, and An. arabiensis, the only member of the An. gambiae s.l. complex was identified in this study. These vector species were present year-round, with particularly high abundance during the rainy season and in riparian sites along the Niger River, especially peripheral and rice-growing areas of the city. These findings underscore the need to adapt and strengthen vector control strategies in such high-risk locations.

Authors’ Contributions

NMS and AD designed the study. NMS, WH, ADS, SA, and IIA collected the data. NMS, MD, and WH analyzed the data, and NMS drafted the manuscript. AD, KMA, MIS, and IML critically revised the document.

Funding

This study received financial support from the SFR Racines structure, to whom we express our sincere gratitude.

Acknowledgements

We extend our thanks to the General Directorate of the Centre de Recherche Médicale et Sanitaire (CERMES) for making this work possible. We also thank the technicians of the Parasitology and Medical Entomology Unit for their assistance in sample collection and laboratory processing.

Conflicts of Interest

The authors declare no conflict of interest.

References

[1] WHO (2026) Maladies à transmission vectorielle.
https://www.who.int/fr/news-room/fact-sheets/detail/vector-borne-diseases
[2] WHO (2025) World Malaria Report 2025.
https://www.who.int/publications/i/item/9789240117822
[3] PNLP (2023) Plan Stratégique National de Lutte contre le Paludisme 2023.
[4] Ibrahim, S.S., Mukhtar, M.M., Irving, H., Labbo, R., Kusimo, M.O., Mahamadou, I., et al. (2019) High Plasmodium Infection and Multiple Insecticide Resistance in a Major Malaria Vector Anopheles coluzzii from Sahel of Niger Republic. Malaria Journal, 18, Article No. 181.[CrossRef] [PubMed]
[5] Labbo, R., Czeher, C., Djibrila, A., Arzika, I., Jeanne, I. and Duchemin, J.B. (2012) Longitudinal Follow-Up of Malaria Transmission Dynamics in Two Villages in a Sahelian Area of Niger during a Nationwide Insecticide-Treated Bednet Distribution Programme. Medical and Veterinary Entomology, 26, 386-395.[CrossRef] [PubMed]
[6] J. Julvez, J. Mouchet, A. Michault, A. Fouta, and M. Hamidine, (1997) Co-épidémiologie du paludisme à Niamey et dans la vallée du fleuve, République du Niger, 1992-1995. Bulletin de la Societe de Pathologie Exotique, 90, 94-100.
[7] De Silva, P.M. and Marshall, J.M. (2012) Factors Contributing to Urban Malaria Transmission in Sub-Saharan Africa: A Systematic Review. Journal of Tropical Medicine, 2012, Article ID: 819563.[CrossRef] [PubMed]
[8] Akono, P.N., Mbida, J.A.M., Tonga, C., Belong, P., Ngo Hondt, O.E., Magne, G.T., et al. (2015) Impact of Vegetable Crop Agriculture on Anopheline Agressivity and Malaria Transmission in Urban and Less Urbanized Settings of the South Region of Cameroon. Parasites & Vectors, 8, Article No. 293.[CrossRef] [PubMed]
[9] Dahoui, M.M.C., Adou, K.A., Coulibaly, B., Niamien, K.L., Koné, A., Cornelie, S., et al. (2023) Entomological Drivers of Uneven Malaria Transmission in Urban Lowland Areas in Bouaké, Côte d’Ivoire. Malaria Journal, 22, Article No. 34.[CrossRef] [PubMed]
[10] Diop, A., Ndiaye, F., Sturm-Ramirez, K., Konate, L., Senghor, M., Diouf, E.H., et al. (2023) Urban Malaria Vector Bionomics and Human Sleeping Behavior in Three Cities in Senegal. Parasites & Vectors, 16, Article No. 331.[CrossRef] [PubMed]
[11] Keiser, J., Utzinger, J., De Castro, M.C., Smith, T.A., Tanner, M. and Singer, B.H. (2004) Urbanization in Sub-Saharan Africa and Implication for Malaria Control. The American Journal of Tropical Medicine and Hygiene, 71, 118-127.[CrossRef] [PubMed]
