Microbiological Quality and Artisanal Manufacturing Practices for “Kilishi” Dried and Spiced Meat in Niamey (Niger)
Hadiza Bawa Ibrahim1,2*orcid, Mamadou Abdoulaye Konare3, Mahamadou Bello Issa Adam4, Mohamed Sanoussi2, Alio Mahamadou Fody5,6, Nicolas Barro2
1Department of Life and Earth Sciences, Lédéa Bernard Ouedraogo University, Ouahigouya, Burkina Faso.
2Molecular Biology Laboratory for Epidemiology and Surveillance of Bacteria and Viruses Transmitted by Food and Water, University of Joseph Ki-Zerbo, Ouagadougou, Burkina Faso.
3Biosciences and Applications Laboratory (LBA), University of Sciences, Techniques and Technologies of Bamako (USTTB), Bamako, Mali.
4Laboratory of Biochemistry, Biotechnology, Food Technology and Nutrition (LABIOTAN), Ouagadougou, Burkina Faso.
5Higher Normal School, Niamey, Niger.
6Department of Life and Earth Sciences, Abdou Moumouni University, Niamey, Niger.
DOI: 10.4236/fns.2026.171003   PDF    HTML   XML   80 Downloads   435 Views  

Abstract

Kilishi, Niger’s iconic dried and spiced meat, is a crucial source of protein and an essential socio-economic asset. However, its artisanal production and informal marketing raise significant concerns about quality and safety. This study examined the Kilishi value chain in Niamey by documenting traditional manufacturing methods and evaluating the product’s microbiological quality. Manufacturing practices were characterized through semi-structured interviews and direct observations. Sixty samples of three Kilishi types (red, white, plain) were analyzed using standard culture techniques, multiplex PCR for identifying Escherichia coli (E. coli), and serotyping for Salmonella. The findings showed that traditional practices such as open-air drying, the use of cement bag paper for packaging, and manual handling pose multiple vulnerabilities. Microbiological testing revealed notable contamination: 41.7% (25/60) of samples contained Escherichia coli, with pathogenic strains identified (Enterotoxinogen Escherichia coli (ETEC): 6.67%; Enterotoxinogenic Escherichia coli-Enteropathogenic Escherichia coli (ETEC-EPEC): 5%). Salmonella spp. were found in 6.7% (4/60) of samples, including one strain of Salmonella typhi (1.67%). The average fecal coliform level (3.40 × 104 CFU/g) consistently exceeded the local standard of 103 CFU/g. Traditional Kilishi practices pose significant health risks to consumers. It is crucial to implement hygiene and safety measures throughout the entire production process to preserve Kilishi’s cultural value while ensuring its safety.

Share and Cite:

Bawa Ibrahim, H., Konare, M.A., Issa Adam, M.B., Sanoussi, S., Fody, M.A. and Barro, N. (2026) Microbiological Quality and Artisanal Manufacturing Practices for “Kilishi” Dried and Spiced Meat in Niamey (Niger). Food and Nutrition Sciences, 17, 27-39. doi: 10.4236/fns.2026.171003.

1. Introduction

Meat plays an essential role in human nutrition, being a rich source of protein, iron, zinc, selenium, and B vitamins [1]. In Niger and the Sahel, Kilishi, a traditional specialty made from thin strips of meat (primarily beef), is widely popular for its distinctive flavor and long shelf life [2]. It represents a vital protein source and holds significant economic and cultural importance for many households [3]. However, despite its importance, the production and marketing of Kilishi primarily occur in artisanal, unregulated settings, raising serious concerns about food safety [4]. Traditional techniques often lack hygiene standards, monitoring, and awareness of good practices [5]. The product’s exposure to the external environment (dust, insects, stray animals) during drying, along with post-cooking handling practices, compromises its integrity, leading to risks of microbiological, physical, or chemical contamination [6]. The final cooking, while beneficial, is insufficient when application conditions vary or subsequent recontamination occurs. This issue is a significant public health concern, as Kilishi is widely consumed, including by at-risk groups. In this context, this study aims to analyze the microbiological quality and artisanal manufacturing practices of the dried and spiced meat (Kilishi) in Niamey (Niger).

