A Study on the Molecular Genes of ESBL-Producing Enterobacteriaceae from Patients Hospitalized in the Internal Medicine Department of a Tertiary Hospital in Lagos, Nigeria
Chinedu Nweke Idakari1*orcid, Chijioke Stanley Anyigor-Ogah2, Nneka Alice Sunday-Nweke3, Ugochi Irene Asaga-Nwali4, Ikechukwu Francis Agwu5, Chidiebere Brown Ene6, Winifred Chinwendu Akpa6, Ogochukwu Chioma7, Godwin Macauley Emelobe6, Ngozi Maryjane Ezekwesili6, John Aghogho Imuere6, Ifeoma Cecila Uche-Omovoh8, Christabel Chinedum Amagwu9, Oyinlola O. Oduyebo10
1Department of Medical Microbiology and Parasitology, David Umahi Federal Teaching Hospital, Uburu, Nigeria.
2Department of Family Medicine, Alex-Ekwueme Federal University Teaching Hospital, Abakaliki, Nigeria.
3Department of Surgery, Alex-Ekwueme Federal University Teaching Hospital, Abakaliki, Nigeria.
4Department of Community Medicine, Alex-Ekwueme Federal University Teaching Hospital, Abakaliki, Nigeria.
5Department of Medical Microbiology and Parasitology, University of Uyo Teaching Hospital, Uyo, Nigeria.
6Department of Medical Microbiology and Parasitology, Alex-Ekwueme Federal University Teaching Hospital, Abakaliki, Nigeria.
7Department of Surgery Federal Medical Centre, Keffi, Nigeria.
8Department of Obstetrics and Gynecology, Alex-Ekwueme Federal University Teaching Hospital, Abakaliki, Nigeria.
9Department of Medical Microbiology and Parasitology, Enugu State University of Technology Teaching Hospital, Enugu, Nigeria.
10Department of Medical Microbiology and Parasitology, University of Lagos, Lagos, Nigeria.
DOI: 10.4236/jbm.2025.137029   PDF    HTML   XML   104 Downloads   597 Views  

Abstract

Background: Multidrug-resistant Enterobacteriaceae pose a significant global health burden. These bacteria produce extended-spectrum beta-lactamase (ESBL) enzymes, which render them resistant to many beta-lactam antibiotics. This study aimed to identify both the phenotypic traits and molecular genes associated with ESBL production in Enterobacteriaceae strains isolated from hospitalized patients in the Internal Medicine Department of Lagos University Teaching Hospital (LUTH), Idi-Araba. Materials and Methods: This cross-sectional study was carried out in the Internal Medicine Department of Lagos University Teaching Hospital, Idi-Araba. All consenting patients admitted with clinical signs of infection were enrolled. Relevant clinical samples were collected and analyzed using standard microbiological identification methods, while multiplex polymerase chain reaction (PCR) was employed to genotypic markers. Result: 300 bacterial pathogens were isolated, of which 176 belonged to the Enterobacteriaceae family. Escherichia coli was the most frequently identified pathogen, accounting for 32% of the isolates, followed by Klebsiella pneumoniae, 23.9% and Klebsiella oxytoca, 17.6%, among others. More than 60% of the Enterobacteriaceae isolates were found to produce ESBL. Among the ESBL genes detected, TEM was the most prevalent, followed by SHV and CTX-M. Conclusion: The study revealed a high prevalence of extended-spectrum beta-lactamase (ESBL) production. Plasmid-mediated resistance genes, including TEM, SHV, and CTX-M, were identified.

Share and Cite:

Idakari, C.N., Anyigor-Ogah, C.S., Sunday-Nweke, N.A., Asaga-Nwali, U.I., Agwu, I.F., Ene, C.B., Akpa, W.C., Chioma, O., Emelobe, G.M., Ezekwesili, N.M., Imuere, J.A., UcheOmovoh I.C., Amagwu, C.C. and Oduyebo, O.O. (2025) A Study on the Molecular Genes of ESBL-Producing Enterobacteriaceae from Patients Hospitalized in the Internal Medicine Department of a Tertiary Hospital in Lagos, Nigeria. Journal of Biosciences and Medicines, 13, 368-384. doi: 10.4236/jbm.2025.137029.

1. Introduction

Background: Enterobacteriaceae is a heterogeneous group of gram-negative straight rods and non-sporulated bacteria. Members of Enterobacteriaceae are widely distributed in nature, and many of their species live in the gut of humans and animals, including insects, where they can cause enteric diseases or remain as commensal organisms. The members of this family play a role as plant pathogens and biotechnological microorganisms for the heterologous production of proteins [1]. However, only a small group of species are considered strict pathogens in human [2].

To survive the effects of antibiotics, microorganisms are constantly finding new defense strategies. Some Enterobacteriaceae produce enzymes called Extended-Spectrum Beta-Lactamases (ESBLs), which are enzymes that cause resistance to some of the most commonly used antibiotics, including all penicillin, cephalosporins and monobactams [3]. Antibiotic resistance of bacteria is commonly seen in daily medical practice, with multidrug-resistant gram-negative bacteria posing the greatest threat to human health [4].

Extended spectrum beta lactamases (ESBLs) are bacterial enzymes that hydrolyze oxyimino-cephalosporins and confer resistance to broad spectrum cephalosporin and aztreonam [5], they give the bacteria ability to resist penicillins and cephalosporins of the first, second and third generations as well as aztreonam through hydrolysis of these antibiotics [6] and are encoded by mobile genetic elements [7]. Alarmingly, these genes code resistance to not only cephalosporins and penicillin but also other antibiotics such as aminoglycosides, fluoroquinolones, tetracyclines, chloramphenicol, and sulfamethoxazole (trimethoprim) [7].

ESBL-producing Enterobacteriaceae infections became a significant therapeutic challenge worldwide in daily clinical practice since their resistances to additional classes of antibiotics reduce effective therapeutic options [8]. In many cases, even common infections such as urinary tract infections caused by ESBL-producing organisms require more complex antibiotics and are of major concern since infections caused by these resistant strains are associated with prolonged hospital stay and increased case-fatality rate [9]. Nosocomial risk factors such as the presence of intravascular catheters, undergoing surgery, staying at an intensive care unit, and international travel have been shown to increase the risk of being colonized with ESBL-producing Enterobacteriaceae [10]-[12].