[12] Doumbe-Belisse, P., Kopya, E., Ngadjeu, C.S., Sonhafouo-Chiana, N., Talipouo, A., Djamouko-Djonkam, L., et al. (2021) Urban Malaria in Sub-Saharan Africa: Dynamic of the Vectorial System and the Entomological Inoculation Rate. Malaria Journal, 20, Article No. 364.[CrossRef] [PubMed]
[13] Mwangangi, J.M., Midega, J., Kahindi, S., Njoroge, L., Nzovu, J., Githure, J., et al. (2011) Mosquito Species Abundance and Diversity in Malindi, Kenya and Their Potential Implication in Pathogen Transmission. Parasitology Research, 110, 61-71.[CrossRef] [PubMed]
[14] Hussain, I. and Hanjra, M.A. (2004) Irrigation and Poverty Alleviation: Review of the Empirical Evidence. Irrigation and Drainage, 53, 1-15.[CrossRef]
[15] Hawaria, D. and Kibret, S. (2023) Increased Malaria Incidence Following Irrigation Practices in the Endorheic Rift Valley Basin of Sidama Region, Ethiopia. PLOS ONE, 18, e0284247.[CrossRef] [PubMed]
[16] Ondeto, B.M., Wang, X., Atieli, H., Orondo, P.W., Ochwedo, K.O., Omondi, C.J., et al. (2022) Malaria Vector Bionomics and Transmission in Irrigated and Non-Irrigated Sites in Western Kenya. Parasitology Research, 121, 3529-3545.[CrossRef] [PubMed]
[17] Demissew, A., Hawaria, D., Kibret, S., Animut, A., Tsegaye, A., Lee, M., et al. (2020) Impact of Sugarcane Irrigation on Malaria Vector Anopheles Mosquito Fauna, Abundance and Seasonality in Arjo-Didessa, Ethiopia. Malaria Journal, 19, Article No. 344.[CrossRef] [PubMed]
[18] Hawaria, D., Demissew, A., Kibret, S., Lee, M., Yewhalaw, D. and Yan, G. (2020) Effects of Environmental Modification on the Diversity and Positivity of Anopheline Mosquito Aquatic Habitats at Arjo-Dedessa Irrigation Development Site, Southwest Ethiopia. Infectious Diseases of Poverty, 9, Article No. 9.[CrossRef] [PubMed]
[19] Chauvet, G., Dyemkouma, A., Rivière, F., Bellan, D. and Dabre, D. (1973) Enquête sur les insectes vecteurs de maladies ou de nuisance dans la ville et les environs de Niamey (Niger). OCCGE.
[20] Julvez, J., Develoux, M., Mounkaila, A. and Mouchet, J. (1992). Diversité du paludisme en zone sahélo-saharienne. Annales de la Société Belge de Médecine Tropicale 72, 163-177.
https://www.documentation.ird.fr/hor/fdi:38345.
[21] Mamane Salé, N., Labbo, R., Laminou, I.M., Issa Arzika, I., Djibo Souley, A., Zoulkifouly Hounkarin, W., et al. (2024) Insecticide Resistance in Anopheles gambiae Sensu Lato (Diptera: Culicidae) across Different Agroecosystems in Niamey, Niger. African Journal of Tropical Entomology Research, 3, 30-40.[CrossRef]
[22] N’Dri, B.P., Wipf, N.C., Saric, J., Fodjo, B.K., Raso, G., Utzinger, J., et al. (2023) Species Composition and Insecticide Resistance in Malaria Vectors in Ellibou, Southern Côte d’Ivoire and First Finding of Anopheles arabiensis in Côte d’Ivoire. Malaria Journal, 22, Article No. 93.[CrossRef] [PubMed]
[23] Coetzee, M. (2020) Key to the Females of Afrotropical Anopheles Mosquitoes (Diptera: Culicidae). Malaria Journal, 19, Article No. 70. [Google Scholar] [CrossRef] [PubMed]
[24] Rudbeck, L. and Dissing, J. (1998) Rapid, Simple Alkaline Extraction of Human Genomic DNA from Whole Blood, Buccal Epithelial Cells, Semen and Forensic Stains for PCR. BioTechniques, 25, 588-592.[CrossRef] [PubMed]
[25] Santolamazza, F., Mancini, E., Simard, F., Qi, Y., Tu, Z. and della Torre, A. (2008) Insertion Polymorphisms of SINE200 Retrotransposons within Speciation Islands of Anopheles gambiae Molecular Forms. Malaria Journal, 7, Article No. 163.[CrossRef] [PubMed]