2. Methodology

2.1. Study Type, Sites, and Period

This study, conducted in Niamey, Niger, combined qualitative methods (observations and interviews) and quantitative methods (laboratory analyses) to assess the microbiological quality of Kilishi (the finished product). Sample collection took place from June to September 2024, and analyses ran from October 2024 to February 2025.

2.2. Qualitative Data Collection

Data were collected through semi-structured interviews and direct observations with 60 actors in the Kilishi value chain (producers and sellers). Interviews focused on production stages (meat selection, drying/cooking techniques, preservation, and packaging) (Figure 1). Special attention was paid to hygiene conditions and the production environment (exposure to dust, insects, and stray animals), with visual documentation produced.

Figure 1. Kilishi production diagram.

2.3. Sample Collection

Sixty (60) Kilishi samples were collected from vendors, following their standard cutting and packaging procedures. Samples were placed in sterile freezer bags, labeled, and transported promptly in a cooler with cold packs to the LaBESTA Laboratory in Ouagadougou, Burkina Faso, for microbiological analysis.

2.4. Microbiological Quality Analysis

Microorganisms were detected using the standard solid culture technique.

2.4.1. Solution and Dilution Preparation

A stock solution (pre-enrichment) was prepared by placing 25 g of Kilishi in 225 ml of Buffered Peptone Water (BPW) (Liofilchem), incubated at 37˚C for 24 h. Decimal dilutions were performed up to 103 for Salmonella and 106 for Escherichia coli (E. coli).

2.4.2. Detection and Identification of Salmonella spp.

Detection followed standard 6579-1: Selective Enrichment: 0.1 ml of pre-enriched broth was plated on Rappaport Vassiliadis (RV) broth at 42˚C, and 1 ml was added to Muller-Kauffman Tetrathionate (MKTT) broth at 37˚C, both incubated 18 to 24 h.

Isolation: Enriched broth was streaked onto selective SS and XLD agar (Liofilchem).

Identification: Suspect strains were identified using the API 20E biochemical profile (BioMérieux).

2.4.3. Serotyping of Salmonella spp.

Serotyping, following biochemical identification, was performed by direct slide agglutination with specific antisera.

2.4.4. Enumeration of Thermotolerant Coliforms and E. Coli Identification

Coliforms were enumerated by surface plating on Violet Red Bile Lactose (VRBL) medium, incubated at 44˚C for 24 h (Standard V08-060, AFNOR, 2009) [7]. Colonies between 15 and 150 were counted to calculate the bacterial load (CFU/gram) using the standard formula. E. coli suspects were confirmed using the API 20 E biochemical gallery (BioMérieux).

N = C ( n 1 +0,1 n 2  )*d*V

N = Number of colony-forming units (CFU)/gram of food;

V = Volume of solution deposited;

ΣC = Total number of colonies counted in boxes with colonies between 15 and 150;

n1 = Number of boxes counted from the first dilution;

n2 = Number of boxes counted from the second dilution;

d = Dilution factor from which the first counts were made.

2.4.5. Multiplex Polymerase Chain Reaction (16-Plex PCR)

This study employed a 16-plex PCR for the simultaneous detection of 16 virulence genes belonging to the five main E. coli pathovars (Enterohemoragic Escherichia coli (EHEC), Enteropathogenic Escherichia coli (EPEC), Enteroaggregative Escherichia coli (EAEC), Enteroinvasive Escherichia coli (EIEC), Enterotoxinogenic Escherichia coli (ETEC) [8].

DNA Extraction: Bacterial DNA was extracted from pure E. coli strains using the heating method (boiling for 10 min, followed by centrifugation at 11,337 rpm for 10 min). The supernatant was stored for PCR.

Amplification: The 20 µl reaction included a premix (Taq polymerase, dNTPs, buffers, MgCl2) and specific mixtures of 16 primers (Mix 1 and Mix 2). The thermocycler program involved 35 cycles with a hybridization step at 62.5˚C for 60 seconds.

