1. Introduction
Wolbachia is a maternally inherited intracellular bacterium that infects a wide range of arthropods and some nematodes [1]. In mosquitoes, Wolbachia has shown great promise as a symbiont capable of reducing vector competence for Plasmodium falciparum, the parasite responsible for the most lethal form of malaria [2]. While transinfected Wolbachia strains have been used in pilot malaria control programs, naturally occurring infections in African malaria vectors remain poorly characterized [3]. Previous evidence has demonstrated natural Wolbachia infections in An. gambiae (s.l.) in Burkina Faso [4], raising the question of whether similar infections occur in other primary vectors such as An. funestus, which contributes substantially to residual malaria transmission. This study investigates the prevalence and species-specific distribution of natural Wolbachia infections in An. funestus complex mosquitoes collected in western Burkina Faso.
2. Materials and Methods
Mosquitoes from the Anopheles funestus group were collected in Soumousso (Houet Province, western Burkina Faso) using CDC light traps between June and November 2022. Adult females were morphologically identified and further processed for species-level confirmation using ITS2-PCR molecular assays according to the protocol described by [5], which includes species-specific primers. This approach allows the differentiation of the six members of the An. funestus group, including An. rivulorum-like, a distinct species within the complex that was first described in Burkina Faso in 2000 and later reported in Cameroon and Zambia.
Total DNA was extracted from individual mosquitoes using the CTAB protocol. The presence of Wolbachia was assessed using a qPCR assay targeting the Wolbachia 16S rRNA gene (W16S-qPCR), using the primer pair W16S-qPCR_F (CATACCTATTCGAAGGGATAG) and W16S-qPCR_R (TTGCGGGACTTAACCCAACA). qPCR reactions were performed using the 5x HOT FIREPol EvaGreen qPCR Mix Plus (ROX) kit (Solis BioDyne, Tartu, Estonie). The cycling conditions consisted of an initial denaturation at 95˚C for 12 minutes, followed by 40 cycles of 15 s denaturation at 95˚C, 20 s annealing at 58˚C, and 20 s extension at 72˚C. All reactions were run on QuantStudio 5 (Thermo Fisher Scientific, USA) qPCR platform. Each qPCR plate contained extraction blanks, and a Wolbachia-infected mosquito DNA control to monitor contamination and assay performance. Samples with Ct values <35 were considered positif. A subset of samples underwent molecular species identification to determine intra-group composition and assess infection prevalence by species. Statistical analysis was performed to calculate prevalence estimates and 95% confidence intervals.
3. Results
3.1. Specie Composition of the Anopheles funestus Complex
The species distribution within the Anopheles funestus group revealed a predominance of An. funestus sensu stricto (50.15%), followed by An. rivulorum-like (23.4%) out of a total of 329 identified mosquitoes. An. leesoni was detected at lower proportions (5.8%). Mixed molecular profiles (An. leesoni/An. funestus, An. leesoni/An. rivulorum-like, An. rivulorum-like/An. funestus) were also observed, likely indicating limitations in the molecular identification method (Figure 1).
Figure 1. Percentage composition of species Within the An. funestus Complex.
3.2. Wolbachia Infections in Wild Anopheles funestus Populations
Among 510 An. funestus group mosquitoes tested using real-time PCR, Wolbachia DNA was detected in 178 individuals, corresponding to an infection frequency of 34.9%. Species-specific prevalence rates were 36.36% in An. funestus s.s. and 25.97% in An. rivulorum-like (Table 1).
Table 1. Prevalence of Wolbachia Infection by Species within the Anopheles funestus complex.
Mosquito species |
Sample size (n) |
Prevalence (%) [95% IC] |
An. funestus s.s. |
165 |
36.36 (29.03 - 44.2) |
An. leesoni |
19 |
26.32 (9.15 - 51.2) |
An. rivulorum-like |
77 |
25.97 (16.64 - 37.23) |
4. Discussion
This study provides molecular evidence of natural Wolbachia infections in An. funestus complex mosquitoes in Burkina Faso. The relatively high prevalence observed, particularly in An. funestus s.s., suggests that Wolbachia may be more widely distributed among African malaria vectors than previously assumed. This observation is consistent with emerging reports from other regions in sub-Saharan Africa [6]-[8]. This high natural prevalence of Wolbachia may reflect a stable ecological association, even though evidence from [9] suggests that it is unlikely to result from long-term coevolution.
Mixed ITS2-PCR profiles were observed in some specimens. These patterns may arise from several methodological limitations inherent to the ITS2 marker. First, cross-amplification can occur among closely related species that share highly similar ITS2 sequences [10] [11]. Second, intragenomic variation within the ribosomal DNA array documented in several Anopheles taxa can generate heterogeneous ITS2 copies within a single individual, leading to mixed amplification products [12]. Finally, although rarely reported, hybridization events between sibling species within the An. funestus complex cannot be fully excluded and may also contribute to atypical PCR profiles [11]. This underscores the need to refine molecular diagnostic tools for species delineation within the funestus complex.
The higher prevalence of Wolbachia observed in An. funestus sensu stricto is particularly noteworthy. It is well established that An. funestus s.s. is the primary vector species within the An. funestus group [13]. Although the mechanisms underlying Wolbachia-Plasmodium interactions in Anopheles remain poorly understood [14], several studies have shown that certain Wolbachia strains can modulate vector competence by affecting mosquito survival, fecundity, or parasite development [15] [16]. In field settings, natural infections have also been associated with reduced sporozoite prevalence or decreased mosquito longevity [2] [17] [18]. Therefore, in a highly anthropophilic and endophilic vector such as An. funestus s.s., even moderate Wolbachia effects could have more direct consequences on Plasmodium transmission dynamics.
Although this study did not determine the Wolbachia strain types or their effects on Plasmodium development, the findings support further investigation into the functional role of naturally occurring Wolbachia in malaria transmission dynamics. Genomic characterization, tissue tropism analysis, and parasite interaction studies will be essential to evaluate whether these native infections offer transmission-blocking potential. Such evidence would be critical for informing Wolbachia-based strategies as part of integrated malaria control programs
5. Conclusion
We report the presence of natural Wolbachia infections in Anopheles funestus complex mosquitoes from western Burkina Faso, with a substantial infection rate in An. funestus sensu stricto. These findings expand the known host range of Wolbachia among African malaria vectors and provide a foundation for future work to assess their utility in malaria control. Continued research is needed to characterize the strains and understand their biological significance.
Ethics Approval and Consent to Participate
Not applicable (mosquito sampling only).
Consent for Publication
All authors’ consent to publication.
Availability of Data and Materials
Available upon reasonable request.
Funding
This work was supported by the African Research Initiative for Scientific Excellence (ARISE) grant (ref: ARISE-PP-143) awarded to Dr. Etienne Bilgo. The ARISE project is funded by the European Union and implemented by the African Academy of Sciences, in partnership with the African Union Commission and the European Commission.
Authors’ contributions
MRdS, AD, MKG and EB design the study. MRdS EJG performed the assays and MRdS and EB wrote the first draft of the manuscript. All authors read and approved the final manuscript.
Acknowledgements
We thank the field team in Soumousso and the insectary technicians for their support.