Characterization of Antibiotic Resistance and Prevalence of Diarrheagenic E. coli Strains Isolated from Stool Samples in a Hospital Setting in Mali
Aminata Maiga1*, Lassina Doumbia2*#, NFaly Tounkara3, Tidiani Sinayoko2, Rabiatou Sanogo4, Ibrahim Keita5, Ami Diakite2, Moussa Diawara3, Oumar Agaly Dicko3, Famakan Dembele3, Mohamed Ag Baraika4, Yacouba Cissoko6, Drissa Kone3, Aldiouma Guindo7, Ibrahim Izetiegouma Maiga1, Ousmane Koita8
1Laboratoire de Biologie Médicale et Hygiène Hospitalière, CHU du Point G, Faculté de Médecine et Odontostomatologie, Université des Sciences, des Techniques et des Technologies de Bamako (USTTB), Bamako, Mali.
2Laboratoire de Biologie Moléculaire Appliquée, USTTB, Bamako, Mali.
3Laboratoire de Biologie Médicale et Hygiène Hospitalière, CHU du Point G, Bamako, Mali.
4Institut National de Santé Publique (INSP), USTTB, Bamako, Mali.
5Laboratoire de Biologie Moléculaire Appliquée, Faculté de Médecine et Odontostomatologie, USTTB, Bamako, Mali.
6Unité de Réanimation, CHU du Point G, Faculté de Médecine et Odontostomatologie, USTTB, Bamako, Mali.
7Centre de Recherche et de Lutte Contre la Drépanocytose, Faculté de Pharmacie, USTTB, Bamako, Mali.
8Laboratoire de Biologie Moléculaire Appliquée, Faculté de Pharmacie, USTTB, Bamako, Mali.
DOI: 10.4236/abb.2025.1612034   PDF    HTML   XML   96 Downloads   582 Views  

Abstract

Introduction: Antibiotic resistance is a major global health challenge that disproportionately affects low-resource countries, particularly those in West Africa. E. coli, a major pathogen in childhood diarrhea, is both a prominent infectious agent and a reservoir of resistance genes, including resistance to last-resort antibiotics, such as carbapenems. Methodology: The study focused on 98 clinical E. coli isolates collected from stool samples of patients in a hospital setting in Bamako. The analyses included screening for DEC-specific virulence genes, detection of resistance genes across various classes of antibiotics (e.g., beta-lactams, carbapenems, fluoroquinolones), and identification of class 1, 2, and 3 integrons. The blaNDM gene was sequenced to identify mutations associated with carbapenem resistance. Results: Among the isolates, 85.7% carried at least one virulence gene. Of these, half involved co-infections, commonly combining EPEC, EAEC, and ETEC strains. Regarding antibiotic resistance, 94.9% of isolates harbored at least one resistance gene, and 50% were multidrug-resistant. The most frequently detected genes were blaTEM, qnrS1, and aphA3. Class 2 integrons were significantly associated with multidrug resistance (p = 0.01). Sequencing of the blaNDM gene revealed point mutations likely to affect protein function, suggesting an evolution toward increased resistance to carbapenems. Conclusion: The high prevalence of multidrug-resistant diarrheagenic E. coli strains in this study highlights the local antibiotic pressure and the serious health threat it represents. This study shows that the new β-lactamase blaNDM gene has disseminated in the hospital environment of Bamako. It should be noted that this will become a major challenge for clinicians.

Share and Cite:

Maiga, A. , Doumbia, L. , Tounkara, N. , Sinayoko, T. , Sanogo, R. , Keita, I. , Diakite, A. , Diawara, M. , Dicko, O. , Dembele, F. , Baraika, M. , Cissoko, Y. , Kone, D. , Guindo, A. , Maiga, I. and Koita, O. (2025) Characterization of Antibiotic Resistance and Prevalence of Diarrheagenic E. coli Strains Isolated from Stool Samples in a Hospital Setting in Mali. Advances in Bioscience and Biotechnology, 16, 517-532. doi: 10.4236/abb.2025.1612034.

1. Introduction

Bacterial resistance to antibiotics is one of the major threats to global public health, with several million deaths estimated each year. Sub-Saharan Africa, particularly its western region, appears to be especially affected by this phenomenon [1]. However, even industrialized countries experience significant health and economic consequences [2] [3].

Among the primary causes of this resistance are the excessive and inappropriate use of antibiotics in both human and animal health, poor management and stewardship, and the intrinsic resistance specific to certain bacterial species [4].

In 2019, Escherichia coli (E. coli) was one of the six pathogens responsible for the highest number of deaths related to antibiotic resistance, ranking first [1]. As a member of the Enterobacteriaceae family, E. coli is a commensal bacterium in the mammalian digestive tract. While most strains are harmless, some are pathogenic and can cause severe intestinal or extra-intestinal infections [5]. The World Health Organization (WHO) ranks E. coli, alongside other Enterobacteriaceae, among the priority pathogens due to the growing threat they pose to human health [6].

E. coli is a common cause of diarrhea in children worldwide. In Mali, this bacterium is implicated in more than 30% of diarrhea cases in children under five years of age. These strains show increased resistance to several classes of antibiotics, notably beta-lactams and quinolones, although they remain relatively sensitive to imipenem, a carbapenem [7]. Moreover, multiple multidrug-resistant strains have been isolated from children suffering from acute diarrhea [8].