The prevalence of beta-lactamase-producing organisms has been rising globally, including in European countries. [13] In North America, the estimated prevalence of ESBL-producing E. coli is 9.8%.[14] Numerous studies have also documented the growing emergence of ESBL-producing Enterobacteriaceae across Africa [15] [16]. However, prevalence rates vary significantly across the continent, ranging from 16.4% to 77.8% in North Africa, and from 8.8% to 13.1% in South Africa. In East Africa, reported rates fall between 37.4% and 62.8% [17]. A pooled analysis by Toy et al. reported a prevalence of 9.3% in sub-Saharan Africa and as high as 58.0% in North West Nigeria [16] [18].

The wide regional differences underscore the need to take into account at the level of the country, the region, the hospital, and at times the individual hospital unit when making decisions about empirical therapy for serious infections. Moreover, infections caused by ESBL producers range from uncomplicated urinary tract infections to life-threatening sepsis. ESBL—producing organism exhibit co-resistance to many other classes of antibiotics, resulting in limitation of therapeutic options. The data generated in this study will enable physicians handling infections caused by ESBL—producing Enterobacteriaceae to consider possible antibiotic susceptibility patterns when formulating decisions pertaining to developing management options. Therefore, this study aimed to identify both the phenotypic features and molecular genes associated with ESBL production in Enterobacteriaceae pathogens isolated from hospitalized patients in the Internal Medicine Department of Lagos University Teaching Hospital (LUTH), Idi-Araba.

2. Methods

2.1. Study Area

This study was undertaken in Lagos University Teaching Hospital (LUTH) Idi-Araba, Lagos State of Nigeria. This is the largest tertiary hospital in Lagos state and one of the foremost hospitals in Nigeria. It serves people in South west geopolitical zone and epicenter for referrals in Nigeria.

2.2. Study Design

The study was a cross-sectional hospital-based survey of all the patients with a clinical diagnosis of infection admitted to the adult medical wards of Lagos University Teaching Hospital. The study started from May 2019 to April 2020. Clinical samples and relevant data were collected from consenting participants who met the eligibility criteria and were processed and analyzed for relevant genes responsible for extended-spectrum beta-lactamase in Enterobacteriaceae.

2.3. Sample Size

The sample size was determined by using the formula below:

N o = Z 2 pq d 2

N = The desired sample size.

Z = The standard normal deviation, usually set at 1.96 corresponding to 95% confidence interval.

p = The prevalence.

q = 1 − p.

d = The standard error (margin of error) set at 0.05.

where Extended Spectrum Beta-lactamase (ESBL) prevalence rate among Enterobacteriaceae of 9.25% was used [19].

The sample size was calculated using the formula above where: Z = 1.96; p = 0.226; q = 1 − p = 0.774; d = 0.05.

N = (1.96)2 × 0.0925 × 0.91/(0.05)2 = 3.8416 × 0.0925 × 0.91/0.0025 = 129.3 = 129.

The number of Enterobacteriaceae isolates used for this study 176 in order to cover for attrition and possible loss due storage.

2.4. Sampling Method

Systematic consecutive sampling method was used to recruit participants into this study.

2.5. Inclusion Criteria

Patients with clinical diagnosis of infection on admission for more than 24 hours at the Lagos State University Teaching Hospital were included in the study.

2.6. Exclusion Criteria

Patients with infections who were hospitalized for one day were excluded from the study.

2.7. Sample Collection and Analysis

Screening specimen included clinically relevant samples collected from patients presenting with infections before administration of antibiotics. The samples analyzed were blood, urine, wound swabs, ascitic fluid, aspirate, wound biopsy, sputum and others. There were aseptically collected into the appropriate specimen bottles and transported to the medical microbiology laboratory through cold chain. The various specimens were carefully registered and processed through macroscopy, microscopy and culture in appropriate media according to the standard laboratory practice. Enterobacteriaceae isolates were further identified with the use of Microbact Identification System (MICROBACTTM 24E) according to the manufacturer’s guideline (Oxoid UK).

2.8. Antibiotics Susceptibility Testing

Antimicrobial susceptibility testing of isolates was done using Clinical and Laboratory Standards Institute (CLSI) guidelines [20]. This was carried out by modified Kirby-Bauer Disk diffusion method on Mueller-Hinton agar plates incubated aerobically at 37˚C for 18 - 24 hours. The zones of inhibition around the disc were measured in millimeters and classified as Sensitive (S), Intermediate (I), or Resistant (R). The antibiotics tested were Piperaciin-Tazobactam (TZP), Cefuroxime (CXM), Amoxicilin/clavulanate (AMC), Ciprofloxacin (CIP), Cefotaxime (CTX), Meropenem (MEM), Amikacin (AK), Ceftriaxone (CRO), Cefipime (FEP), Gentamicin (CN), Levofloxacin (LEV) [20].

2.9. Phenotypic Detection and Confirmation of Extended Spectrum β-Lactamase (ESBL) Producing Enterobacteriaceae

The Enterobacteriaceae isolates were screened for ESBL production by using disc diffusion of ceftazidime (30 µg) and cefotaxime (30 µg) placed on inoculated plate containing Muller Hinton agar according to CLSI recommendation. The zone diameters of ≤22 mm and ≤27 mm for ceftazidime and cefotaxime respectively, were indicated as suspected ESBL production [20]. Positive isolates were subjected to a confirmatory test using the double disk synergy test.

Confirmatory test: Double disc synergy test (DDST) was used to test for presence of ESBL in Enterobacteriaceae. Discs containing cephalosporin (cefotaxime and ceftazidime) was placed next to a disc with clavulanic acid (amoxicillin-clavulanic acid). The distance between the discs was 20 mm centre to centre. The agar was incubated at 35˚C to 37˚C for 18 hours in ambient air.

3. Result

Positive result was indicated by augmenting of zone of inhibition towards the direction of the amoxicillin-clavulanic acid with dumb-bell or keyhole appearance.