[26] Echeverry, D.F., Deason, N.A., Makuru, V., Davidson, J., Xiao, H., Niedbalski, J., et al. (2017) Fast and Robust Single PCR for Plasmodium Sporozoite Detection in Mosquitoes Using the Cytochrome Oxidase I Gene. Malaria Journal, 16, Article No. 230.[CrossRef] [PubMed]
[27] Kent, R.J. and Norris, D.E. (2005) Identification of Mammalian Blood Meals in Mosquitoes by a Multiplexed Polymerase Chain Reaction Targeting Cytochrome B. The American Journal of Tropical Medicine and Hygiene, 73, 336-342.[CrossRef] [PubMed]
[28] Williams, J. and Pinto, J. (2012) Training Manual on Malaria Entomology.
https://www3.paho.org/hq/dmdocuments/2012/2012-Training-manual-malaria-entomology.pdf
[29] Dabiré, R.K., Namountougou, M., Sawadogo, S.P., Yaro, L.B., Toé, H.K., Ouari, A., et al. (2012) Population Dynamics of Anopheles gambiae S.L. in Bobo-Dioulasso City: Bionomics, Infection Rate and Susceptibility to Insecticides. Parasites & Vectors, 5, Article No. 127.[CrossRef] [PubMed]
[30] Labbo, R., Fandeur, T., Jeanne, I., Czeher, C., Williams, E., Arzika, I., et al. (2016) Ecology of Urban Malaria Vectors in Niamey, Republic of Niger. Malaria Journal, 15, Article No. 314.[CrossRef] [PubMed]
[31] Kwi, P.N., Ewane, E.E., Moyeh, M.N., Tangi, L.N., Ntui, V.N., Zeukeng, F., et al. (2022) Diversity and Behavioral Activity of Anopheles Mosquitoes on the Slopes of Mount Cameroon. Parasites & Vectors, 15, Article No. 344.[CrossRef] [PubMed]
[32] Traoré, A., Badolo, A., Guelbeogo, M.W., Sanou, A., Viana, M., Nelli, L., et al. (2019) Anopheline Species Composition and the 1014F-Genotype in Different Ecological Settings of Burkina Faso in Relation to Malaria Transmission. Malaria Journal, 18, Article No. 165.[CrossRef] [PubMed]
[33] Fondjo, E., Toto, J.C., Tchouaki, M., Wolfang, E., Patchoke, S., Menze, B., et al. (2022) High Vector Diversity and Malaria Transmission Dynamics in Five Sentinel Sites in Cameroon.[CrossRef]
[34] Soma, D.D., Poda, S.B., Hien, A.S., Namountougou, M., Sangaré, I., Sawadogo, J.M.E., et al. (2021) Malaria Vectors Diversity, Insecticide Resistance and Transmission during the Rainy Season in Peri-Urban Villages of South-Western Burkina Faso. Malaria Journal, 20, Article No. 63.[CrossRef] [PubMed]
[35] Soma, D.D., Zogo, B.M., Somé, A., Tchiekoi, B.N., Hien, D.F.D.S., Pooda, H.S., et al. (2020) Anopheles Bionomics, Insecticide Resistance and Malaria Transmission in Southwest Burkina Faso: A Pre-Intervention Study. PLOS ONE, 15, e0236920.[CrossRef] [PubMed]
[36] Zogo, B., Soma, D.D., Tchiekoi, B.N., Somé, A., Ahoua Alou, L.P., Koffi, A.A., et al. (2019) Anopheles Bionomics, Insecticide Resistance Mechanisms, and Malaria Transmission in the Korhogo Area, Northern Côte d’Ivoire: A Pre-Intervention Study. Parasite, 26, Article No. 40.[CrossRef] [PubMed]
[37] Yokoly, F.N., Zahouli, J.B.Z., Small, G., Ouattara, A.F., Opoku, M., de Souza, D.K., et al. (2021) Assessing Anopheles Vector Species Diversity and Transmission of Malaria in Four Health Districts along the Borders of Côte d’Ivoire. Malaria Journal, 20, Article No. 409.[CrossRef] [PubMed]
[38] Koffi, A.A., Camara, S., Ahoua Alou, L.P., Oumbouke, W.A., Wolie, R.Z., Tia, I.Z., et al. (2023) Anopheles Vector Distribution and Malaria Transmission Dynamics in Gbêkê Region, Central Côte d’Ivoire. Malaria Journal, 22, Article No. 192.[CrossRef] [PubMed]
[39] Hamza, A.A., Dogara, M.M., Balogun, J.B., Omotayo, A.I., Adeniyi, K.A., Abubakar, A.S., et al. (2023) Entomological Surveillance Reveals Transmission of Malaria but Not Lymphatic Filariasis in Two Communities in North-West Nigeria. Parasitology Research, 123, Article No. 26.[CrossRef] [PubMed]
