Resistance Profile Confirming the Presence of Three Knock-Down Mutations: S989P, V1016G and F1534C in Aedes aegypti in the Arrondissements of Abomey-Calavi and Ouedo in Benin
Tatchémè Filémon Tokponnon1,2, Sare Dabou Zoulkifilou1, Esther Astrid Kotannou1,2, Odile Kouagou1,2, Déo Gracias Houmenou1,2, Minassou Juvenal Ahouandjinou1, Linda Towakinou1, Brunelle Agassounon1,2, Houessinon Festus1,2, Gounou Idayath1,2, Andil Agbo-Ola1, Herman Sagbohan1, Aboubakar Sidick2, Germain Gil Padonou1, Razaki Ossè1,3, Lamine Baba-Moussa4, Martin Akogbeto1
1Centre de Recherche Entomologique de Cotonou, Ministère de la Santé, Cotonou, Benin.
2Ecole Polytechnique d’Abomey Calavi, Université d’Abomey-Calavi, Abomey-Calavi, Bénin.
3Ecole de Gestion et d’Exploitation des Systèmes d’Elevage, Université Nationale d’Agriculture, Kétou, Benin.
4Laboratoire de Biologie et de Typage Moléculaire en Microbiologie (LBTMM), Département de Biochimie et de Biologie Cellulaire (BBC), Université de Abomey‑Calavi (UAC), Abomey‑Calavi, Benin.
DOI: 10.4236/jbise.2025.187021   PDF    HTML   XML   121 Downloads   604 Views  

Abstract

Context: The control of arboviruses such as Dengue focuses on the control of Aedes mosquitoes through the use of insecticides. Unfortunately, the effectiveness of this chemical control is influenced by the increasing frequency of insecticide resistance. The aim of this study was to assess the sensitivity of Aedes aegypti in the Abomey-Calavi district to pyrethroids, the frequency of kdr mutations and the level of expression of detoxification enzymes. Methodology: Aedes eggs were collected using 100 ovitraps in 04 districts of the Abomey-Calavi arrondissement and 96 ovitraps in Ouèdo. Female Aedes obtained were exposed to a diagnostic dose of permethrin, deltamethrin, alpha-cypermethrin and cyfluthrin according to the WHO tube test protocol. PCR was used to detect kdr mutations (F1534C, S989P, V1016G) in the voltage-gated sodium channel gene in exposed Aedes females. Finally, 65 females from the Abomey-Calavi district who had not been in contact with an insecticide were analyzed individually to assess the expression of detoxification enzymes. Results: The traps were highly positive, with a positivity rate of 77% in Abomey-Calavi and 85% in Ouèdo. The hatching and emergence rates were 89% and 50% respectively in Abomey-Calavi, and 46% and 43% in Ouèdo. Identification of these adults yielded Aedes aegypti with a total of 1857 (99.73%), compared with 5 (less than 1% of the total) for Aedes albopictus. Sensitivity tests showed resistance to deltamethrin (86.53% in Zoundja and 88.95% in Zoca) and permethrin (45% Tokpa-Zoungo). In Ouèdo, on the other hand, the mortality rate of Aedes after exposure to permethrin, deltamethrin, alpha-cypermethrin and cyfluthrin was 100%. PCR genotyping of female Aedes DNA revealed the presence of kdr mutation alleles at very high frequencies. The Aedes mosquitoes analyzed had significantly higher median levels of oxidase and glutathione s-transferase (GST) expression than the insecticide-sensitive Rockefeller reference strain. Conclusion: The detection of deltamethrin resistance, several kdr mutations and overexpression of glutathione s-transferases and oxidases underscores the urgency of implementing alternative control strategies against Aedes mosquitoes. In addition, the implementation of a systematic monitoring of insecticide resistance in Aedes in Benin will enable a better understanding of susceptibility trends in space and time, and thus the development of better alternative control strategies to better control this vector.

Share and Cite:

Tokponnon, T. , Zoulkifilou, S. , Kotannou, E. , Kouagou, O. , Houmenou, D. , Ahouandjinou, M. , Towakinou, L. , Agassounon, B. , Festus, H. , Idayath, G. , Agbo-Ola, A. , Sagbohan, H. , Sidick, A. , Padonou, G. , Ossè, R. , Baba-Moussa, L. and Akogbeto, M. (2025) Resistance Profile Confirming the Presence of Three Knock-Down Mutations: S989P, V1016G and F1534C in Aedes aegypti in the Arrondissements of Abomey-Calavi and Ouedo in Benin. Journal of Biomedical Science and Engineering, 18, 288-300. doi: 10.4236/jbise.2025.187021.