3.1. Quality Control

Klebsiella pneumoniae ATCC 700603 was used as positive control organism Escherichia coli ATCC 25922 was used as negative control organism [20].

3.2. Molecular Detection of the Resistance Genes

The molecular analysis was done in Nigeria Institute of Medical Research (NIMR) Yaba Lagos, Nigeria. Genotypic determination of the resistance genes responsible for ESBL producing enterobacteriaceae phenotype was done. Polymerase chain reactions (PCR) were used to detect the resistant genes from the isolates following the result of the phenotypic resistance testing.

3.3. DNA Extractions

Bacterial DNA extractions were done by extraction column method using Zymo Bacterial/Fungal DNA Mini PrepTM Kit [21] [22].

Table 1. Primer sequence.

Phenotypic resistance

Target gene

Primer name

PRIMER SEQUENCE 51 → 31

Amplicon size (base pair)

References

ESBL

i. CTX-M

Forward (F)

GACAAAGAGAGTGCAACGGATG

501

[23]

CTX-M

Reverse (R)

TCAGTGCGATCCAGACGAAA

ii. TEM

Forward (F)

AGTGCTGCCATAACCATGAGTG

431

[23]

Reverse ®

CTGACTCCCCGTCGTGTAGATA

iii. SHV

Forward (F)

GATGAACGCTTTCCCATGATG

214

[23]

Reverse (R)

CGCTGTTATCGCTCATGGTAA

3.4. Choice of Primer

Table 1 shows primers used for detection of antibiotic resistance genes were chosen from database sequences with consideration to the common target of resistance genes (TEM, SHV, and CTX-M). The primers were synthesized by STAB VIDA, Lda, FCT/UNL (Lab. 0072829-516) Caparica in Portugal.

3.5. Amplification

The PCR was performed in a final volume of 20 µL reaction master mixture using Solis Biodyne (from Estonia) 5X firepol ready to load master mix. 4 µL of extracted DNA was added to 16 µL of PCR master mixture. The amplification reactions were performed in Bio-Rad T100 Thermal Cycler under the described amplification conditions. The runs were done as multiplex PCR and the condition was optimized to ensure that each amplicon was the correct base pair. The annealing temperature of each of the primer set was optimized with due consideration to the melting temperature (Tm) of the various primers in the set to ensure optimum reaction. 35 cycles were performed to ensure enough PCR products were generated to enable easy detection after agarose gel electrophoresis. The runs were done according to the groups of genes responsible for a particular phenotypic resistance.

ESBL-producing Enterobacteriaceae genes (CTX-M, TEM and SHV): the previously described protocol was used and the multiplex assay detected TEM, SHV, and CTX-M genes [23] The amplification condition involved denaturation at 94˚C for 5 minutes followed by 35 cycles of 94 C for 1 minute, 61˚C for 1 minute and 72˚C for 1 minute, and a final extension of 72˚C for 5 minutes [23].

3.6. Agarose Gel Electrophoresis

Agarose gel electrophoresis technique was used to separate amplified gene products according to their base pairs. The assay products were electrophoresed for 30 minutes at 100 V in 0.5X TBE buffer. The DNA was stained with ethidium bromide (1 µ/mL). The gels were imaged under ultraviolet (UV) light. The PCR amplicon size was calculated by comparing the molecular weight with the molecular ladders [23].

3.7. Data Analysis

The data collected were entered in Microsoft Excel version 2010 and subsequently analyzed using the International Business Machine Statistical Package for Social Sciences (IBM SPSS) statistics for Windows, version 25 (IBM Corp., Armonk, New York, USA). The data were presented in frequency tables and summary statistics.

4. Results

4.1. Demographic Characteristics of the Patients Enrolled in the Cross-Sectional Study

A total of 717 patients were investigated, 300 were positive for different bacterial infections and 176 were positive for infections caused by bacteria of the family Enterobacteriaceae. Seventy-four (42%) males and one hundred and two (58%) females were participants with infections caused by Enterobacteriaceae. The age range of the patients was (18 to 80) years, with a mean age of 45.9 ± 12.1 years. The highest number of patients was in the 30 to 39 age group followed by the 40 to 49 and 50 to 59 years age groups, with 42% and 38% respectively (Table 2).

4.2. Types of Clinical Infections Involved in the Study

Urinary tract infections 72 (41%) were the most predominant infection, followed by lower respiratory tract infections 37 (21%), bloodstream infections 30 (17%), skin and soft tissue infections 30 (17%) and 7 (4%) others (Figure 1). The most common organism isolated was Escherichia coli 56 (32%), followed by Klebsiella pneumoniae 42 (23.9%), Klebsiella oxytoca 31 (17.6%), and others (Table 3).

4.3. Antibiotic Susceptibility Profile of Pathogens

The susceptibility profiles of the isolates showed that over 60% Enterobacteriaceae were susceptible to amikacin, levofloxacin, piperacillin tazobactam and meropenem while more than 50% were resistant to second and third generation cephalosporins such as cefuroxime, cefotaxime and ceftriaxone. Most of the Enterobacteriaceae were susceptible to piperacillin tazobactam (81%) and meropenem (89%) (Table 4).

4.4. Extended Spectrum Beta-Lactamase Producing Enterobacteriaceae

Of 176 Enterobacteriaceae isolates screened for extended spectrum beta-lactamase (ESBL) production using ceftazidime and cefotaxime disc diffusion, 95 (54%) isolates were positive (Table 5). Those positive with screening test were subjected to confirmatory test using double disc synergy test (DDST). The test revealed that 52 (29.5%) of Enterobacteriaceae were extended spectrum beta-lactamase (ESBL) producers (Table 5). The distribution of the ESBL producing Enterobacteriaceae according to their various species is shown in Table 5. Klebsiella pneumoniae 19 (36.5%) was the most common ESBL producers followed by Escherichia coli 15 (28.8%), klebsiella oxytoca 9 (17.3%), Enterobacter cloacae 2 (3.8%), and one (1.9%) each of Citrobacter koseri, Enterobacter aerogenes, Enterobacter agglomerans, Enterobacter gergoviae and proteus vulguris.