Beyond its multidrug-resistant profile, E. coli also plays a key role as a reservoir of resistance genes, due to its ability to acquire such genes from other bacteria and transmit them through horizontal gene transfer mechanisms [9] [10]. This resistance is more pronounced in clinical strains compared to environmental strains [11].

In this context, this study aims to characterize the molecular profile of virulence and antibiotic resistance genes in clinical E. coli strains, with a particular focus on carbapenems, a class that remains understudied in Mali.

2. Materials and Methods

The study focused on 98 clinical E. coli isolates collected from stool samples of patients between 2020 and 2021 at the laboratory of the CHU of Point G, Bamako, Mali, and stored at −80˚C. The isolates were subsequently analyzed at the Laboratory of Applied Molecular Biology (LBMA) using standard PCR.

Molecular analyses included screening for DEC-specific virulence genes, detection of resistance genes across various antibiotic classes, and identification of class 1, 2, and 3 integrons (Table 1).

Table 1. List of primers used.

DEC type

Target gene

Primer

Primer sequence 5’ - 3’

PCR product Size bp

Reference

ETEC

eltB

LT-F

TCTCTATGTGCATACGGAGC

322

[12]

LT-R

CCATACTGATTGCCGCAAT

estA

ST-F

GTCAAACCAGTA(G/A)GGTCTTCAAAA

147

[12]

ST-R

CCCGGTACA(G/A)GGAGGATTACAACA

EHEC

vt1

VT1-F

GAAGAGTCCGTGGGATTAC

130

[12]

VT1-R

AGCGATGCAGCTATTAATAA

vt2

VT2-F

ACCGTTTTTCAGATTTT(G/A)CACATA

298

[12]

VT2-R

TACACAGGAGCAGTTTCAGACAGT

EPEC

EaeA

Eae-F

CACACGAATAAACTGACTAAAATG

376

[12]

Eae-R

AAAAACGCTGACCCGCACCTAAAT

bfpA

bfpA-F

TTCTTGGTGCTTGCGTGTCTTTT

367

[12]

bfpA-R

TTTTGTTTGTTGTATCTTTGTAA

EIEC

Ial

SHIG-F

CTGGTAGGTATGGTGAGG

320

[12]

SHIG-R

CCAGGCCAACAATTATTTCC

EAEC

pCVD432

EA-F

CTGGCGAAAGACTGTATCAT

630

[12]

EA-R

AAATGTATAGAAATCCGCTGTT

Resistance genes

blaOXA

OXA 1-F

ATGAAAAACACAATACATATC

890

[13]

OXA 1-R

AATTTAGTGTGTTTAGAATGG

blaSHV

SHV-F

TTATCTCCCTGTTAGCCACC

800

[13] [14]

SHV-R

GATTTGCTGATTTCGCTCGG

blaTEM

TEM-F

ATAAAATTCTTGAAGACGAAA

850

[13]

TEM-R

GACAGTTACCAATGCTTAATC

blaCTX-M-3/15/22

CTX-M-F

GTTACAATGTGTGAGAAGCAG

593

[15]

CTX-M-R

CCGTTTCCGCTATTACAAAC

catA1

catA 1-F

CGCCTGATGAATGCTCATCCG

450

[14]

catA 1-R

CCTGCCACTCATCGCAGTAC

tetA

tetA-F

GTAATTCTGAGCACTGTCGC

956

[14]

tetA-R

CTGCCTGGACAACATTGCTT

aphA-3

aphA-3-F

GGGACCACCTATGATGTGGAACG

600

[14]

aphA-3-R

CAGGCTTGATCCCCAGTAAGTC

[16]

blaNDM

NDM-1_F

GGTTTGGCGATCTGGTTTTC

621

NDM-1_R

CGGAATGGCTCATCACGATC

blaIMP

IMP_F

CACTTGGTTTGTGGAACGTG

192

This study

GenBank: CP090265.1

IMP_R

CAATAGTTAACCCCGCCAAA

QnrS1

QnrS1_F

ACGCACGGAACTCTATACCG

154

This study

GenBank: CP090265.1

QnrS1_R

ACGACATTCGTCAACTGCAA

Integron

intI1

Int1_F

ACATGTGATGGCGACGCACGA

580

[17]

Int1_R

ATTTCTGTCCTGGCTGGCGA

intI2

Int2_F

CACGGATATGCGACAAAAAGGT

806

[17]

Int2_R

GTAGCAAACGACTGACGAAATG

intI3

Int3_F

AACTCTTGCACCGTTCGGAT

542

This study

GenBank: CP047278.1

Int3_R

CAGGAGGTTCAGACGTTGCT

Frozen isolates were thawed and cultured on Mueller-Hinton (MH) agar for DNA extraction. Then, a full loop of fresh pure E. coli culture was stored at −80˚C in 1.5% (v/v) glycerol in enumeration broth for further analysis.

DNA Extraction

Reference strains were provided by the National Institute of Public Health (NIPH) of Mali. DNA was extracted from E. coli isolates and the reference strain using a full loop of colonies in 100 µL of ultrapure water following the Salting-out method. The purified DNA was eluted in 70 µL of TE buffer and stored at −20˚C for further amplification.