1. Introduction

Vector-borne diseases are increasingly affecting populations, accounting for 17% of all infectious diseases. Among disease vectors, mosquitoes are the most formidable [1] and are mostly found in sub-Saharan Africa. Arboviruses are among these infectious diseases, causing 40,000 deaths worldwide every year. Yellow fever, dengue virus and Zika virus are arboviruses whose vector is Aedes, and whose disease burden is a source of major concern [1]. Between 2010 and 2019, cases of dengue fever were diagnosed in Benin, resulting in at least one death in the commune of Abomey-Calavi [2]. In the absence of effective vaccines or drugs, control relies mainly on vector control [3] through the use of chemical insecticides. Insecticides play a major role in mosquito control, and synthetic pyrethroids are the chemicals of choice because of their rapid and effective activity against insects, their low toxicity to mammals and their degradability in the environment [4, 5]. The WHO recommends the use of pyrethroids against adult mosquitoes and larvicides. Unfortunately, long-term intensive use of insecticides leads to the emergence of resistance in mosquito species under selection pressure, and this is one of the main obstacles to arthropod pest control [6, 7]. Many control programs are threatened by insecticide resistance. Aedes aegypti has been reported to be resistant to pyrethroids and organophosphates in various parts of the world, while little data is available on insecticide resistance in A. aegypti in Benin. The few studies that have been carried out show a decrease in the sensitivity of A. aegypti to a wide variety of active ingredients [8-10]. Two main mechanisms are involved in insecticide resistance in insects: secretion of detoxification enzymes and insensitivity of target sites [11]. The first mechanism involves overexpression or qualitative changes in the catalytic sites of enzymes such as non-specific esterases (NES), glutathione S-transferases (GST) and mixed-function oxidases (MFO). The importance of detoxification enzymes in Aedes resistance to different classes of insecticides has been reported in several previous studies in different parts of the world [12-14]. Target insensitivity is due to mutations that reduce the binding affinity between the insecticide and its physiological target. Pyrethroids and DDT directly target the sodium channel to cause nerve membrane depolarization [15] and insects develop resistance to these types of insecticides by substitution of one or more amino acids in the channel sequence [16]. These mutations in the sodium channel are known as “resistance knockdown” (kdr) and have been reported in A. aegypti in several African countries, including Benin, Ghana, Burkina Faso, Nigeria and Angola [8, 17].

In Benin, most data on insecticide sensitivity concern malaria vectors, and very little is known about Aedes. The lack of data on their sensitivity to insecticides used in public health is a growing obstacle for arbovirosis control programs. We assessed the susceptibility of A. aegypti adults to insecticides and the mechanisms involved in four localities in the Abomey-Calavi district, in order to select the best insecticides to use in the event of an epidemic.

2. Materials and methods

2.1. Study Sites

The present study is a descriptive study that took place in the Ouèdo arrondissement from February 2022 to July 2022 and in Abomey-Calavi, more precisely in Tokpa-Zoungo from July to October 2022, then in Zoundja and Zoca from July to October 2023. Figure 1 shows the positions of the sites where the traps were set.

Figure 1. Trap positions at study sites.

2.2. Aedes Egg Collection and Adult Rearing at the Insectarium

The eggs were collected using Aedes ovitraps, due to the scarcity of Aedes mosquito breeding sites. We therefore used a total of 40 traps in each of the localities of Zoundja and Zoca during this collection period. In Ouèdo, a total of 96 traps were used, followed by 20 traps in Tokpa-Zoungo. These are black plastic pots that can hold half a liter of water, in which wooden egg-laying supports were immersed. The wooden egg-laying supports were removed from each pot after a week and transported to CREC. The water contained in the pots was received and transported to the CREC insectarium. Once at the Vector Bioecology Laboratory, eggs were counted using a binocular microscope and hatched according to standard insectary rearing procedures for Aedes species. Larval hatching rate was measured by visually counting the number of larvae per tray using a ladle. Adult emergence rate was measured using an aspirator.