4.5. Molecular Analysis of ESBL Producing Enterobacteriaceae

All the 52 extended spectrum beta-lactamase (ESBL) producing Enterobacteriaceae were subjected to molecular analysis by polymerase chain reaction (PCR). The result showed that TEM genes 43 (56.6%) were the highest followed by SHV genes 31 (40.8%), with the lowest of 2 (2.6%) for CTX-M genes. Extended spectrum beta-lactamase genes were most detected in Klebsiella pneumoniae 19 (41.3%), followed by Klebsiella oxytoca 10 (21.7%), Escherichia coli 10 (21.7%), Enterobacter cloacae 3 (6.5%), and 1 (2.2%) each for Enterobacter aerogenes, Proteus mirabilis, Proteus vulgaris, and Citrobacter koseri. There was no resistance gene detected in 6 isolates (Table 6). There were multiple occurrences of genes in some of the isolates. The co-existence of CTX-M, TEM and SHV was seen in an isolate of Escherichia coli, while TEM and SHV genes were seen in 27 isolates (Klebsiella pneumoniae (16), Klebsiella oxytoca (6), Escherichia coli (3), Enterobacter aerogenes (1) and Citrobacter koseri (1)). The co-existence of TEM and CTX-M genes was seen in only one isolate of Klesbsiella oxytoca.

Table 2. Baseline characteristics.

Variable

Frequency (n = 176)

Percentage (%)

Age group (Years)

18 - 29

25

14.0

30 - 39

42

24.0

40 - 49

38

22

50 - 59

38

22

≥60

33

19

Mean ± SD Age

45.9 ± 12.1

Gender

Male

74

42

Female

102

58

Figure 1. Various types of infections.

Table 3. Enterobacteriaceae isolated from the clinical specimens.

Enterobacteriaceae

Blood (%)

Sputum (%)

Urine (%)

Wound specimen (%)

Others (%)

E. coli

56 (32%)

6 (20.0)

14 (37.8)

26 (36.1)

8 (26.6)

2 (28.6)

Klebsiella pneumoniae

42 (23.9%)

10 (33.3)

16 (43.2)

8 (11.1)

6 (20)

2 (28.6)

Klebsiella oxytoca

31 (17.6%)

2 (6.6)

5 (13.5)

19 (26.4)

4 (13.3)

1 (14.3)

Citrobacter freundii

2 (1.1%)

2 (6.6)

0 (0.0)

0 (0.0)

0 (0.0)

0 (0.0)

Citrobacter koseri

5 (2.8%)

1 (3.3)

0 (0.0)

2 (2.8)

1 (3.3)

1 (14.3)

Enterobacter aerogenes

5 (2.8%)

1 (3.3)

1 (2.7)

2 (2.8)

1 (3.3)

0 (0.0)

Enterobacter agglomerans

5 (2.8%)

2 (6.6)

0 (0.0)

3 (4.1)

0 (0.0)

0 (0.0)

Enterobacter cloacae

3 (1.7%)

1 (3.3)

0 (0.0)

0 (0.0)

2 (6.6)

0 (0.0)

Enterobacter gergoviae

2 (1.1%)

0 (0.0)

0 (0.0)

1 (1.4)

1 (3.3)

0 (0.0)

Klebsiella ozaenae

1 (0.5%)

0 (0.0)

1 (2.7)

0 (0.0)

0 (0.0)

0 (0.0)

Morganella morganii

1 (0.5%)

0 (0.0)

0 (0.0)

1 (1.4)

0 (0.0)

0 (0.0)

Proteus mirabilis

10 (5.7%)

3 (10.0)

(0.0)

2 (2.8)

4 (13.3)

1 (14.3)

Proteus vulgaris

2 (1.1%)

(0.0)

(0.0)

1 (1.4)

1 (3.3)

0 (0.0)

Providencia rettgeri

4 (2.3%)

0 (0.0)

0 (0.0)

2 (2.8)

2 (6.6)

0 (0.0)

Serratia marcescens

4 (2.3%)

1 (3.3)

0 (0.0)

3 (4.1)

0 (0.0)

0 (0.0)

Serratia liquefaciens

3 (1.7%)

1 (3.3)

0 (0.0)

2 (2.8)

0 (0.0)

0 (0.0)

Total

176 (100)

30 (100)

37 (100)

72 (100)

30 (100)

7 (100)

Table 4. Antibiotics susceptibility profile.

S/N

ISOLATE

TOTAL NUMBER OF ISOLATES

GENTAMICIN (%S)

AMIKACIN (%S)

CIPROFLOXACIN (%S)

LEVOFLOXACIN (%S)

CEFUROXIME (%S)

CEFOTAXIME (%S)

CEFTRIAXONE (%S)

CEFEPIME (%S)

PIPERACILLIN TAZOBACTAM (%S)

AMOXICILLIN CLAVULANATE (%S)

MEROPENEM (%S)

1.

Escherichia coli

56

36 (64)

36 (64)

25 (45)

41 (73)

16 (29)

29 (52)

29 (52)

35 (63)

48 (86)

31 (55)

51 (91)

2.

Klebsiella pneumoniae

42

23 (55)

30 (72)

19 (45)

25 (60)

12 (29)

15 (36)

14 (33)

23 (55)

32 (76)

25 (60)

33 (79)

3.

Klebsiella oxytoca

31

17 (55)

24 (77)

16 (52)

21 (68)

8 (26)

11 (35)

13 (42)

17 (55)

22 (71)

17 (55)

28 (90)

4.

Klebsiella ozaenae

1

0

1 (100)

0

1 (100)

0

1 (100)

1 (100)

1 (100)

1 (100)

1 (100)

1 (100)

5.

Proteus mirabilis

10

6 (60)

5 (50)

6 (60)

8 (80)

3 (30)

7 (70)

6 (60)

7 (70)

9 (90)

6 (60)

9 (90)

6.

Proteus vulgaris

2

1 (50)

1 (50)

1 (50)

1 (50)

0

1 (50)

1 (50)

1 (50)

2 (100)

1 (50)

2 (100)

7.

Enterobacter aerogenes

5

4 (80)

5 (100)

4 (80)

5 (100)

2 (40)

3 (60)

3 (60)

3 (60)

4 (80)

2 (40)

4 (80)

8.