[40] Labbo, R., Fouta, A., Jeanne, I., Ousmane, I. and Duchemin, J. (2004) Anopheles funestus in Sahel: New Evidence from Niger. The Lancet, 363, 660.[CrossRef] [PubMed]
[41] Czeher, C. (2010) Distribution nationale de moustiquaires imprégnées d’insecticide au Niger: Effets sur les anophèles vecteurs. Ph.D. Thesis, Université de Versailles-Saint Quentin en Yvelines.
[42] Labbo, R., Fatouma, A.D., Amadou, S., Ibrahim, A., Izamné, M., Saadou, K. and Ouwe Missi Oukem-Boyer, O. (2017) Productivity of Malaria Vectors from Drain-age Ditches in Niamey, Republic of Niger. JSM Environmental Science and Ecology, 5, Article 1052.
[43] Mwangangi, J.M., Shililu, J., Muturi, E.J., Muriu, S., Jacob, B., Kabiru, E.W., et al. (2010) Anopheles Larval Abundance and Diversity in Three Rice Agro-Village Complexes Mwea Irrigation Scheme, Central Kenya. Malaria Journal, 9, Article No. 228.[CrossRef] [PubMed]
[44] Mamane Sale, N., Zamanka Naroua, H., Zoulkifouly Hounkarin, W., Labbo, R., Maman Laminou, I., Djibo Souley, A., et al. (2023) Influence des facteurs environnementauxsur labondance des anopheles dans les differents agroecosystemes de la ville de niamey. International Journal of Advanced Research, 11, 1-15.[CrossRef]
[45] Ngadjeu, C.S., Doumbe-Belisse, P., Talipouo, A., Djamouko-Djonkam, L., Awono-Ambene, P., Kekeunou, S., et al. (2020) Influence of House Characteristics on Mosquito Distribution and Malaria Transmission in the City of Yaoundé, Cameroon. Malaria Journal, 19, Article No. 53.[CrossRef] [PubMed]
[46] Salako, A.S., Ossè, R., Padonou, G.G., Dagnon, F., Aïkpon, R., Kpanou, C., et al. (2019) Population Dynamics of Anopheles gambiae S.L. and Culex quinquefasciatus in Rural and Urban Settings before an Indoor Residual Spraying Campaign in Northern Benin. Vector-Borne and Zoonotic Diseases, 19, 674-684.[CrossRef] [PubMed]
[47] Forson, A.O., Hinne, I.A., Dhikrullahi, S.B., Sraku, I.K., Mohammed, A.R., Attah, S.K., et al. (2022) The Resting Behavior of Malaria Vectors in Different Ecological Zones of Ghana and Its Implications for Vector Control. Parasites & Vectors, 15, Article No. 246.[CrossRef] [PubMed]
[48] Thabet, H.S., TagEldin, R.A., Fahmy, N.T., Diclaro, J.W., Alaribe, A.A., Ezedinachi, E., et al. (2022) Spatial Distribution of PCR-Identified Species of Anopheles gambiae Senu lato (Diptera: Culicidae) across Three Eco-Vegetational Zones in Cross River State, Nigeria. Journal of Medical Entomology, 59, 576-584.[CrossRef] [PubMed]
[49] Kouassi, B.L., Edi, C., Ouattara, A.F., Ekra, A.K., Bellai, L.G., Gouaméné, J., et al. (2023) Entomological Monitoring Data Driving Decision-Making for Appropriate and Sustainable Malaria Vector Control in Côte d’Ivoire. Malaria Journal, 22, Article No. 14.[CrossRef] [PubMed]
[50] Gimonneau, G., Pombi, M., Choisy, M., Morand, S., Dabiré, R.K. and Simard, F. (2011) Larval Habitat Segregation between the Molecular Forms of the Mosquito Anopheles gambiae in a Rice Field Area of Burkina Faso, West Africa. Medical and Veterinary Entomology, 26, 9-17.[CrossRef] [PubMed]
[51] Ibrahim, S.S., Fadel, A.N., Tchouakui, M., Terence, E., Wondji, M.J., Tchoupo, M., et al. (2019) High Insecticide Resistance in the Major Malaria Vector Anopheles coluzzii in Chad Republic. Infectious Diseases of Poverty, 8, Article No. 100.[CrossRef] [PubMed]
[52] Ibrahim, S.S., Manu, Y.A., Tukur, Z., Irving, H. and Wondji, C.S. (2014) High Frequency of kdr L1014F Is Associated with Pyrethroid Resistance in Anopheles coluzzii in Sudan Savannah of Northern Nigeria. BMC Infectious Diseases, 14, Article No. 441.[CrossRef] [PubMed]