2.3. Insecticide Sensitivity Tests

The insecticide resistance profile of Aedes populations in the field was assessed using the WHO tube method [18]. Given the number of Aedes adults available, Aedes females aged 2 - 5 days were exposed to diagnostic doses of Permethrin 0.75%; Deltamethrin 0.05%; Alphacypermethrin 0.05% and Cyfluthrin 0.15%. For each insecticide, four exposure tubes containing insecticide-impregnated papers and one control tube with untreated paper were used. 20 - 25 female Aedes mosquitoes were introduced into each tube, and the number of mosquitoes knocked down by the insecticide was counted every 15 min. After 60 min of exposure, the mosquitoes were transferred to tubes containing untreated paper, placed under observation (25˚C and 80% humidity) and fed on 10% honey juice. Mortality after 24 hours was recorded following WHO guidelines, with individuals considered dead if they were immobile or unable to stand upright.

2.4. Morphological Identification of Aedes

Adult Aedes spp. were identified using Fontenille’s taxonomic keys [19] by microscopic visualization. A. aegypti and Ae. albopictus can be recognized by their characteristic white stripes on the legs. The thorax is then used to differentiate the two species. A. aegypti has two thin white median lines in the shape of a lyre, while Ae. albopictus has white median lines. Ae. albopictus has only one distinct white central line.

2.5. Genotyping for kdr Mutations

After grinding each mosquito in 200 μl of 2% CTAB, we then place in a Bain-Marie at 65˚C for 05 minutes. Then 200 μL of chloroform is added and centrifuged at 12,000 rpm for 05 minutes at room temperature after mixing by inversion at least 10 times. The supernatant collected in well-labeled tubes is mixed by inversion with 200 μl of isopropanol and centrifuged at 12,000 rpm at room temperature for 10 minutes. The isopropanol is drained off and centrifuged for 05 minutes at 12,000 rpm after adding 200 μl of 70% ethanol. After emptying the ethanol, the resulting DNA pellet is dried for 05 minutes in a speed-vac or for half a day on the bench. 40 μl of sterile H2O is added to the DNA pellets in each tube, which are then left on the bench overnight or for half a day.

For Kdr genotyping, a random subset of both dead and alive mosquitoes from the WHO susceptibility bioassays was selected. This sampling strategy was applied to reduce selection bias and allow accurate estimation of allele frequencies. Allele-specific PCR (AS-PCR) was used to detect the presence of the S989P, V1016G and F1534C mutations according to the protocol of Li et al. 2015 [20]. Each mosquito was tested by AS-PCR twice, the first PCR used a primer specific for the susceptible and the second a primer specific for the mutant. The primers used for the genotyping were the following:

S989PF: 5’AATGATATTAACAAAATTGCGC3’ and S989PR: 5’GCACGCCTCTAATATTGATGC; V1016GF: 5’GCCACCGTAGTGATAGGAAATC3’ and V1016GValR: 5’CGGGTTAAGTTTCG TTTAGTAGC3’; and F1534CF: 5’GGAGAACTACACGTGGGAGAAC3’ and F1534CR: 5’CGCCACTGAAATTGAGAATAGC3’.

2.6. Measurement of Detoxification Enzyme Activity

To quantify the activity of detoxification enzymes, biochemical tests were carried out only on 3- to 5-day-old female Aedes mosquitoes from Zoundja and Zoca not exposed to insecticides.

All mosquitoes were stored at −80˚C to avoid degradation of the enzymes prior to manipulation. All manipulations were carried out on ice. Mosquitoes were individually ground in 200 µl of distilled water. Grindings were centrifuged at 14,000 rpm for 2 minutes. For oxidases, 20 µl of the grindings were distributed in two wells of a microplate, and 10 µl in two replicates for the other enzymes. All plates must have two wells filled with 10 µl for background.

For oxidases, 80 µl of 0.0625M Potassium Phosphate buffer (KHPO4) pH 7.2 was added to the 20 µl of shred and standard ranges in ascending order of concentration. Next, 200 µl of solution (composed of 12 mg of 3,3,5,5-tetra methyl Benzidine or TMBZ previously dissolved in 5 ml methanol and 18 ml of 0.25M Sodium Acetate Buffer pH 5.0) was added to the same replicates. After adding 25 µl of 3% hydrogen peroxide to each well, the plate was incubated for thirty minutes and the absorbance was read as an end point at 630 nm.

For non-specific esterases, 90 µl of 1% TBS (Triton Phosphate Saline) buffer was added to the 10 μl of shredded material from each mosquito and the standard ranges in ascending order of concentration. The plate was then incubated at room temperature for 10 minutes; after this, 100 μl of a solution (600 µl alpha-naphthyl acetate or beta-naphthyl acetate + 3 ml 1% Triton PBS buffer pH 6.5 + 6 ml H2O) was added to each well and the plate was again incubated at room temperature for 30 minutes. Finally, we added 100 µl of a solution (10 mg Fast Garnett Salt dissolved in 12 ml distilled water) to each replicate and the plate was then incubated at room temperature with a lid on for 10 minutes. End-point absorbance was read on a spectrophotometer at 550 nm.