Enterobacter agglomerans

5

1 (20)

2 (40)

3 (60)

4 (80)

1 (20)

2 (40)

3 (60)

4 (80)

4 (80)

4 (80)

5 (100)

9.

Enterobacter cloacae

3

0

1 (33)

3 (100)

3 (100)

0

0

0

1 (33)

2 (67)

2 (67)

3 (100)

10.

Enterobacter gergoviae

2

2 (100)

1 (50)

1 (50)

1 (50)

1 (50)

1 (50)

1 (50)

1 (50)

2 (100)

1 (50)

2 (100)

11.

Citrobacter koseri

5

5 (100)

3 (60)

4 (80)

4 (80)

4 (80)

3 (60)

4 (80)

4 (80)

4 (80)

4 (80)

5 (100)

12.

Citrobacter freundii

2

1 (50)

2 (100)

0

0

0

1 (50)

1 (50)

1 (50)

2 (100)

1 (50)

1 (50)

13.

Serratia marcescens

4

4 (100)

4 (100)

1 (25)

3 (75)

3 (75)

4 (100)

4 (100)

4 (100)

4 (100)

2 (50)

4 (100)

14.

Serratia liquefaciens

3

2 (67)

3 (100)

1 (33)

2 (67)

1 (33)

3 (100)

3 (100)

3 (100)

3 (100)

2 (67)

3 (100)

15.

Providencia rettgeri

4

4 (100)

4 (100)

3 (75)

4 (100)

2 (50)

3 (75)

1 (25)

2 (50)

3 (75)

3 (75)

4 (100)

16.

Morganella morganni

1

1 (100)

1 (100)

1 (100)

1 (100)

0

0

0

0

1 (100)

1 (100)

1 (100)

17.

Total

176

107 (61)

123 (70)

88 (50)

124 (70)

53 (30)

84 (48)

84 (48)

107 (61)

143 (81)

103 (59)

156 (89)

Table 5. Extended Spectrum Beta-lactamase resistance phenotype screening and confirmatory test.

Bacterial Isolate

ESBL Screening

ESBL Confirmation with DDST

Klebsiella pnuemoniae (n = 42)

a. ESBL Positive

27 (64.3%)

19 (45.2%)

b. ESBL Negative

15 (35.7%)

-

Escherichia coli (n = 56)

a. ESBL Positive

26 (46.4%)

15 (26.8%)

b. ESBL Negative

30 (53.6%)

-

Klebsiella oxytoca (n = 31)

a. ESBL Positive

18 (58.1%)

10 (32.3%)

b. ESBL Negative

13 (41.9%)

-

Enterobacter cloacae (n = 3)

a. ESBL Positive

3 (100%)

3 (100%)

b. ESBL Negative

0 (0.0%)

-

Proteus mirabilis (n = 10)

a. ESBL Positive

7 (70%)

2 (20%)

b. ESBL Negative

3 (30%)

-

Proteus vulgaris (n = 2)

a. ESBL Positive

1 (50%)

1 (50%)

b. ESBL Negative

1 (50%)

-

Enterobacter aerogenes (n = 5)

a. ESBL Positive

3 (60%)

1 (20%)

b. ESBL Negative

2 (405)

-

Citrobacter koseri (n = 5)

a. ESBL Positive

3 (60%)

1 (20%)

b. ESBL Negative

2 (40%)

-

Klebsiella ozaenae (n = 1)

a. ESBL Positive

1 (100%)

0 (0.0)

b. ESBL Negative

0 (0.0)

0 (0.0)

Enterobacter agglomerans (n = 5)

a. ESBL Positive

2 (40%)

b. ESBL Negative

3 (60)

0 (0.0)

Enterobacter gergoviae (n = 2)

-

a. ESBL Positive

1 (50%)

0 (0.0)

b. ESBL Negative

1 (50%

-

Citrobacter freundii (n = 2)

a. ESBL Positive

1 (50%)

0 (0.0)

b. ESBL Negative

1 (50%)

-

Serratia marcescens (n = 4)

a. ESBL Positive

0 (0.0)

0 (0.0)

b. ESBL Negative

4 (100%)

-

Serratia liquefacciens (n = 3)

a. ESBL Positive

0 (0.0)

0 (0.0)

b. ESBL Negative

3 (100%)

-

Providencia rettgeri (n = 4)

a. ESBL Positive

1 (25%)

0 (0.0)

b. ESBL Negative

3 (75%)

-

Morganella morganni (n = 1)

a. ESBL Positive

1 (100%)

0 (0.0)

b. ESBL Negative

0 (0.0)

-

Table 6. Molecular Genes Identified from the isolates.

Bacteria isolate

No. (%) of ESBL positive isolates (n = 52)

No (%) of isolates harbouring ESBL gene (n = 46)

No of various ESBL genes detected (n = 76)

CTX-M (n = 2)

TEM (n = 43)

SHV (n = 31)

Klebsiella pneumoniae

19

19 (41.3%)

0 (0.0)

16 (37.2%)

19 (61.3%)

Klebsiella oxytoca

10

10 (21.7%)

1 (50.0%)

10 (23.3%)

6 (19.4%)

Escherichia coli

15

10 (21.7%)

1 (50.0%)

10 (23.3%)

4 (12.9%)

Enterobacter cloacae

3

3 (6.5%)

0 (0.0)

3 (7.0%)

0 (0.0%)

Enterobacter aerogenes

1

1 (2.2%)

0 (0.0)

1 (2.3%)

1 (3.2%)

Proteus mirabilis

2

1 (2.2%)

0 (0.0)

1 (2.3%)

0 (0.0)

Proteus vulgaris

1

1 (2.2%)

0 (0.0)

1 (2.3%)

0 (0.0)

Citrobacter koseri

1

1 (2.2%)

0 (0.0)

1 (2.3%)

0 (0.0)