Identification of Virulence Genes

Strains harboring at least one DEC-associated virulence gene were classified as Diarrheagenic E. coli (DEC). Several genes characteristic of Diarrheagenic E. coli (DEC) were targeted (see Table 1):

  • bfpA and eae for typical enteropathogenic E. coli (EPEC),

  • agg and aaic for enteroaggregative E. coli (EAEC),

  • lt and st for enterotoxigenic E. coli (ETEC).

Three microliters of DNA from the reference strains provided by the NIPH, the negative control (sterile ultrapure water), and the E. coli isolates were used for multiplex PCR with specific primers (Table 1), as described by Vilchez et al. (2009) [12].

Additionally, to confirm the multiplex PCR results, DNA extracted from freshly cultured colonies on MH agar was subjected to single PCR. Each specific primer was tested independently in a single PCR to confirm suspected DEC isolates identified by multiplex PCR.

Identification of Resistance and Integron Genes

Specific resistance genes to different antibiotic families were evaluated: ESBL genes (Extended-Spectrum Beta-Lactamases) for beta-lactams; blaNDM and blaIMP for carbapenems; tetA for tetracyclines; qnrS1 for quinolones; catA1 for chloramphenicols, and aphA3 for aminoglycosides.

PCR was used to detect the presence of antibiotic resistance genes, as well as class 1, 2, and 3 integron genes, and to assess their distribution among the isolates. Integrons play a major role in the acquisition, expression, and dissemination of antibiotic resistance, particularly resistance integrons.

All amplification was carried out using the PTC 200 thermocycler (MJ Research, USA) with specific primer sequences [13]-[17], as listed in Table 1. The reaction total volume was 25 µL containing 3 µL of DNA, 1× Buffer (Mg2+ free), 3 mM MgCl2, 0.4 mM deoxynucleotide triphosphates (dNTPs) (Invitrogen, USA), 0.4 μM of each primer, and 0.025 U of Taq polymerase (Invitrogen, USA).

The PCR program for all reactions was as follows: initial denaturation at 94˚C for 5 minutes, followed by 35 cycles of 94˚C for 30 seconds (denaturation), annealing at 44 to 60˚C for 45 seconds (variable according to the specific primers), and 72˚C for 1 minute (extension). The annealing temperatures were: OXA (44˚C), QnrS1 and IMP (50˚C), NDM (52˚C), SHV (60˚C), TEM (55˚C), catA (59˚C), tetA (55˚C), CTX-M (57.2˚C), aphA-3 (51.9˚C), Int1 (59˚C), Int2 (55˚C), and Int3 (57˚C), respectively. A final elongation step was performed at 72˚C for 10 minutes. All PCR products were visualized on a 1.5% agarose gel stained with ethidium bromide.

Sequencing

Among isolates carrying the blaNDM gene, two with strong PCR amplification signals were considered for Sanger sequencing to confirm the sequence and identify mutations associated with carbapenem resistance, given the first-time detection of this gene and the limited resources.

The amplified product was purified using Exonuclease I and Alkaline Phosphatase enzymes, followed by thermal cycling and ethanol precipitation. Sequencing was performed on the CEQTM 8000 DNA Analyzer (Beckman Coulter). The resulting sequence was compared to database entries using the NCBI BLAST search tool. Mutations were analyzed using Geneious Prime 2023.0 software.

Phylogenetic Analysis

We retrieved the most closely related sequences from GenBank as of June 3rd, 2024. The sequence dataset was aligned using BioEdit, version 7.7.1 (5/10/2021). Based on the resulting alignments, we performed a maximum likelihood (ML) phylogenetic reconstruction using MEGA version 7.0.26, applying the Tamura-Nei model and assessing branch support with 1,000 bootstrap replicates.

Data Analysis

Beta-lactam resistance was defined as the presence of at least one beta-lactam resistance gene. Multidrug resistance (MDR) was defined genotypically as the detection of resistance genes belonging to at least three different classes of antibiotics. A genotypic definition was selected because the focus of this study was to characterize the genetic determinants of antimicrobial resistance. Genomic screening provides a sensitive and reproducible means of identifying resistance mechanisms, including those that may not be consistently detectable through phenotypic susceptibility testing, and allows standardized comparison across isolates. Although this definition differs from conventional phenotypic surveillance criteria, it offers a robust framework for assessing MDR potential in the context of genomic analysis.

Data were analyzed using STATA software version 14.0. The chi-square test or Fisher’s exact test was used, as appropriate, to determine the statistical significance of the data. A p-value less than 0.05 was considered statistically significant.

Figures were generated using Excel and the online platform Flourish (https://flourish.studio/), employing chord diagrams to illustrate associations between variables in cases of co-infections, multi-resistance, and the presence of different integrons.

3. Results

This study focused on the molecular characterization of virulence and antibiotic resistance gene profiles of E. coli strains isolated in a clinical setting. Of the 98 isolates, 84 (approximately 86%) were identified as DEC, based on the detection of at least one specific virulence gene (Figure 1).

Among the 84 DEC strains identified, 50% were mono-infections, predominantly EPEC (21.4%), followed by EAEC (20.2%) and ETEC (8.3%). The remaining 50% involved mixed infections, with the EAEC-EPEC combination being the most common (27.4%), followed by EPEC-ETEC (9.5%), EAEC-ETEC (3.6%), and the triple combination EAEC-EPEC-ETEC (9.5%) (Figure 2).