Electrophoresis: PCR products were separated on a 2% agarose gel, stained with ethidium bromide, and visualized under a UV lamp. A 100 bp molecular weight marker was used.

Interpretation: Pathovar determination was based on the presence of specific genes (elt for ECET; stx1/stx2 for ECST; uidA as the general E. coli marker) (Table 1). Reference E. coli strains from THL (Helsinki, Finland) served as controls.

Table 1. Primer sequences for multiplex PCR.

Pathovars

Targeted Gene

Primer Sequences (5 to 3)

T in pb

[C] in µM

Ref.

eaeA

eae-F: TCAATGCAGTTCCGTTATCAGTT

2

eae-R: GTAAAGTCCGTTACCCCAACCTG

482

0.1

1

STEC-ETEC

escV

MP3-escV-F: ATTCTGGCTCTCTTCTTCTTTATGGCTG

MP3-escV-R: CGTCCCCTTTTACAAACTTCATCGC

544

0.4

1

ent

ent-F: TGGGCTAAAAGAAGACACACTG

ent-R: CAAGCATCCTGATTATCTCACC

629

0.4

1

stx1

MP4-stx1A-F: CGATGTTACGGTTTGTTACTGTGACAGC

STEC

MP4-stx1A-R: AATGCCACGCTTCCCAGAATTG

284

0.2

1

stx2

MP3-stx2A-F: GTTTTGACCATCTTCGTCTGATTATTGAG

MP3-stx2A-R: AGCGTAAGGCTTCTGCTGTGAC

324

0.4

1

ipaH

ipaH-F: GAAAACCCTCCTGGTCCATCAGG

2

ipaH-R: GCCGGTCAGCCACCCTCTGAGAGTAC

437

0.1

2

EIEC

invE

MP2-invE-F: CGATAGATGGCGAGAAATTATATCCCG

MP2-invE-R: CGATCAAGAATCCCTAACAGAAGAATCAC

766

0.2

1

aggR

MP2-aggR-F: ACGCAGAGTTGCCTGATAAAG

EAEC

MP2-aggR-R: AATACAGAATCGTCAGCATCAGC

400

0.2

1

pic

MP2-pic-F: AGCCGTTTCCGCAGAAGCC

MP2-pic-R: AAATGTCAGTGAACCGACGATTGG

1111

0.2

1

astA

MP2-astA-F: TGCCATCAACACAGTATATCCG

MP2-astA-R: ACGGCTTTGTAGTCCTTCCAT

102

0.4

1

elt

MP2-LT-F: GAACAGGAGGTTTCTGCGTTAGGTG

MP2-LT-R: CTTTCAATGGCTTTTTTTTGGGAGTC

655

0.1

1

ETEC

estIa

MP4-STIa F: CCTCTTTTAGYCAGACARCTGAATCASTTG

MP4-STIa-R: CAGGCAGGATTACAACAAAGTTCACAG

157

0.4

1

estIb

MP2-STI-F: TGTCTTTTTCACCTTTCGCTC

MP2-STI-R: CGGTACAAGCAGGATTACAACAC

171

0.2

1

E. coli

uidA

MP2-uidA-F: ATGCCAGTCCAGCGTTTTTGC

MP2-uidA-R: AAAGTGTGGGTCAATAATCAGGAAGTG

1487

0.2

1

STEC: Shigalike Toxin E. coli; ETEC: Enterotoxinogenic E. coli; EIEC: Enteroinvasive E. coli; EAEC: Enteroaggregative E. coli; Ref.: Reference; T: Expected amplicon size in base pairs (bp); [C]: Concentration; 1: [9]; 2: [8].

2.5. Data Analysis

2.5.1. Qualitative Analysis

Data from interviews and observations were transcribed and subjected to qualitative thematic analysis to identify key manufacturing stages and potential health risks.

2.5.2. Quantitative and Statistical Analysis

Quantitative microbiological data underwent descriptive statistical analysis to determine the prevalence of the different microorganisms (expressed as frequencies and percentages). Software: Excel and Epi-Info version 3.5.1 were used for prevalence calculations. Statistical Significance: Med Calc 11.0.1.0 software was used to determine p-values. Differences were considered statistically significant at a p-value less than or equal to 0.05.