5. Discussion

The emergence and rapid spread of multidrug-resistant strains of ESBL-producing Enterobacteriaceae pose a significant global public health concern [24]. Findings from this study reveal a high prevalence of ESBL-producing organisms based on phenotypic analysis. Specifically, the study recorded a 29.5% prevalence of ESBL-producing Enterobacteriaceae in various clinical samples, highlighting a serious health challenge in Nigeria. This aligns with previously reported prevalence rates in the country, which have ranged from 7.5% to 82.3% [25] [26]. Similarly, high rates of ESBL producers have been documented in other African nations. For example, a systematic review from Nepal reported a pooled prevalence of 29% among Enterobacteriaceae isolates, with Escherichia coli being the most common ESBL producer [27]. In Egypt, a meta-analysis estimated an overall prevalence of 60%, primarily involving E. coli and Klebsiella pneumoniae [28]. Likewise, in Ghana, 49.1% of Enterobacteriaceae isolates were found to be ESBL producers, with E. coli being the most prevalent [29]. Even more concerning are reports from Nigeria and other countries that have recorded even higher prevalence rates [30]-[33]. These results indicate that beta-lactam antibiotics are becoming less effective in treating infections caused by Enterobacteriaceae across different regions. The elevated prevalence rates highlight the urgent need for ongoing monitoring and the implementation of antibiotic stewardship strategies.

Klebsiella pneumoniae and Escherichia coli were identified as the most common ESBL-producing Enterobacteriaceae in this study. This finding is consistent with earlier reports from healthcare institutions in South West Nigeria as well as several European countries [31] [34]. However, research conducted by Nwankwo and colleagues in Kano [35] revealed a slightly different pattern, with E. coli emerging as the predominant ESBL producer, followed by Klebsiella pneumoniae. These discrepancies in the prevalence and distribution of ESBL phenotypes may be due to variations in study methodologies, timing, geographic regions, patient populations, clinical conditions, infection prevention and control measures across different healthcare settings [25] [26].

Several evidence has shown that carbapenems are drugs of choice in the management of ESBL producing Enterobacteriaceae [25] and in this study, many ESBL producers were found susceptible to carbapenems.

The ESBL-producing Enterobacteriaceae isolates in this study harbored CTX-M, TEM, and SHV genes. Among these, the TEM gene was the most frequently detected, followed by SHV, while CTX-M was the least common. This pattern aligns with the findings of a systematic review by Tanko and colleagues on the prevalence of ESBL-producing Gram-negative bacteria in Nigeria [25]. The results also support earlier studies reporting a high prevalence of TEM and SHV genes in Nigeria [26] [30] [36]. However, some studies have reported a higher occurrence of the CTX-M gene [37]-[39] both within and outside the country. Klebsiella species were the most prevalent carriers of ESBL resistance genes, followed by Escherichia coli, a trend consistent with the findings from the systematic review of ESBL phenotypes in Nigeria [25]. In contrast, studies from North African countries such as Egypt reported CTX-M as the most dominant gene, identified in 73% of phenotypically confirmed ESBL-producing E. coli isolates, followed by TEM (60%) and SHV (22%) [28]. These differences suggest that the prevalence and distribution of ESBL genes can vary significantly across different geographic regions.

The identification of TEM, SHV, and CTX-M genes in Enterobacteriaceae (key pathogens in both community-acquired and hospital-associated infections) offers important insights into their epidemiology and the risk factors linked to their transmission [28]. These findings are particularly significant for infection prevention and control efforts, as these genes are plasmid-mediated and often associated with transposons and insertion sequences. This genetic configuration facilitates their horizontal transfer between bacterial strains, even across different species. Such plasmid-mediated gene exchange plays a crucial role in the acquisition and dissemination of multidrug resistance among bacterial populations [28] [36]. The detection of ESBL genes, especially the CTX-M genotype, is a major public health concern, given its association with numerous outbreaks in healthcare settings and communities worldwide [28] [40].

Throughput technologies, including DNA sequencing and pulsed-field gel electrophoresis, have been utilized in numerous studies to detect ESBL genes and trace their transmission patterns [41]. However, the absence of these tools in certain regions limits the scope of effective surveillance and containment strategies.

6. Conclusions

This study identified a high prevalence of ESBL production among Enterobacteriaceae isolates from patients admitted to the medical wards of Lagos University Teaching Hospital (LUTH). While most of the isolates remained susceptible to meropenem, a considerable proportion exhibited strong resistance to third-generation cephalosporins. The detection of plasmid-mediated ESBL genes, namely TEM, SHV, and CTX-M, raises concerns about the potential for widespread outbreaks of multidrug-resistant superbugs.

Therefore, routine surveillance and screening for ESBL-producing Enterobacteriaceae are highly recommended. Additionally, the use of carbapenems is strongly advised for the effective management of infections caused by these resistant organisms.

Limitation

Although genetic sequencing of the identified ESBL genes would have provided deeper insights, it was not feasible due to financial constraints. Expanding the study to include a larger population would also enhance the validity and generalizability of the findings.