For total proteins, we added two 10 µl replicates of each mosquito grind to the plate and standard ranges in ascending order of concentration. Next, we added 200 µl of a solution (composed of 19.6 µl of Bicinchoninic Acid Solution and 380 µl of Copper Sulfate). End-point absorbance was read at 590 nm after holding the plate for 30 minutes at room temperature.

For glutathione-S-transferases, two 10 µl replicates of the crushed material were added to the plate. We then added 200 µl of a solution (composed of 20 ml 0.1M Sodium Phosphate buffer pH 6.5, 60 mg glutathione in reduced form (GSH), and 13 mg CDNB (-chloro-2,4-dinitrobenzene) all previously and fully dissolved in 500 µl methanol, respectively. Absorbance was read kinetically at 340 nm for 5 minutes.

3. Data analysis

GPS coordinates of laying traps were recorded using the OSMTracker for AndroidTM application. Insecticide susceptibility test results were recorded and analyzed using Microsoft Excel 2019. Biochemical data were recorded through a computer connected to the microplate reader. Transformations from absorbance values to product quantity (µmol/min/mg protein) were automatically performed using GeneS.1 software, provided with the spectrophotometer. Statistical analyses were conducted using GraphPad Prism 5 software (version 5.00, San Diego, CA, USA). The Mann-Whitney test was chosen for comparison between Rockefeller (susceptible strain), and field mosquitoes. Statistical significance was determined if p < 0.05. All statistical analyses were performed in Stata/SE 17.0, including Pearson’s chisquare test to investigate deviations from Hardy-Weinberg equilibrium.

4. Results

4.1. Attractiveness of Aedes Traps

In this study, 196 traps were used, of which 159 were positive (Aedes females laid eggs in them) and 37 negatives, giving a positivity rate of 81% (Table 1). The total number of eggs obtained after collection was 8846.

Table 1. Trap-ponder positivity ratein the study areas.

Status of traps

Zoundja

Zoca

Tokpa zoungo

Ouedo

Total

Positive trap

35 (88%)

33 (83%)

09 (45%)

82 (85%)

159 (81%)

Negative trap

05 (12%)

07 (17%)

11 (55%)

14 (15%)

37 (19%)

Total

40 (100%)

40 (100%)

20 (100%)

96 (100 %)

196 (100%)

4.2. Hatching and Emergence Rates

After counting the eggs, we obtained a total of 6561 eggs for all the positive. After watering, hatching rates were 89% in Abomey-Calavi and 46% in Ouèdo. At the end, the rate of mosquitoes emerging was 50% in Abomey-Calavi and 43% in Ouèdo, as shown in Table 2.

Table 2. Hatching and emergence rates.

Abomey-Calavi district

Locations

Zoundja

Zoca

Tokpa-zoungo

Ouèdo

Number of eggs

1015

954

269

4323

Number of larvae

960 (95%)

847 (89%)

180 (67%)

1998 (46 %)

Number of adults

453 (47%)

432 (51%)

110 (61%)

867 (43%)

4.3. Aedes Insecticide Test

Table 3 shows the results of 24-hour sensitivity testing of mosquitoes to insecticides. Analysis shows that Aedes strains from Ouèdo were 100% sensitive to permethrin, deltamethrin, alphacypermethrin and cyfluthrin within 24 hours. On the other hand, high resistance to deltamethrin and permethrin was observed in the Aedes populations of Zoundja, Zoca and Tokpa-zoungo, respectively.

Table 3. Results of mosquito sensitivity tests to insecticides.

Insecticides

Study site

Number of mosquitoes tested

Number of mosquitoes survived at 24 h

Number of mosquitoes dead at 24 hours

Mortality rate in 24 h

Status

Permethrin

Ouèdo

86

00

86

100%

S

Tokpa-

Zoungo

100

55

45

45%

R

Deltamethrin

Ouèdo

85

00

85

100%

S

Zoundja

86

09

77

89.53%

R

Zoca

81

13

68

83.95%

R

Alphacypermethrin

Ouèdo

87

00

87

100%

S

Cyfluthrin

Ouèdo

89

00

89

100%

S

Legend: S: Susceptible; R: Resistant.