Detection of Resistance Genes

A total of 93 out of 98 E. coli isolates (94.9%) carried at least one antibiotic resistance gene, and 50% (49/98) were identified as multidrug-resistant (MDR).

Figure 1. Prevalence of E. coli strains based on the presence of virulence genes.

Figure 2. Distribution of mixed infections among DEC pathotypes based on detected virulence genes.

Beta-lactam resistance genes were detected in 77.6% (76/98) of isolates, with blaTEM being the most frequently identified gene. Regarding the overall prevalence of resistance genes, qnrS1 was the most common (66.3%), followed by blaTEM (49%), aphA3 (45.9%), blaCTX-M (35.7%), blaIMP (23.5%), tetA (22.5%), blaNDM (16.3%), and catA1 (10.2%). Carbapenem resistance genes were detected in 38.8% of isolates (Table 2).

Table 2. Distribution of resistance genes according to antibiotic families among E. coli isolates.

Antibiotic families

Gene

Present, n (%)

Absent, n (%)

Overall, N = 98

93 (94.9)

5 (5.1)

Beta-lactams

Overall

76 (77.6)

22 (22.4)

blaTEM

48 (49.0)

50 (51.0)

blaCTX-M

35 (35.7)

63 (64.3)

blaSHV

25 (25.5)

73 (74.5)

blaOXA

16 (16.3)

82 (83.7)

Carbapenems

Overall

38 (38.8)

60 (61.2)

blaIMP

23 (23.5)

75 (76.5)

blaNDM

16 (16.3)

82 (83.7)

Quinolone

qnrS1

65 (66.3)

33 (33.7)

Chloramphenicol

catA1

10 (10.2)

88 (89.8)

Tetracycline

tetA

22 (22.5)

76 (77.5)

Aminoglycoside

aphA3

45 (45.9)

53 (54.1)

Integron

Overall

37 (37.8)

61 (62.2)

Int 1

35 (35.7)

63 (64.3)

Int 2

25 (25.5)

73 (74.5)

Int 3

31 (31.6)

67 (68.4)

Multidrug resistance associated with the blaNDM resistance gene was observed in 4 isolates, of which 3 also carried an integron gene. Additionally, 11 isolates harbored the blaTEM-blaCTX-M-qnrS1 gene combination, and 8 of them also carried an integron gene. Finally, 7 isolates carried the blaOxa-blaCTX-M-qnrS1 gene combination, all of which were positive for the integron gene.

Co-detection of resistance genes was observed between resistance genes across most classes of antibiotics investigated. However, the most frequent co-detections were observed between beta-lactams and quinolones (53 isolates), followed by beta-lactams and aminoglycosides (37 isolates), beta-lactams and carbapenems (33 isolates), aminoglycosides and quinolones (31 isolates), quinolones and carbapenems (26 isolates), and beta-lactams and tetracyclines (21 isolates) (Figure 3). These co-detections contribute to the high risk of multidrug resistance, significantly reducing therapeutic options.

Integron Distribution and Resistance Genes

Integron genes were detected among the E. coli isolates as follows: Int1 (35.7%, 35/98), Int3 (31.6%, 31/98), and Int2 (25.5%, 25/98) (Table 3). A statistically significant association was observed between class 2 integrons and isolates harboring more than three resistance genes (p = 0.01), suggesting a strong link between class 2 integrons and multidrug resistance. Although class 1 and class 3 integrons were also found among isolates with more than three resistance genes (60% and 61.3%, respectively), their associations were not statistically significant (p > 0.05) (Table 3).

Figure 3. Distribution of resistance genes across different classes of antibiotics in E. coli strains.

Table 3. Distribution of integron genes based on the number of co-detection resistance genes.

Number of resistance genes

Integron 1 (n = 34)

Integron 2 (n = 25)

Integron 3 (n = 30)

n (%)

p-value

n (%)

p-value

n (%)

p-value

1

4 (11.4)

0.962

1 (4)

0.185

3 (9.7)

0.791

2

9 (25.7)

0.214

6 (24)

0.236

8 (25.8)

0.262

3 or more

21 (60)

0.14

18 (72)

0.011

19 (61.39)

0.128

Analysis of blaNDM Sequencing Results

Sequencing of the PCR-amplified blaNDM product was successful for one sample and showed high similarity to blaNDM-5. The encoded protein was characterized by several amino acid substitutions, including Val → Leu at position 88 and Met → Leu at position 154. It differed from previously described enzymes by additional substitutions at positions 132 (Leu → Met) and 166 (Asp → Hist), which may alter the structure or function of the protein (Table 4). These novel mutations could contribute to reduced susceptibility of E. coli strains to expanded-spectrum cephalosporins and carbapenems. However, functional validation studies, such as site-directed mutagenesis and phenotypic susceptibility testing, are required to confirm the impact of these specific amino acid substitutions on enzyme activity and antibiotic resistance.

Table 4. Analysis of mutations in blaNDM sequencing results.

