Natural Wolbachia Infections in Anopheles funestus Complex Mosquitoes in Burkina Faso

Abstract

Wolbachia is a maternally transmitted endosymbiotic bacterium with demonstrated potential for modulating vector competence and suppressing Plasmodium falciparum development in Anopheles mosquitoes. While naturally occurring Wolbachia infections have been reported in Anopheles gambiae sensu lato in Burkina Faso, the extent of its distribution among other key malaria vectors, particularly within the Anopheles funestus complex remains unclear. This study aimed to assess the presence and prevalence of natural Wolbachia infections in wild An. funestus complex populations from western Burkina Faso. Adult females were collected from Soumousso and screened for Wolbachia using a quantitative PCR assay targeting the 16S rRNA gene (W16S-qPCR). Molecular species identification was conducted on a subsample to resolve intra-group composition. Of 329 individuals identified, An. funestus sensu stricto accounted for 50.2% of the sample, with An. rivulorum-like (23.4%) and An. leesoni (5.8%) also present. A notable proportion of specimens exhibited mixed molecular profiles, indicating possible limitations in marker resolution or interspecific hybridization. Out of 510 specimens tested by qPCR, Wolbachia DNA was detected in 178 individuals, yielding an overall infection prevalence of 34.9%. Stratified by species, An. funestus sensu stricto exhibited the highest prevalence (36.4%), followed by An. leesoni and An. rivulorum-like. These findings provide the first molecular evidence of natural Wolbachia infections in An. funestus complex mosquitoes in Burkina Faso. The observed infection rates, particularly in An. funestus s.s., a major malaria vector, underscore the potential epidemiological relevance of this symbiosis. Further genomic and functional characterization of the detected Wolbachia strains is essential to elucidate their phylogenetic origins, tissue tropism, and potential influence on Plasmodium development. Such insights will be critical for evaluating the suitability of Wolbachia-based biocontrol strategies in African vector populations where An. funestus plays a dominant role in residual malaria transmission.

Share and Cite:

de Souza, M.R., Gnambani, E.J., Gomgnimbou, M.K., Diabate, A. and Bilgo, E. (2026) Natural Wolbachia Infections in Anopheles funestus Complex Mosquitoes in Burkina Faso. American Journal of Molecular Biology, 16, 60-66. doi: 10.4236/ajmb.2026.161005.

1. Introduction

Wolbachia is a maternally inherited intracellular bacterium that infects a wide range of arthropods and some nematodes [1]. In mosquitoes, Wolbachia has shown great promise as a symbiont capable of reducing vector competence for Plasmodium falciparum, the parasite responsible for the most lethal form of malaria [2]. While transinfected Wolbachia strains have been used in pilot malaria control programs, naturally occurring infections in African malaria vectors remain poorly characterized [3]. Previous evidence has demonstrated natural Wolbachia infections in An. gambiae (s.l.) in Burkina Faso [4], raising the question of whether similar infections occur in other primary vectors such as An. funestus, which contributes substantially to residual malaria transmission. This study investigates the prevalence and species-specific distribution of natural Wolbachia infections in An. funestus complex mosquitoes collected in western Burkina Faso.

2. Materials and Methods

Mosquitoes from the Anopheles funestus group were collected in Soumousso (Houet Province, western Burkina Faso) using CDC light traps between June and November 2022. Adult females were morphologically identified and further processed for species-level confirmation using ITS2-PCR molecular assays according to the protocol described by [5], which includes species-specific primers. This approach allows the differentiation of the six members of the An. funestus group, including An. rivulorum-like, a distinct species within the complex that was first described in Burkina Faso in 2000 and later reported in Cameroon and Zambia.