3. Results

3.1. Kilishi Manufacturing Processes

Artisanal Kilishi in Niamey is the result of a traditional process, involving specific steps to guarantee its texture, taste, and preservation.

3.1.1. Meat Selection and Preparation

Kilishi is mainly prepared from beef, with the hind leg being preferred for its yield. The meat is first scraped clean of bone fragments, then meticulously flattened into thin strips to ensure optimal and uniform drying.

3.1.2. Initial Drying

Meat slices are spread out for intense sun drying, usually in the open air. Observations have shown that this phase lasts about 3 hours per side, after which the meat is turned over. The drying process lasts approximately 24 hours. During this stage, the meat is exposed to environmental elements, which is a critical point for product hygiene and safety.

3.1.3. Preparation, Seasoning, and Final Cooking

After initial drying, the meat is coated with peanut oil and seasoned. Salt and peanut oil are essential ingredients found in all varieties. Three main varieties of Kilishi exist. Red Kilishi: Distinguished by the addition of red chili pepper (Tattassé), White Kilishi: Includes classic condiments (groundnuts, garlic, ginger, chilies) but without red pepper, and Unseasoned Kilishi: Contains only peanut oil and salt.

The seasoning mixture is evenly spread. The meat is then grilled over a wood fire at a low temperature (about 15 to 20 minutes per side. This final cooking provides the Kilishi its unique flavor and appearance while potentially reducing the existing microbial load.

3.2. Marketing and Storage Practices

3.2.1. Shelf Life and Storage

Kilishi is known for its long shelf life, ranging from three months to one year at ambient temperature without refrigeration, attributed to low water activity resulting from intensive drying and cooking.

3.2.2. Packaging

The product is typically wrapped in paper (including paper from empty cement bags) or aluminum foil. Plastic bags are avoided. The use of recycled paper raises hygiene concerns.

3.2.3. Display Conditions and Sales Points

Sales occur in various locations (markets, unofficial stalls) with varied exposure. Observations highlighted: Frequent open-air display, sometimes only covered by a piece of cloth. Critical Factors: Direct exposure to dust, high ambient temperatures, constant presence of insects (flies), and, in some cases, proximity to stray animals. Handling: Frequent direct hand handling by vendors without gloves poses a potential source of cross-contamination post-cooking.

3.3. Microbiological quality of Kilishi

The collected Kilishi samples showed contamination primarily with Salmonella and E. coli, with frequencies of 4 (6.7%) and 25 (41.7%), respectively (Figure 2). The microbial loads of these strains were quantified and are presented in Table 2. Regarding faecal coliform counts, the bacterial load ranged from 2 × 102 CFU/g to 1.20 × 106 CFU/g, with an average of 3.40 × 104 CFU/g.

Figure 2. Prevalence of bacteria in kilishi samples

Table 2. Microbial load of thermotolerant coliforms and Salmonella in samples.

Study Sites

Code

Thermotolerant Coliforms (UFC/g)

Absence or Presence of Salmonella spp. in 25 g

Study 1 (N = 10)

ES1

2.06 × 104 ± 2.91 × 104a

Presence

Study 2 (N = 10)

ES2

3.39 × 104 ± 3.72 × 104a

Presence

Study 3 (N = 10)

ES3

2.77 × 104 ± 4.44 × 104a

Absence

Study 4 (N = 10)

ES4

9.88 × 104 ± 3.06 × 105a

Presence

Study 5 (N = 10)

ES5

1.85 × 104 ± 3.34 × 104a

Absence

Study 6 (N = 10)

ES6

2.64 × 104 ± 4.26 × 104a

Presence

Moyenne ± SD

3.40 × 104 ± 1.29 × 105

4/60

N = Number of sample, p = 0.40 > 0.05. The ‘a’ in bold indicates that there is no significant difference between the results for the different sectors.