Position

Mutation type

Mutation consequence

88

G → T substitution

Valine-Leucine change

98

C → A substitution

Silent mutation

132

C → A substitution

Leucine-Methionine change

154

A → C substitution

Methionine-Leucine change

166

A → C substitution

Asparagine-Histidine change

Phylogenetic Diversity of NDM-Producing Escherichia coli Strains Including a Malian Isolate

The single sequence from this study is closely related to the sequence from China (Figure 4).

Maximum-likelihood phylogeny of blaNDM sequence from this study was reconstructed with MEGA version 7.0.26. Phylogeny was inferred by using the Maximum Likelihood method based on the Tamura-Nei model, and branch support was evaluated with bootstrap approximation using 1000 replicates. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. We used six sequences from BLAST in GenBank, along with the single sequence from this study. The sequences from this study is shown in red.

Figure 4. Phylogeny of blaNDM sequence from this study.

4. Discussion

Enteropathogenic E. coli (EPEC) strains play a central role in the occurrence of diarrhea, especially in children [18] [19]. In this study, 86% of the isolates were identified as DEC, representing a higher prevalence than that reported in other African countries: 61.1% in Niger, 55.9% in Ethiopia [20] [21], and 45% in Burkina Faso [22]. Conversely, lower rates have been observed in Colombia (17.9%) [18], Kenya (22.46%) [19], and India (17.4%) [23]. Such variability may be attributed to differences in the target population, sanitation conditions, and detection methods.

In this study, EPEC strains were the most frequently detected, followed by EAEC and ETEC. This trend is consistent with findings from Kenya [19], South Korea [21], and India [23], although the latter did not report any ETEC strains. Other studies, however, have reported the opposite pattern, with a predominance of EAEC followed by EPEC [24]-[26]. Although the overall prevalence of EPEC is generally low, these strains are highly contagious in children and can lead to more severe forms of diarrhea [27]. We did not differentiate between typical and atypical EPEC strains, but previous research suggests that typical EPEC strains are more commonly associated with diarrheal illness in developing countries [28].

Additionally, 50% of DEC strains in this study exhibited mixed infections involving two or three virulence genes. These combinations may enhance the pathogenic potential of the strains and exacerbate the severity of infection [29] [30]. Similar associations have been reported in Sub-Saharan Africa, although at lower frequencies [20] [22] [26]. Regarding antibiotic resistance, 50% of the DEC strains in this study were multidrug-resistant (MDR), defined as the presence of at least one resistance gene in three different antibiotic classes. By comparison, MDR rates were 63.2% in Ethiopia [21], 95.3% in Nigeria [31], and 42.07% in Iran [32]. In Mali, a study also reported high levels of beta-lactam resistance, with 13 different variants identified [7].

The most frequently detected resistance genes in this study were blaTEM (49%), blaCTX-M (35.7%), and blaSHV (25.5%). These results align with those obtained by Saye in Bamako [33] and are consistent with findings from other studies. For instance, in Iran, the prevalence of these genes was 93.2% for blaTEM, 20.5% for blaCTX-M, and 2.3% for blaSHV [34]. Co-detection of resistance genes across multiple antibiotic classes was also observed, particularly between beta-lactams and quinolones, and between beta-lactams and aminoglycosides. A similar, though less frequent, association was reported in Iran (11.4%) [34]. The coexistence of ESBL genes and fluoroquinolone resistance has also been documented in other studies [35]. We also found isolates carrying both the blaNDM gene and integron genes.

The high prevalence of multidrug-resistant (MDR) E. coli observed in this study may be attributed to the strong selection pressure exerted by excessive and inappropriate antibiotic use in Mali. Historical data support this hypothesis; for instance, a 2002 study conducted in community health centers (CSCOM) reported an antibiotic prescription rate of 61.6%, with a substantial proportion classified as inappropriate [36]. Such prescribing practices not only promote resistance but also reduce the effectiveness of commonly used treatments over time. Beta-lactams remain the most frequently prescribed class, followed by aminoglycosides [37]. This pattern of antibiotic use is concerning, as it may contribute to the continued selection of resistant strains, particularly in environments with limited diagnostic capacity and antimicrobial stewardship programs.

We also observed a high prevalence of class 1 integrons, followed by class 3 and class 2 integrons. These genetic elements facilitate the acquisition and dissemination of resistance genes. A similar integron distribution profile was reported by Guindo et al. in Mali [7]. In contrast, a study conducted in Iran found that class 2 integrons (76.8%) were more strongly associated with multidrug resistance [32]. In our study, class 2 integrons were significantly associated with the presence of more than three resistance genes. For class 1 and class 3 integrons, associations were observed but did not reach statistical significance. This contrasts with the findings of Singh et al., who reported a significant association only for class 1 integrons [38].

Clinically, such extensive co-detection has serious implications. The presence of linked resistance determinants can drastically limit empirical therapy: for example, the combination of β-lactamase and PMQR genes may render both cephalosporins and fluoroquinolones ineffective, while co-carriage of carbapenemase and aminoglycoside resistance genes substantially restricts salvage treatment options. These resistance gene combinations, therefore, pose a major threat to the efficacy of first-line and last-resort antibiotics in both community and hospital settings.