Total DNA was extracted from individual mosquitoes using the CTAB protocol. The presence of Wolbachia was assessed using a qPCR assay targeting the Wolbachia 16S rRNA gene (W16S-qPCR), using the primer pair W16S-qPCR_F (CATACCTATTCGAAGGGATAG) and W16S-qPCR_R (TTGCGGGACTTAACCCAACA). qPCR reactions were performed using the 5x HOT FIREPol EvaGreen qPCR Mix Plus (ROX) kit (Solis BioDyne, Tartu, Estonie). The cycling conditions consisted of an initial denaturation at 95˚C for 12 minutes, followed by 40 cycles of 15 s denaturation at 95˚C, 20 s annealing at 58˚C, and 20 s extension at 72˚C. All reactions were run on QuantStudio 5 (Thermo Fisher Scientific, USA) qPCR platform. Each qPCR plate contained extraction blanks, and a Wolbachia-infected mosquito DNA control to monitor contamination and assay performance. Samples with Ct values <35 were considered positif. A subset of samples underwent molecular species identification to determine intra-group composition and assess infection prevalence by species. Statistical analysis was performed to calculate prevalence estimates and 95% confidence intervals.

3. Results

3.1. Specie Composition of the Anopheles funestus Complex

The species distribution within the Anopheles funestus group revealed a predominance of An. funestus sensu stricto (50.15%), followed by An. rivulorum-like (23.4%) out of a total of 329 identified mosquitoes. An. leesoni was detected at lower proportions (5.8%). Mixed molecular profiles (An. leesoni/An. funestus, An. leesoni/An. rivulorum-like, An. rivulorum-like/An. funestus) were also observed, likely indicating limitations in the molecular identification method (Figure 1).

Figure 1. Percentage composition of species Within the An. funestus Complex.

3.2. Wolbachia Infections in Wild Anopheles funestus Populations

Among 510 An. funestus group mosquitoes tested using real-time PCR, Wolbachia DNA was detected in 178 individuals, corresponding to an infection frequency of 34.9%. Species-specific prevalence rates were 36.36% in An. funestus s.s. and 25.97% in An. rivulorum-like (Table 1).

Table 1. Prevalence of Wolbachia Infection by Species within the Anopheles funestus complex.

Mosquito species

Sample size (n)

Prevalence (%) [95% IC]

An. funestus s.s.

165

36.36 (29.03 - 44.2)

An. leesoni

19

26.32 (9.15 - 51.2)

An. rivulorum-like

77

25.97 (16.64 - 37.23)

4. Discussion

This study provides molecular evidence of natural Wolbachia infections in An. funestus complex mosquitoes in Burkina Faso. The relatively high prevalence observed, particularly in An. funestus s.s., suggests that Wolbachia may be more widely distributed among African malaria vectors than previously assumed. This observation is consistent with emerging reports from other regions in sub-Saharan Africa [6]-[8]. This high natural prevalence of Wolbachia may reflect a stable ecological association, even though evidence from [9] suggests that it is unlikely to result from long-term coevolution.

Mixed ITS2-PCR profiles were observed in some specimens. These patterns may arise from several methodological limitations inherent to the ITS2 marker. First, cross-amplification can occur among closely related species that share highly similar ITS2 sequences [10] [11]. Second, intragenomic variation within the ribosomal DNA array documented in several Anopheles taxa can generate heterogeneous ITS2 copies within a single individual, leading to mixed amplification products [12]. Finally, although rarely reported, hybridization events between sibling species within the An. funestus complex cannot be fully excluded and may also contribute to atypical PCR profiles [11]. This underscores the need to refine molecular diagnostic tools for species delineation within the funestus complex.

The higher prevalence of Wolbachia observed in An. funestus sensu stricto is particularly noteworthy. It is well established that An. funestus s.s. is the primary vector species within the An. funestus group [13]. Although the mechanisms underlying Wolbachia-Plasmodium interactions in Anopheles remain poorly understood [14], several studies have shown that certain Wolbachia strains can modulate vector competence by affecting mosquito survival, fecundity, or parasite development [15] [16]. In field settings, natural infections have also been associated with reduced sporozoite prevalence or decreased mosquito longevity [2] [17] [18]. Therefore, in a highly anthropophilic and endophilic vector such as An. funestus s.s., even moderate Wolbachia effects could have more direct consequences on Plasmodium transmission dynamics.