[53] Touré, Y.T., Petrarca, V., Traoré, S.F., Coulibaly, A., Maiga, H.M., Sankaré, O., Sow, M., Di Deco, M.A. and Coluzzi, M. (1998) The Distribution and Inversion Polymorphism of Chromosomally Recognized Taxa of the Anopheles gambiae Complex in Mali, West Africa. Parassitologia, 40, 477-511.
[54] Okiwelu, S., Ebenezer, A., Agi, P., Noutcha, M.E., Awolola, T. and Oduola, A. (2012) Species Composition of the Anopheles gambiae Complex across Eco-Vegetational Zones in Bayelsa State, Niger Delta Region, Nigeria. Journal of Vector Borne Diseases, 49, 164-167.[CrossRef]
[55] Pombi, M., Calzetta, M., Guelbeogo, W.M., Manica, M., Perugini, E., Pichler, V., et al. (2018) Unexpectedly High Plasmodium Sporozoite Rate Associated with Low Human Blood Index in Anopheles coluzzii from a LLIN-Protected Village in Burkina Faso. Scientific Reports, 8, Article No. 12806.[CrossRef] [PubMed]
[56] Saili, K., de Jager, C., Sangoro, O.P., Nkya, T.E., Masaninga, F., Mwenya, M., et al. (2023) Anopheles rufipes Implicated in Malaria Transmission Both Indoors and Outdoors Alongside Anopheles Funestus and Anopheles arabiensis in Rural South-East Zambia. Malaria Journal, 22, Article No. 95.[CrossRef] [PubMed]
[57] Ibrahim, S.S., Mukhtar, M.M., Irving, H., Riveron, J.M., Fadel, A.N., Tchapga, W., et al. (2020) Exploring the Mechanisms of Multiple Insecticide Resistance in a Highly Plasmodium-Infected Malaria Vector Anopheles funestus Sensu Stricto from Sahel of Northern Nigeria. Genes, 11, Article 454.[CrossRef] [PubMed]
[58] Coulibaly, B., Kone, R., Barry, M.S., Emerson, B., Coulibaly, M.B., Niare, O., et al. (2016) Malaria Vector Populations across Ecological Zones in Guinea Conakry and Mali, West Africa. Malaria Journal, 15, Article No. 191.[CrossRef] [PubMed]
[59] Tabue, R.N., Awono-Ambene, P., Etang, J., Atangana, J., C, A., Toto, J.C., et al. (2017) Role of Anopheles (Cellia) rufipes (Gough, 1910) and Other Local Anophelines in Human Malaria Transmission in the Northern Savannah of Cameroon: A Cross-Sectional Survey. Parasites & Vectors, 10, Article No. 22.[CrossRef] [PubMed]
[60] Ould Lemrabott, M.A., Ould Ahmedou Salem, M.S., Ould Brahim, K., Brengues, C., Rossignol, M., Bogreau, H., et al. (2018) Seasonal Abundance, Blood Meal Sources and Insecticide Susceptibility in Major Anopheline Malaria Vectors from Southern Mauritania. Parasites & Vectors, 11, Article No. 232.[CrossRef] [PubMed]
[61] Minakawa, N., Seda, P. and Yan, G. (2002) Influence of Host and Larval Habitat Distribution on the Abundance of African Malaria Vectors in Western Kenya. The American Journal of Tropical Medicine and Hygiene, 67, 32-38.[CrossRef] [PubMed]
[62] Klinkenberg, E., McCall, P., Wilson, M.D., Amerasinghe, F.P. and Donnelly, M.J. (2008) Impact of Urban Agriculture on Malaria Vectors in Accra, Ghana. Malaria Journal, 7, Article No. 151.[CrossRef] [PubMed]
[63] Doannio, J.M.C., Dossou-Yovo, J., Diarrassouba, S., Rakotondraibé, M.E., Chauvancy, G. and Chandre, F. (2002) [Dynamics of Malaria Transmission in Kafi-né, a Rice Growing Village in a Humid Savannah Area of Côte d’Ivoire]. Bulletin de la Societe de Pathologie Exotique, 95, 11-16.
[64] Beck-Johnson, L.M., Nelson, W.A., Paaijmans, K.P., Read, A.F., Thomas, M.B. and Bjørnstad, O.N. (2017) The Importance of Temperature Fluctuations in Understanding Mosquito Population Dynamics and Malaria Risk. Royal Society Open Science, 4, Article ID: 160969.[CrossRef] [PubMed]

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.