The frequent co-detections of resistance genes across beta-lactams and other antibiotic classes observed in this study strongly suggest that resistance determinants are not acting in isolation and may be mediated by linked elements, such as plasmids harboring multiple resistance genes. In addition, co-transmission of plasmid-mediated quinolone resistance (PMQR) genes with extended-spectrum β-lactamase (ESBL) genes has been documented in Enterobacteriaceae [39]. Such combinations can severely constrain empirical therapeutic choices, as previously noted in ESBL- and PMQR-co‑harboring Enterobacteriaceae [39].

The co-occurrence of carbapenemase and aminoglycoside resistance genes has also been reported in clinical isolates [40] [41], further compounding the risk of multidrug resistance. Clinically, such extensive co-detection has serious implications. These resistance gene combinations, therefore, pose a major threat to the efficacy of first-line and last-resort antibiotics in both community and hospital settings.

Finally, the detection of the blaNDM gene, which encodes carbapenemase production, underscores the emergence of highly resistant strains. To our knowledge, this is the first report of the NDM β-lactamase gene with mutations in Mali, highlighting its spread within hospital settings in Bamako. These findings emphasize the urgent need for enhanced surveillance and molecular studies to mitigate the clinical impact of this emerging resistance threat. This gene was first identified in 2008 [42], and the sequence obtained in our study reveals two characteristic mutations at positions 88 (Val → Leu) and 154 (Met → Leu) [43]. The presence of NDM-5 in clinical isolates constitutes a major public health concern, given the limited therapeutic options available for treating infections caused by such strains.

One limitation of this study is the low number of sequenced samples due to the limited resources and its retrospective design. However, a key strength is the large number of resistance genes investigated using a molecular approach. Finally, additional studies using high-throughput sequencing (NGS) are needed to better characterize the genetic diversity of E. coli strains and to deepen our understanding of the molecular mechanisms underlying their resistance.

5. Conclusion

This study demonstrates the prevalence of diarrheagenic E. coli (DEC) strains carrying diverse antibiotic resistance genes, highlighting the public health threat posed by multidrug-resistant DEC. Based on these results, we recommend implementing routine molecular surveillance for carbapenemase genes in Malian hospitals to monitor their spread and inform infection control strategies.

NOTES

*These authors equally contributed.

#Corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

References

[1] Murray, C.J.L., Ikuta, K.S., Sharara, F., Swetschinski, L., Robles Aguilar, G., Gray, A., et al. (2022) Global Burden of Bacterial Antimicrobial Resistance in 2019: A Systematic Analysis. The Lancet, 399, 629-655.[CrossRef] [PubMed]
[2] Fair, R.J. and Tor, Y. (2014) Antibiotics and Bacterial Resistance in the 21st Century. Perspectives in Medicinal Chemistry, 6, 25-64.[CrossRef] [PubMed]
[3] World Health Organization (2024) Antimicrobial Resistance.
[4] Marston, H.D., Dixon, D.M., Knisely, J.M., Palmore, T.N. and Fauci, A.S. (2016) Antimicrobial Resistance. Journal of the American Medical Association, 316, Article 1193.[CrossRef] [PubMed]
[5] Nataro, J.P. and Kaper, J.B. (1998) Diarrheagenic Escherichia coli. Clinical Microbiology Reviews, 11, 142-201.[CrossRef] [PubMed]
[6] World Health Organization (2017) WHO Names 12 Bacteria That Pose the Greatest Threat to Human Health. The Guardian.
[7] Guindo, I., Dicko, A.A., Konaté, I., Sacko, K., Abdou, M., Dao, S. and Bougoudogo, F. (2022) Facteurs de Pathogénicité et Résistance aux Antibiotiques des Souches d’Escherichia coli isolées chez les Enfants Diarrhéiques de 0 à 59 Mois en Milieu Communautaire à Bamako [Pathogenicity Factors and Antibiotic Resistance of Escherichia coli Strains Isolated from Diarrheic Children Aged 0-59 Months in Community Settings in Bamako]. Health Sciences and Diseases, 23, 49-56.
https://hsd-fmsb.org/index.php/hsd/article/view/3615
[8] Diarra, B., Guindo, I., Koné, B., Dembélé, M., Cissé, I., Thiam, S., et al. (2024) High Frequency of Antimicrobial Resistance in Salmonella and Escherichia coli Causing Diarrheal Diseases at the Yirimadio Community Health Facility, Mali. BMC Microbiology, 24, Article No. 35.[CrossRef] [PubMed]
[9] Poirel, L., Madec, J., Lupo, A., Schink, A., Kieffer, N., Nordmann, P., et al. (2018) Antimicrobial Resistance in Escherichia coli. Microbiology Spectrum, 6, 1-27.[CrossRef] [PubMed]
[10] Rodrigo, L. (2020) E. coli Infections: Importance of Early Diagnosis and Efficient Treatment. Books on Demand.
[11] Havenga, B., Ndlovu, T., Clements, T., et al. (2019) Exploring the Antimicrobial Resistance Profiles of WHO Critical Priority List Bacterial Strains. BMC Microbiology, 19, Article No. 303.[CrossRef] [PubMed]
[12] Vilchez, S., Reyes, D., Paniagua, M., Bucardo, F., Möllby, R. and Weintraub, A. (2009) Prevalence of Diarrhoeagenic Escherichia coli in Children from León, Nicaragua. Journal of Medical Microbiology, 58, 630-637.[CrossRef] [PubMed]
[13] Weill, F., Guesnier, F., Guibert, V., Timinouni, M., Demartin, M., Polomack, L., et al. (2006) Multidrug Resistance in salmonella Enterica Serotype Typhimurium from Humans in France (1993 to 2003). Journal of Clinical Microbiology, 44, 700-708. [Google Scholar] [CrossRef] [PubMed]
[14] Letchumanan, V., Yin, W., Lee, L. and Chan, K. (2015) Prevalence and Antimicrobial Susceptibility of Vibrio Parahaemolyticus Isolated from Retail Shrimps in Malaysia. Frontiers in Microbiology, 6, Article 33.[CrossRef] [PubMed]
[15] Pagani, L., Dell’Amico, E., Migliavacca, R., D’Andrea, M.M., Giacobone, E., Amicosante, G., et al. (2003) Multiple CTX-M-Type Extended-Spectrum β-Lactamases in Nosocomial Isolates of Enterobacteriaceae from a Hospital in Northern Italy. Journal of Clinical Microbiology, 41, 4264-4269.[CrossRef] [PubMed]
[16] Awoke, T., Teka, B., Aseffa, A., Sebre, S., Seman, A., Yeshitela, B., et al. (2022) Detection of blaKPC and blaNDM Carbapenemase Genes among Klebsiella pneumoniae Isolates in Addis Ababa, Ethiopia: Dominance of blaNDM. PLOS ONE, 17, e0267657.[CrossRef] [PubMed]
[17] Ploy, M.C., Denis, F., Courvalin, P., et al. (2000) Molecular Characterization of Integrons in Acinetobacter baumannii: Description of a Hybrid Class 2 Integron. Antimicrobial Agents and Chemotherapy, 44, 2684-2688.[CrossRef] [PubMed]
[18] Rúgeles, L.C., Bai, J., Martínez, A.J., Vanegas, M.C. and Gómez-Duarte, O.G. (2010) Molecular Characterization of Diarrheagenic Escherichia coli Strains from Stools Samples and Food Products in Colombia. International Journal of Food Microbiology, 138, 282-286.[CrossRef] [PubMed]
[19] Okumu, N.O., Ngeranwa, J.J.N., Muloi, D.M., Ochien’g, L., Moodley, A., Mutisya, C., et al. (2023) Risk Factors for Diarrheagenic Escherichia coli Infection in Children Aged 6-24 Months in Peri-Urban Community, Nairobi, Kenya. PLOS Global Public Health, 3, e0002594.[CrossRef] [PubMed]
[20] Abdoulaye, O., Maiga, D.A., Amadou Harouna, M.L., et al. (2020) Prevalence of Virulence Genes of Escherichia coli During Acute Gastroenteritis in Children in Niamey. Health Sciences and Disease, 21, 1-5.
[21] Wolde, A., Deneke, Y., Sisay, T., et al. (2022) Molecular Characterization and Antimicrobial Resistance of Pathogenic Escherichia coli Strains in Children from Wolaita Sodo, Southern Ethiopia. Journal of Tropical Medicine, 2022, Article ID: 9166209.[CrossRef] [PubMed]
[22] Bonkoungou, I.J.O., Lienemann, T., Martikainen, O., et al. (2012) Diarrhoeagenic Escherichia coli Detected by 16‐Plex PCR in Children with and without Diarrhoea in Burkina Faso. Clinical Microbiology and Infection, 18, 901-906.
[23] Shetty, V.A., Kumar, S.H., Shetty, A.K., Karunasagar, I. and Karunasagar, I. (2012) Prevalence and Characterization of Diarrheagenic Escherichia coli Isolated from Adults and Children in Mangalore, India. Journal of Laboratory Physicians, 4, 24-29.[CrossRef] [PubMed]