Although this study did not determine the Wolbachia strain types or their effects on Plasmodium development, the findings support further investigation into the functional role of naturally occurring Wolbachia in malaria transmission dynamics. Genomic characterization, tissue tropism analysis, and parasite interaction studies will be essential to evaluate whether these native infections offer transmission-blocking potential. Such evidence would be critical for informing Wolbachia-based strategies as part of integrated malaria control programs

5. Conclusion

We report the presence of natural Wolbachia infections in Anopheles funestus complex mosquitoes from western Burkina Faso, with a substantial infection rate in An. funestus sensu stricto. These findings expand the known host range of Wolbachia among African malaria vectors and provide a foundation for future work to assess their utility in malaria control. Continued research is needed to characterize the strains and understand their biological significance.

Ethics Approval and Consent to Participate

Not applicable (mosquito sampling only).

Consent for Publication

All authors’ consent to publication.

Availability of Data and Materials

Available upon reasonable request.

Funding

This work was supported by the African Research Initiative for Scientific Excellence (ARISE) grant (ref: ARISE-PP-143) awarded to Dr. Etienne Bilgo. The ARISE project is funded by the European Union and implemented by the African Academy of Sciences, in partnership with the African Union Commission and the European Commission.

Authors’ contributions

MRdS, AD, MKG and EB design the study. MRdS EJG performed the assays and MRdS and EB wrote the first draft of the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We thank the field team in Soumousso and the insectary technicians for their support.