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

References

[1] Octavia, S. and Lan, R. (2014) The Family Enterobacteriaceae. In: Rosemberg, E., De Long, E., Lory, S. and Stackebrandt, E., Eds., The Prokaryotes, Springer, 225-286.[CrossRef]
[2] Murray, P.R., Rosenthal, K.S. and Pfaller, M.A. (2020) Medical Microbiology. 9th Edition, Elsevier, 258-272.
[3] Rimella, L., Alderton, S., Sammarro, M., Rowlingson, B., Cocker, D., Feasey, N., et al. (2023) Inference on Extended-Spectrum β-Lactamase Escherichia coli and Klebsiella pneumoniae Data through SMC2. Journal of the Royal Statistical Society Series C: Applied Statistics, 72, 1435-1451.[CrossRef]
[4] Ogefere, H., Aigbiremwen, P. and Omoregie, R. (2015) Extended-Spectrum β-Lactamase (ESBL)-Producing Gram-Negative Isolates from Urine and Wound Specimens in a Tertiary Health Facility in Southern Nigeria. Tropical Journal of Pharmaceutical Research, 14, 1089-1094.[CrossRef]
[5] Kumar, M., Lakshmi, V. and Rajagopalan, R. (2006) Occurrence of Extended Spectrum SS-Lactamases among Enterobacteriaceae spp. Isolated at a Tertiary Care Institute. Indian Journal of Medical Microbiology, 24, 208-211.[CrossRef] [PubMed]
[6] Pagani, L., Migliavacca, R., Pallecchi, L., Matti, C., Giacobone, E., Amicosante, G., et al. (2002) Emerging Extended-Spectrum β-Lactamases in Proteus mirabilis. Journal of Clinical Microbiology, 40, 1549-1552.[CrossRef] [PubMed]
[7] Coque, T.M., Oliver, A., Pérez-Díaz, J.C., Baquero, F. and Cantón, R. (2002) Genes Encoding TEM-4, SHV-2, and CTX-M-10 Extended-Spectrum β-Lactamases Are Carried by Multiple Klebsiella pneumoniae Clones in a Single Hospital (Madrid, 1989 to 2000). Antimicrobial Agents and Chemotherapy, 46, 500-510. [Google Scholar] [CrossRef] [PubMed]
[8] Hyle, E.P., Lipworth, A.D., Zaoutis, T.E., Nachamkin, I., Fishman, N.O., Bilker, W.B., et al. (2005) Risk Factors for Increasing Multidrug Resistance among Extended-Spectrum β-Lactamase-Producing Escherichia coli and Klebsiella Species. Clinical Infectious Diseases, 40, 1317-1324.[CrossRef] [PubMed]
[9] Lautenbach, E., Patel, J.B., Bilker, W.B., Edelstein, P.H. and Fishman, N.O. (2001) Extended-Spectrum β-Lactamase-Producing Escherichia coli and Klebsiella pneumoniae: Risk Factors for Infection and Impact of Resistance on Outcomes. Clinical Infectious Diseases, 32, 1162-1171.[CrossRef] [PubMed]
[10] Colodner, R. and Raz, R. (2005) Extended-Spectrum β-Lactamases: The End of Cephalosporins? The Israel Medical Association Journal, 7, 336-338.
[11] Marcel, J., Alfa, M., Baquero, F., Etienne, J., Goossens, H., Harbarth, S., et al. (2008) Healthcare-Associated Infections: Think Globally, Act Locally. Clinical Microbiology and Infection, 14, 895-907.[CrossRef] [PubMed]
[12] Tängdén, T., Cars, O., Melhus, A. and Löwdin, E. (2010) Foreign Travel Is a Major Risk Factor for Colonization with Escherichia coli Producing CTX-M-Type Extended-Spectrum β-Lactamases: A Prospective Study with Swedish Volunteers. Antimicrobial Agents and Chemotherapy, 54, 3564-3568.[CrossRef] [PubMed]
[13] Bevan, E.R., Jones, A.M. and Hawkey, P.M. (2017) Global Epidemiology of CTX-M β-Lactamases: Temporal and Geographical Shifts in Genotype. Journal of Antimicrobial Chemotherapy, 72, 2145-2155.[CrossRef] [PubMed]
[14] Zhang, Z., Chen, M., Yu, Y., Pan, S. and Liu, Y. (2018) Antimicrobial Susceptibility among Gram-Positive and Gram-Negative Blood-Borne Pathogens Collected between 2012-2016 as Part of the Tigecycline Evaluation and Surveillance Trial. Antimicrobial Resistance & Infection Control, 7, Article No. 152.[CrossRef] [PubMed]
[15] Bulabula, A.N.H., Dramowski, A. and Mehtar, S. (2017) Maternal Colonization or Infection with Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae in Africa: A Systematic Review and Meta-Analysis. International Journal of Infectious Diseases, 64, 58-66.[CrossRef] [PubMed]
[16] Toy, T., Pak, G.D., Duc, T.P., Campbell, J.I., El Tayeb, M.A., Von Kalckreuth, V., et al. (2019) Multicountry Distribution and Characterization of Extended-Spectrum β-Lactamase-Associated Gram-Negative Bacteria from Bloodstream Infections in Sub-Saharan Africa. Clinical Infectious Diseases, 69, S449-S458.[CrossRef] [PubMed]
[17] Andrew, B., Kagirita, A. and Bazira, J. (2017) Prevalence of Extended-Spectrum β-Lactamases-Producing Microorganisms in Patients Admitted at KRRH, Southwestern Uganda. International Journal of Microbiology, 2017, Article ID: 3183076.[CrossRef] [PubMed]
[18] Ibrahim, Y., Sani, Y., Saleh, Q., Saleh, A. and Hakeem, G. (2017) Phenotypic Detection of Extended Spectrum Beta Lactamase and Carbapenemase Co-Producing Clinical Isolates from Two Tertiary Hospitals in Kano, North West Nigeria. Ethiopian Journal of Health Sciences, 27, 3-10.[CrossRef] [PubMed]
[19] Yusha’u, M., Olonitola, S.O. and Aliyu, B.S. (2007) Prevalence of Extended-Spectrum β Lactamases (ESBLs) among Members of the Enterobacteriaceae Isolates Obtained from Mohammed Abdullahi Wase Specialist Hospital, Kano, Nigeria. International Journal of Pure and Applied Sciences, 1, 42-48.
[20] CLSI (2024) Clinical and Laboratory Standard Institute. Performance Standards for Antimicrobial Susceptibility Testing, 34th Informational Supplement, CLSI M100-S34.
[21] Vesty, A., Biswas, K., Taylor, M.W., Gear, K. and Douglas, R.G. (2017) Evaluating the Impact of DNA Extraction Method on the Representation of Human Oral Bacterial and Fungal Communities. PLOS ONE, 12, e0169877.[CrossRef] [PubMed]