3.3.1. Prevalence of Salmonella Serovars

The results show a variable prevalence of Salmonella in the different kilishi meats collected from the sales sites in the city of Niamey. It appears that 6.7% (4/60) of the samples are contaminated with Salmonella spp. The study also shows that 1.67% are infected with Salmonella typhi (Table 3).

Table 3. Prevalence of Salmonella serovars.

Salmonella Serotypes

Numbers of Salmonella (N = 4)

Percentage (%)

S. enteritidis

0

0

S. paratyphi A, B, C

0

0

S. typhi

1

1.67

S. spp.

3

5.03

Total

4

6.7

N = Total number of Salmonella isolated; % = Percentage.

3.3.2. Prevalence of E. coli Pathovars

Table 4. Prevalence of E. coli pathovars.

Pathotypes of E. coli

Number of Pathotypes (N = 25)

Percentages (%)

ECST

4

6.67

ECST-ECET

3

5.03

ECEA

0

0

ECEI

0

0

ECET

Traces

1

N = Total number of Salmonella isolated; ECST = Shiga-like toxine Escherichia coli; ECEA = Enteroaggregative Escherichia coli; ECEI = Enteroinvasive Escherichia coli; ECET = Enterotoxinogenic Escherichia coli.

Figure 3. Agarose gel image showing multiplex PCR amplicons.

Molecular analyses showed that 41.7% of Kilishi intended for human consumption contained E. coli strains associated with diarrhoea. Five E. coli pathovars were identified. The study showed a prevalence of 6.67% ECST, 5% ECST-ECET, 0% ECEA, 0% ECEI, and 1% ECET. The highest prevalence rates were observed for ECST and ECST-ECET (Table 4). The uidA gene confirms that the E. coli strain was identified in all strains tested. These strains, which only carry the uidA gene, are classified as non-diarrhoeic E. coli (Figure 3).

4. Discussion

According to the results of surveys, microbiological analyses, and field observations, this research shows that contamination of Kilishi is closely linked to traditional production processes, creating pathovars that allow pathogens to enter the human population, with few preventive measures in place, representing a critical public health problem. Although the production process relies on complex and well-known traditional artisanal expertise, it exposes the product to various sources of contamination. Prolonged exposure to open air, the continuous presence of insects, direct contact with the meat, and the use of inappropriate containers, such as recycled cement bags, are common practices that facilitate the entry of harmful microorganisms. The fecal coliform count ranged from 2 × 102 to 1.20 × 106 CFU/g, with an estimated mean of 3.40 × 104 CFU/g, well above the threshold of 103 CFU/g prescribed by Decree No. 624-04 [10]. This high load indicates poor hygiene during preparation and suggests recent fecal contamination [11], primarily due to poor hand hygiene, handling both money and food, and the use of ingredients grown with potentially contaminated manure [12]. The high incidence of fecal contamination and opportunistic pathogens in Kilishi is not accidental but a direct consequence of critical stages in the artisanal process, notably prolonged environmental exposure and post-cooking recontamination, which erode the sanitary barrier and render a nutritious food a potential vector for foodborne illness. The detection of thermotolerant coliforms served as an indirect indicator of enteropathogenic microorganisms [13]. PCR analysis confirmed the presence of several diarrheagenic E. coli variants, including ETEC (6.7%) and ETEC-EPEC (5.03%). Although these prevalences are lower than those reported in some regional studies [14], they confirm a significant health threat and the spread of these pathogens.

Contamination by Salmonella typhi was confirmed at 6.7%, with one serotype identified at 1.67%. While lower than rates reported in neighboring countries [14], these figures still indicate a considerable risk. Salmonella presence is attributed to inadequate formal sanitary controls on meat during slaughter and transport, as well as to cross-contamination during handling and preparation [15]. Regional studies suggest non-typhoidal serotypes linked to animal/environmental reservoirs are common in the area [16].

The final grilling stage (15 - 20 minutes per side) helps reduce the microbial load. However, efficacy relies on sustained temperature and adequate time. The risk of post-cooking recontamination is significant due to: Handling the product without gloves. Exposure to dust, flies, and dirty surfaces; ambient-temperature storage; unsuitable packaging [17].