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

References

[1] Kaur, R., Shropshire, J.D., Cross, K.L., Leigh, B., Mansueto, A.J., Stewart, V., et al. (2021) Living in the Endosymbiotic World of Wolbachia: A Centennial Review. Cell Host & Microbe, 29, 879-893.[CrossRef] [PubMed]
[2] Shaw, W.R., Marcenac, P., Childs, L.M., Buckee, C.O., Baldini, F., Sawadogo, S.P., et al. (2016) Wolbachia Infections in Natural Anopheles Populations Affect Egg Laying and Negatively Correlate with Plasmodium Development. Nature Communications, 7, Article No. 11772.[CrossRef] [PubMed]
[3] Inácio da Silva, L.M., Dezordi, F.Z., Paiva, M.H.S. and Wallau, G.L. (2021) Systematic Review of Wolbachia Symbiont Detection in Mosquitoes: An Entangled Topic about Methodological Power and True Symbiosis. Pathogens, 10, Article 39.[CrossRef] [PubMed]
[4] Baldini, F., Segata, N., Pompon, J., Marcenac, P., Robert Shaw, W., Dabiré, R.K., et al. (2014) Evidence of Natural Wolbachia Infections in Field Populations of Anopheles gambiae. Nature Communications, 5, Article No. 3985.[CrossRef] [PubMed]
[5] Cohuet, A., Simard, F., Toto, J., Kengne, P., Coetzee, M. and Fontenille, D. (2003) Species Identification within the Anopheles funestus Group of Malaria Vectors in Cameroon and Evidence for a New Species. The American Journal of Tropical Medicine and Hygiene, 69, 200-205.[CrossRef] [PubMed]
[6] Estelle, D.L., Jacques, G.E., Issiaka, S., Lovett, B., Abdoulaye, D. and Etienne, B. (2025) Unstable Laboratory Wolbachia Strain w-Anga Is Negatively Correlated with Plasmodium falciparum in Wild Malaria Vectors. Scientific Reports, 15, Article No. 17732.[CrossRef] [PubMed]
[7] Baldini, F., Rougé, J., Kreppel, K., Mkandawile, G., Mapua, S.A., Sikulu-Lord, M., et al. (2018) First Report of Natural Wolbachia Infection in the Malaria Mosquito Anopheles arabiensis in Tanzania. Parasites & Vectors, 11, Article No. 635.[CrossRef] [PubMed]
[8] Walker, T., Quek, S., Jeffries, C.L., Bandibabone, J., Dhokiya, V., Bamou, R., et al. (2021) Stable High-Density and Maternally Inherited Wolbachia Infections in Anopheles moucheti and Anopheles demeilloni Mosquitoes. Current Biology, 31, 2310-2320.e5.[CrossRef] [PubMed]
[9] Chrostek, E. and Gerth, M. (2019) Is Anopheles gambiae a Natural Host of Wolbachia? mBio, 10, e00784-19.[CrossRef] [PubMed]
[10] Erlank, E., Koekemoer, L.L. and Coetzee, M. (2018) The Importance of Morphological Identification of African Anopheline Mosquitoes (Diptera: Culicidae) for Malaria Control Programmes. Malaria Journal, 17, Article No. 43.[CrossRef] [PubMed]
[11] Odero, J.O., Nambunga, I.H., Wangrawa, D.W., Badolo, A., Weetman, D., Koekemoer, L.L., et al. (2023) Advances in the Genetic Characterization of the Malaria Vector, Anopheles funestus, and Implications for Improved Surveillance and Control. Malaria Journal, 22, Article No. 230.[CrossRef] [PubMed]
[12] Mishra, S., Sharma, G., Das, M.K., Pande, V. and Singh, O.P. (2021) Intragenomic Sequence Variations in the Second Internal Transcribed Spacer (ITS2) Ribosomal DNA of the Malaria Vector Anopheles stephensi. PLOS ONE, 16, e0253173.[CrossRef] [PubMed]
[13] Ogola, E.O., Fillinger, U., Ondiba, I.M., Villinger, J., Masiga, D.K., Torto, B., et al. (2018) Insights into Malaria Transmission among Anopheles funestus Mosquitoes, Kenya. Parasites & Vectors, 11, Article No. 577.[CrossRef] [PubMed]
[14] Straub, T.J., Shaw, W.R., Marcenac, P., Sawadogo, S.P., Dabiré, R.K., Diabaté, A., et al. (2020) The Anopheles coluzzii Microbiome and Its Interaction with the Intracellular Parasite WOLBACHIA. Scientific Reports, 10, Article No. 13847.[CrossRef] [PubMed]
[15] Hughes, G.L., Koga, R., Xue, P., Fukatsu, T. and Rasgon, J.L. (2011) Wolbachia Infections Are Virulent and Inhibit the Human Malaria Parasite Plasmodium falciparum in Anopheles gambiae. PLOS Pathogens, 7, e1002043.[CrossRef] [PubMed]
[16] Joshi, D., McFadden, M.J., Bevins, D., Zhang, F. and Xi, Z. (2014) Wolbachia Strain W AlbB Confers Both Fitness Costs and Benefit on Anopheles Stephensi. Parasites & Vectors, 7, Article No. 336.[CrossRef] [PubMed]
[17] Gomes, F.M., Hixson, B.L., Tyner, M.D.W., Ramirez, J.L., Canepa, G.E., Alves e Silva, T.L., et al. (2017) Effect of Naturally Occurring Wolbachia in Anopheles gambiae S.L. Mosquitoes from Mali on Plasmodium falciparum Malaria Transmission. Proceedings of the National Academy of Sciences of the United States of America, 114, 12566-12571.[CrossRef] [PubMed]
[18] Wong, M.L., Liew, J.W.K., Wong, W.K., Pramasivan, S., Mohamed Hassan, N., Wan Sulaiman, W.Y., et al. (2020) Natural Wolbachia Infection in Field-Collected Anopheles and Other Mosquito Species from Malaysia. Parasites & Vectors, 13, Article No. 414.[CrossRef] [PubMed]

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.