[24] Hegde, A., Ballal, M. and Shenoy, S. (2012) Detection of Diarrheagenic Escherichia coli by Multiplex PCR. Indian Journal of Medical Microbiology, 30, 279-284.[CrossRef] [PubMed]
[25] Konaté, A., Dembélé, R., Kagambèga, A., Soulama, I., Kaboré, W.A.D., Sampo, E., et al. (2017) Molecular Characterization of Diarrheagenic Escherichia coli in Children Less than 5 Years of Age with Diarrhea in Ouagadougou, Burkina Faso. European Journal of Microbiology and Immunology, 7, 220-228.[CrossRef] [PubMed]
[26] Moyo, S.J., Maselle, S.Y., Matee, M.I., Langeland, N. and Mylvaganam, H. (2007) Identification of Diarrheagenic Escherichia coli Isolated from Infants and Children in Dar Es Salaam, Tanzania. BMC Infectious Diseases, 7, Article No. 92.[CrossRef] [PubMed]
[27] Gambushe, S.M., Zishiri, O.T. and El Zowalaty, M.E. (2022) Review of Escherichia coli O157:H7 Prevalence, Pathogenicity, Heavy Metal and Antimicrobial Resistance, African Perspective. Infection and Drug Resistance, 15, 4645-4673.[CrossRef] [PubMed]
[28] Trabulsi, L.R., Keller, R. and Gomes, T.A.T. (2002) Typical and Atypical Enteropathogenic Escherichia coli. Emerging Infectious Diseases, 8, 508-513.[CrossRef] [PubMed]
[29] Santos, A.C.D.M., Santos, F.F., Silva, R.M. and Gomes, T.A.T. (2020) Diversity of Hybrid-and Hetero-Pathogenic Escherichia coli and Their Potential Implication in More Severe Diseases. Frontiers in Cellular and Infection Microbiology, 10, Article 339.[CrossRef] [PubMed]
[30] Kaper, J.B., Nataro, J.P. and Mobley, H.L.T. (2004) Pathogenic Escherichia coli. Nature Reviews Microbiology, 2, 123-140.[CrossRef] [PubMed]
[31] Medugu, N., Aworh, M.K., Iregbu, K., Nwajiobi-Princewill, P., Abdulraheem, K., Hull, D.M., et al. (2022) Molecular Characterization of Multi Drug Resistant Escherichia coli Isolates at a Tertiary Hospital in Abuja, Nigeria. Scientific Reports, 12, Article No. 14822.[CrossRef] [PubMed]
[32] Kargar, M., Mohammadalipour, Z., Doosti, A., Lorzadeh, S. and Japoni-Nejad, A. (2014) High Prevalence of Class 1 to 3 Integrons among Multidrug-Resistant Diarrheagenic Escherichia coli in Southwest of Iran. Osong Public Health and Research Perspectives, 5, 193-198.[CrossRef] [PubMed]
[33] Saye, T. (2012) Prévalence des entérobactéries productrices de beta-lactamases à spectre élargi au CHU du Point G de 2006 à 2008.
https://library.adhl.africa/handle/123456789/10257
[34] Egwu, E., Ibiam, F.A., Moses, I.B., Iroha, C.S., Orji, I., Okafor-Alu, F.N., et al. (2023) Antimicrobial Susceptibility and Molecular Characteristics of Beta-Lactam-and Fluoroquinolone-Resistant E. coli from Human Clinical Samples in Nigeria. Scientific African, 21, e01863.[CrossRef]
[35] Rupp, M.E. and Fey, P.D. (2003) Extended Spectrum β-Lactamase (ESBL)-Producing Enterobacteriaceae: Considerations for Diagnosis, Prevention and Drug Treatment. Drugs, 63, 353-365.[CrossRef] [PubMed]
[36] Diawara, A., Sangho, H., Maiga, D., Kone, A.B.D., Maiga, M.D. and Simaga, S.Y. (2007) Pratiques de prescription dans les centres de sante communautaires (CSCOM) et utilisation des midicaments par les populations. Le Mali Médical, No. 2, 10-13.
https://library.adhl.africa/handle/123456789/10996
[37] Coulibaly, Y., Konate, A., Kone, D. and Bougoudogo, F. (2014) Étude de la prescription des antibiotiques en milieu hospitalier malien. Revue Malienne dInfectiologie et de Microbiologie, 3, 2-8.
[38] Singh, T., Dar, S.A., Singh, S., Shekhar, C., Wani, S., Akhter, N., et al. (2021) Integron Mediated Antimicrobial Resistance in Diarrheagenic Escherichia coli in Children: In Vitro and in Silico Analysis. Microbial Pathogenesis, 150, Article ID: 104680.[CrossRef] [PubMed]
[39] Azargun, R., Sadeghi, M.R., Soroush Barhaghi, M.H., Samadi Kafil, H., Yeganeh, F., Ahangar Oskouee, M., et al. (2018) The Prevalence of Plasmid-Mediated Quinolone Resistance and ESBL-Production in Enterobacteriaceae Isolated from Urinary Tract Infections. Infection and Drug Resistance, 11, 1007-1014.[CrossRef] [PubMed]
[40] Altayb, H.N., Elbadawi, H.S., Alzahrani, F.A., Baothman, O., Kazmi, I., Nadeem, M.S., et al. (2022) Co-Occurrence of β-Lactam and Aminoglycoside Resistance Determinants among Clinical and Environmental Isolates of Klebsiella Pneumoniae and Escherichia coli: A Genomic Approach. Pharmaceuticals, 15, Article 1011.[CrossRef] [PubMed]
[41] Smriti, S., Verma, G., Pradhan, S., Sigh, N., Panda, S.S., Mohapatra, I., et al. (2025) Co-Occurrence of Genes Encoding Carbapenem Resistance and Aminoglycoside Resistance in Clinical Isolates of Enterobacterales. Drug Target Insights, 19, 91-98.[CrossRef]
[42] Yong, D., Toleman, M.A., Giske, C.G., Cho, H.S., Sundman, K., Lee, K., et al. (2009) Characterization of a New Metallo-β-Lactamase Gene, blaNDM-1, and a Novel Erythromycin Esterase Gene Carried on a Unique Genetic Structure in Klebsiella pneumoniae Sequence Type 14 from India. Antimicrobial Agents and Chemotherapy, 53, 5046-5054.[CrossRef] [PubMed]
[43] Hornsey, M., Phee, L. and Wareham, D.W. (2011) A Novel Variant, NDM-5, of the New Delhi Metallo-β-Lactamase in a Multidrug-Resistant Escherichia coli ST648 Isolate Recovered from a Patient in the United Kingdom. Antimicrobial Agents and Chemotherapy, 55, 5952-5954.[CrossRef] [PubMed]

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.