Analysis of the production and marketing steps revealed several critical issues: the absence of an initial meat health inspection, open-air sun drying, and exposure to insects and stray animals [18]. Insanitary storage of ingredients (peanut oilcake and oil) promotes the growth of mycotoxin-producing molds [19]. Use of empty cement bags for packaging, which may introduce microbiological and chemical contaminants [20].

Kilishi has an inherently high nutritional value (proteins, heme iron, B vitamins, zinc, selenium) enhanced by the addition of peanut meal and spices (unsaturated fatty acids, antioxidants). However, Prolonged exposure to sunlight and air can cause lipid oxidation and a decrease in heat-sensitive vitamins (B and E) [21]. Microbial or chemical contamination (particularly by mycotoxins from mold on peanuts or poorly preserved meat) compromises the product’s value, potentially rendering it unfit for consumption and reducing nutrient absorption [22].

The safety of Kilishi is compromised by artisanal practices that facilitate micro- biological and chemical contamination, notwithstanding its inherent high nutritional value. Although this study provides crucial data on the health safety of Kilishi, certain limitations must be highlighted. First, the study focused specifically on the city of Niamey. While representative of urban practices in Niger, the results could vary in other regions or neighboring countries depending on microclimates and local variations in artisanal processes. Second, the sample size, although statistically significant for a preliminary assessment, would benefit from being expanded in future studies to capture a greater diversity of producers and points of sale. Cross-sectional nature: Finally, the cross-sectional nature of the sampling provides a snapshot of the situation at a given moment. A longitudinal study incorporating seasonal variations (temperature and humidity) would allow a better understanding of the dynamics of microbiological and chemical contamination over the course of the year. These considerations do not call into question the validity of our results, but pave the way for broader future research for a comprehensive mapping of health risks related to Kilishi in West Africa.

5. Conclusions

This study provided an in-depth assessment of the artisanal value chain of Kilishi in Niamey, combining an analysis of production and marketing practices with an evaluation of the microbiological quality of the finished product. The results highlighted the richness of traditional know-how while revealing critical points of contamination that severely compromise consumer health and safety. The high prevalence of hygiene-indicator microorganisms, such as various pathotypes of E. coli, alongside the presence of more severe pathogens, including Salmonella serovars, clearly demonstrates a link between field manufacturing/marketing conditions and product contamination. Open-air drying, frequent manual handling, the use of recycled packaging, and exposure to environmental contaminants are identified as the primary sources of these risks. Beyond microbiological hazards, these practices also affect the product’s physicochemical quality, notably degrading its nutritional value.

The artisanal practices and the lack of hygiene observed in Kilishi production directly compromise consumer food safety in Niamey by favoring contamination with major pathogens such as Salmonella and E. coli.

In conclusion, the safety of Kilishi can only be ensured through targeted inter- ventions. The identified challenges require integrating Good Manufacturing and Hygiene Practices (GMP) adapted to the local context while preserving the product’s artisanal character and cultural significance. In order to translate these principles into concrete actions for artisans, we primarily recommend:

Modernization of drying infrastructures: Moving away from drying directly on the ground or on precarious supports in favor of elevated and covered dryers. This setup not only helps reduce cross-contamination from dust and animals but also protects the product from chemical atmospheric pollutants.

Improvement of final packaging: Promoting and generalizing the use of single-use food packaging (plastic wrap or sealed bags) instead of recycled paper or non-sterile containers. This measure is crucial for maintaining the microbiological integrity of the product until consumption.

Training on chemical risks: Raising producers’ awareness about managing smoking times and the quality of the wood used to reduce the formation of toxic compounds.

By adopting these simple and inexpensive measures, the Kilishi industry can guarantee a product that combines tradition, high nutritional value, and food safety, thus meeting modern consumption standards.

Ethical Approval

Vendor-informed consent is required in accordance with local regulations, and all participants provided verbal consent.