[22] Zymoresearch (2019) Instruction Manual. Quick-DNATM Fungal/Bacterial Miniprep Kit Catalog No. D6005.
https://files.zymoresearch.com/protocols/_d6005_quick-dna_fungal-bacterial_miniprep_kit.pdf
[23] Kim, J., Jeon, S., Rhie, H., Lee, B., Park, M., Lee, H., et al. (2009) Rapid Detection of Extended Spectrum β-Lactamase (ESBL) for Enterobacteriaceae by Use of a Multiplex PCR-Based Method. Infection and Chemotherapy, 41, 181-184.[CrossRef]
[24] Adler, A., Katz, D.E. and Marchaim, D. (2016) The Continuing Plague of Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae Infections. Infectious Disease Clinics of North America, 30, 347-375.[CrossRef] [PubMed]
[25] Tanko, N., Bolaji, R.O., Olayinka, A.T. and Olayinka, B.O. (2020) A Systematic Review on the Prevalence of Extended-Spectrum β Lactamase-Producing Gram-Negative Bacteria in Nigeria. Journal of Global Antimicrobial Resistance, 22, 488-496.[CrossRef] [PubMed]
[26] Mohammed, Y. (2016) Characterization of Extended-Spectrum β-Lactamase from Escherichia coli and Klebsiella Species from North Eastern Nigeria. Journal of Clinical and Diagnostic Research, 10, DC07-DC10.[CrossRef] [PubMed]
[27] Khadka, C., Shyaula, M., Syangtan, G., Bista, S., Tuladhar, R., Singh, A., et al. (2023) Extended-Spectrum β-Lactamases Producing Enterobacteriaceae (ESBL-PE) Prevalence in Nepal: A Systematic Review and Meta-Analysis. Science of the Total Environment, 901, Article ID: 166164.[CrossRef] [PubMed]
[28] Azzam, A., Khaled, H., Samer, D. and Nageeb, W.M. (2024) Prevalence and Molecular Characterization of ESBL-Producing Enterobacteriaceae in Egypt: A Systematic Review and Meta-Analysis of Hospital and Community-Acquired Infections. Antimicrobial Resistance & Infection Control, 13, Article No. 145.[CrossRef] [PubMed]
[29] Sampah, J., Owusu-Frimpong, I., Aboagye, F.T. and Owusu-Ofori, A. (2023) Prevalence of Carbapenem-Resistant and Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae in a Teaching Hospital in Ghana. PLOS ONE, 18, e0274156.[CrossRef] [PubMed]
[30] Ushie, S.N., Oyedeji, K.S., Ogban, G.I., Ushie, D.E., Nwaokorie, F.O., Odeniyi, O.M., et al. (2020) Molecular Epidemiology of Extended Spectrum β-Lactamases Producing Escherichia coli and Klebsiella Species in Catheterized Patients. European Journal of Medical and Health Sciences, 2, 1-6.[CrossRef]
[31] Hassan, W., Hashim, A. and Domany, R. (2012) Plasmid Mediated Quinolone Resistance Determinants qnr, aac(6’)-Ib-cr, and qep in ESBL-Producing Escherichia coli Clinical Isolates from Egypt. Indian Journal of Medical Microbiology, 30, 442-447.[CrossRef] [PubMed]
[32] Obeng-Nkrumah, N., Twum-Danso, K., Krogfelt, K.A. and Newman, M.J. (2013) High Levels of Extended-Spectrum β-Lactamases in a Major Teaching Hospital in Ghana: The Need for Regular Monitoring and Evaluation of Antibiotic Resistance. The American Society of Tropical Medicine and Hygiene, 89, 960-964.[CrossRef] [PubMed]
[33] Hoban, D.J., Lascols, C., Nicolle, L.E., Badal, R., Bouchillon, S., Hackel, M., et al. (2012) Antimicrobial Susceptibility of Enterobacteriaceae, Including Molecular Characterization of Extended-Spectrum β-Lactamase-Producing Species, in Urinary Tract Isolates from Hospitalized Patients in North America and Europe: Results from the SMART Study 2009-2010. Diagnostic Microbiology and Infectious Disease, 74, 62-67.[CrossRef] [PubMed]
[34] Olowe, O.A. and Aboderin, B.W. (2010) Detection of Extended Spectrum β-Lactamase Producing Strains of (Escherichia coli) and (Klebsiella sp.) in a Tertiary Health Centre in Ogun State. International Journal of Tropical Medicine, 5, 62-64.[CrossRef]
[35] Nwankwo, E., Magaji, N. and Tijjani, J. (2015) Antibiotic Susceptibility Pattern of Extended Spectrum Betalactamase (ESBL) Producers and Other Bacterial Pathogens in Kano, Nigeria. Tropical Journal of Pharmaceutical Research, 14, 1273-1278.[CrossRef]
[36] Tsaku, P.A., Ngwai, Y.B., Pennap, G.R.I., Ishaleku, D., Ibrahim, T., Nkene, I.H., et al. (2019) Extended-Spectrum β-Lactamase-Production in Escherichia coli Isolated from Door Handles in Nasarawa State University, Keffi, Nigeria. Heliyon, 5, e02177.[CrossRef] [PubMed]
[37] Raji, M.A., Jamal, W., Ojemeh, O. and Rotimi, V.O. (2015) Sequence Analysis of Genes Mediating Extended-Spectrum β-Lactamase (ESBL) Production in Isolates of Enterobacteriaceae in a Lagos Teaching Hospital, Nigeria. BMC Infectious Diseases, 15, Article No. 259.[CrossRef] [PubMed]
[38] Olowe, O.A., Oladipo, G.O., Makanjuola, O.A. and Olaitan, J.O. (2012) Prevalence of Extended Spectrum β-Lactamase (ESBL) Carrying Genes in Klebsiella spp from Clinical Samples at Ile-Ife, South Western Nigeria. International Journal of Pharma Medicine and Biological Sciences, 1, 129-138.
[39] Bai, L., Wang, L., Yang, X., Wang, J., Gan, X., Wang, W., et al. (2017) Prevalence and Molecular Characteristics of Extended-Spectrum β-Lactamase Genes in Escherichia coli Isolated from Diarrheic Patients in China. Frontiers in Microbiology, 8, Article 144.[CrossRef] [PubMed]
[40] O. Gutkind, G., Di Conza, J., Power, P. and Radice, M. (2013) β-Lactamase-Mediated Resistance: A Biochemical, Epidemiological and Genetic Overview. Current Pharmaceutical Design, 19, 164-208.[CrossRef] [PubMed]
[41] Flokas, M.E., Detsis, M., Alevizakos, M. and Mylonakis, E. (2016) Prevalence of ESBL-Producing Enterobacteriaceae in Paediatric Urinary Tract Infections: A Systematic Review and Meta-Analysis. Journal of Infection, 73, 547-557.[CrossRef] [PubMed]

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.