Acknowledgements

We express our deep gratitude to all the individuals and institutions that made this work possible. We also thank all the butchers who contributed to this field study for providing the information necessary to make this study helpful.

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

References

[1] Tiendrebeogo, S.C.W., Sawadogo/Lingani, H., Kabore, D., Zida/Ouedraogo, K., Pare, A., Samandoulougou, S. and Dicko, M.H. (2016) Evaluation de l’impact du séchoir à gaz BB équipement sur la qualité du kilichi (viande de boeuf séchée): Assessment of the Impact of Gas Dryer BB Equipment on the Quality of Kilichi a Traditional Dried Beef. Sciences Naturelles Et Appliquées, 2, 191-203.
https://revuesciences-techniquesburkina.org/index.php/sciences_naturelles_et_appliquee/article/view/886
[2] Seini, S.H., Nafiou, A.I.M., Aminatou Maazou, B., Sadou, H., Ibrahim, A., Alma, M.M., et al. (2018) Influence of Manufacturing Methods on the Microbiological and Nutritional Characteristics of Kilichi, Dry Meat of Niger. International Journal of Current Microbiology and Applied Sciences, 7, 231-241.[CrossRef]
[3] Adeboye, A., Akanbi, C. and Igene, J. (2018) Drying Kinetics of Beef during the First Stage Drying of Kilishi. Nigerian Food Journal, 36, 67-73.
https://www.nifst.org
[4] Iheagwara, M. and Okonkwo, T. (2019) Effect of Processing Techniques on the Microbiological Quality of Kilishi—A Traditional Nigerian Dried Beef Product. Journal of Meat Science and Technology, 4, 11-17.
https://www.jakraya.com/journal/jmst
[5] Mbawala, A., Daoudou, B. ad Martin, N. (2010) Microbiological Quality of Kilishi (Dried Meat Product) Produced in the City of Ngaoundéré (Cameroon). Tropicultura, 28, 153-160.
[6] Hamidi, E.N., Hajeb, P., Selamat, J., Lee, S.Y. and Abdull Razis, A.F. (2022) Bioaccessibility of Polycyclic Aromatic Hydrocarbons (PAHs) in Grilled Meat: The Effects of Meat Doneness and Fat Content. International Journal of Environmental Research and Public Health, 19, Article 736.[CrossRef] [PubMed]
[7] AFNOR (2009) Food Microbiology-Enumeration of Thermotolerant Coliforms Using the Filter Membrane Method (NF V08-060).
https://www.boutique.afnor.org/fr-fr/norme/nf-v08060/microbiologie-des-aliments-denombrement-des-coliformes-thermotolerants-par-/fa160465/33001
[8] Antikainen, J., Tarkka, E., Haukka, K., Siitonen, A., Vaara, M. and Kirveskari, J. (2009) New 16-Plex PCR Method for Rapid Detection of Diarrheagenic Escherichia coli Directly from Stool Samples. European Journal of Clinical Microbiology & Infectious Diseases, 28, 899-908.[CrossRef] [PubMed]
[9] Müller, D., Greune, L., Heusipp, G., Karch, H., Fruth, A., Tschäpe, H., et al. (2007) Identification of Unconventional Intestinal Pathogenic Escherichia coli Isolates Expressing Intermediate Virulence Factor Profiles by Using a Novel Single-Step Multiplex PCR. Applied and Environmental Microbiology, 73, 3380-3390.[CrossRef] [PubMed]
[10] Ministère de l’Agriculture et du Développement Rural de la République Slovaque—Présidence Slovaque du Conseil de l’UE (2004) Decree of the Minister of Agriculture and Rural Development, the Minister of Health and the Minister of Industry, Trade and Telecommunications No. 624-04 of 17 Safar 1425 (08 April 2004) on Microbiological Standards to be Met by Animal Foodstuffs or Foodstuffs of Animal Origin.
[11] Bodering, A., Ndoutamia, G., Ngandolo, B.N. and Ngakou, A. (2017) Utilisation des antibiotiques et profil de résistance des souches de Salmonella spp. et Escherichia coli isolées des exploitations avicoles des villes de N’Djaména et Doba au Tchad. International Journal of Biological and Chemical Sciences, 11, 1669-1684.[CrossRef]
[12] Bako, E., Kagambèga, A., Traore, K., Bagre, T., Ibrahim, H., Bouda, S., et al. (2017) Characterization of Diarrheagenic Escherichia coli Isolated in Organic Waste Products (Cattle Fecal Matter, Manure And, Slurry) from Cattle’s Markets in Ouagadougou, Burkina Faso. International Journal of Environmental Research and Public Health, 14, Article 1100.[CrossRef] [PubMed]
[13] Abeid, A.O., Mennane, Z., Hassan, O. and Ouhssine, M. (2015) Microbiological Study and Identification of Strains Isolated from Fish (Mugil cephalus) Dried-Pounded “Lekhlia”. Journal of Materials and Environmental Science, 6, 1142-1146.
[14] Sambe-Ba, B., Espié, E., Faye, M.E., Timbiné, L.G., Sembene, M. and Gassama-Sow, A. (2013) Community-Acquired Diarrhea among Children and Adults in Urban Settings in Senegal: Clinical, Epidemiological and Microbiological Aspects. BMC Infectious Diseases, 13, Article No. 580.[CrossRef] [PubMed]
[15] Nikiema, M.E.M., Kakou-ngazoa, S., Ky/Ba, A., Sylla, A., Bako, E., Addablah, A.Y.A., et al. (2021) Characterization of Virulence Factors of Salmonella Isolated from Human Stools and Street Food in Urban Areas of Burkina Faso. BMC Microbiology, 21, Article No. 338.[CrossRef] [PubMed]
[16] Kagambèga, A., Martikainen, O., Lienemann, T., Siitonen, A., Traoré, A.S., Barro, N., et al. (2012) Diarrheagenic Escherichia coli Detected by 16-Plex PCR in Raw Meat and Beef Intestines Sold at Local Markets in Ouagadougou, Burkina Faso. International Journal of Food Microbiology, 153, 154-158.[CrossRef] [PubMed]
[17] Ai, A., Saadatu, I. and Ao, A. (2022) Microbiological Quality of Kilishi Sold in Nasarawa, Nasarawa State. Journal of Food: Microbiology, Safety & Hygiene, 7, 1-5.
[18] Abdel-Kader, A.S., Alio, A.A., Chaibou, Y., Abdoulahi, M.I.I., Seini, S.H. and Hassimi, S. (2024) Evaluation of the Microbiological Quality of Three Varieties of Kilichi Produced in Niger. Asian Food Science Journal, 23, 24-30.[CrossRef]
[19] Boubacar Seydou, R., Harouna, A., Kpoclou, Y.E., Douny, C., Brose, F., Hamani, M., et al. (2019) Assessment of the Physicochemical Characteristics, Chemical and Microbiological Safety of Two Types of Kilichi, a Grilled Meat Produced in Niger. Food Science & Nutrition, 7, 3293-3301.[CrossRef] [PubMed]
[20] Iko Afé, O.H., Saegerman, C., Kpoclou, Y.E., Anihouvi, V.B., Douny, C., Igout, A., et al. (2020) Polycyclic Aromatic Hydrocarbons Contamination of Traditionally Grilled Pork Marketed in South Benin and Health Risk Assessment for the Beninese Consumer. Food Additives & Contaminants: Part A, 37, 742-752.[CrossRef] [PubMed]
[21] Alamuoye, N.O., Alamuoye, O.F. and Adebayo, F.B. (2024) Moisture Sorption Isotherm, Proximate Composition, Lipid Oxidative Stability, and Sensory Characteristics of Sun-Dried Kilishi in Storage. Asian Journal of Food Research and Nutrition, 3, 320-328.[CrossRef]
[22] Pandey, A.K., Samota, M.K., Kumar, A., Silva, A.S. and Dubey, N.K. (2023) Fungal Mycotoxins in Food Commodities: Present Status and Future Concerns. Frontiers in Sustainable Food Systems, 7, Article 1162595.[CrossRef]

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.