4.4. Mosquito Identification

Following identification, the predominant species in the Abomey-Calavi and Ouèdo districts is Aedes aegypti, with a total of 1857 (99.73%), compared with 5 (less than 1%) for Aedes albopictus.

4.5. Identification of kdr Mutations

At the end of migration, the size of DNA fragments was visualized using ultraviolet light, by comparing the different bands obtained with the molecular weight marker. The size of PCR products for the detection of kdr mutations was 240 bp for (S989P), 284 bp for (F1534C), 348 bp (V1016G), while the size of products used as non-allele-specific external primers was 594 bp (S989P), 517 bp (F1534C), 592 bp (V1016G) (Figure 2).

Figure 2. Gel electrophoresis bands of PCR products corresponding to kdr mutations. Image: A. Kotannou, 2023.

PCR was able to effectively distinguish between individual mosquitoes homozygous or heterozygous for the S989P, F1534C and V1016G mutations. The number of mosquitoes per genotype for the various mutations is summarized in Table IV below. Mutation frequency was calculated using the following formula [20] (Table 4):

Fréquence (kdr) = 2RR+RS 2( RR+RS+SS ) ×100

Table 4. Frequency of kdr mutations.

kdr Mutation

Study Site

Mosquitoes Tested

Homozygote Mutation (RR)

Heterozygote Mutation (RS)

Homozygote Wild Type (SS)

Allele Frequency

R

S

S989P

Zoundja

14

06

06

02

0.64

0.36

Zoca

09

04

03

02

0.61

0.39

Tokpa-zoungo

46

00

01

45

0.01

0.99

Ouèdo

46

00

07

39

0.08

0.92

F1534C

Zoundja

32

10

16

06

0.56

0.44

Zoca

36

14

15

07

0.60

0.40

Tokpa-zoungo

38

23

07

08

0.70

0.30

Ouèdo

46

04

00

42

0.09

0.91

V1016G

Zoundja

28

05

11

12

0.38

0.62

Zoca

31

10

08

13

0.45

0.55

Tokpa-zoungo

45

04

02

39

0.11

0.89

Ouèdo

46

00

00

46

00

1

4.6. Expression of Detoxification Enzymes

The Aedes mosquitoes analyzed showed significantly higher median levels of oxidases (p > 0.0001 at Zoundja and p = 0.0002 at Zoca) and glutathione s-transferases (GSTs) (p = 0.0015 at Zoundja and p = 0.0055 at Zoca) compared to the insecticide-sensitive Rockefeller reference strain. On the other hand, no significant difference was observed between the median levels of non-specific esterases (p ˂ 0.05 in each study area) of the tested strain and those of the sensitive Rockefeller strain (Figures 3-5).

Figure 3. Expression of oxidases in Aedes mosquitoes at Zoundja and Zoca in the Abomey-Calavi commune.

Figure 4. Expression of non-specific esterases (α-esterase on the left and β-esterase on the right) in Aedes mosquitoes at Zoundja and Zoca in the commune of Abomey-Calavi.

Figure 5. GSTs expression in Aedes mosquitoes at Zoundja and Zoca in the commune of Abomey-Calavi.

5. Discussion

Insecticide resistance in arbovirus vectors is a major challenge in vector control. This study provides information on the current status of insecticide resistance, the presence of kdr F1534C, S989P and V1016G mutations and the expression of detoxification enzymes in Aedes populations in the Ouèdo arrondissement and three localities in the Abomey-Calavi arrondissement. The study revealed that the positivity of ovitraps was 85% in Ouèdo and 77% in Abomey-Calavi, testifying to the effectiveness of this method. This result shows that ovitraps are more attractive to gravid females and facilitate Aedes sampling. This confirms the results of previous studies, which reported that, in many epidemics, ovitraps showed positivity for the presence of both A. aegypti and Ae. albopictus [21, 22]. The low hatching rate of 46% observed in Ouèdo, on the other hand, may be due to the high proportion of unfertilized eggs, but also to the fact that the egg-laying trays were not left in the water long enough for all the eggs to hatch. As for the emergence rate, this is due to the density of the larval population. Larval population density increases larval mortality and lengthens larval development time, according to Pichon and Gayral in 1970 in three West African savannah villages (Dougoumato, Kongolekan and Koumbia) [23]. Sensitivity to permethrin, deltamethrin, alpha-cypermethrin and cyfluthrin was observed in the Aedes population of Ouèdo. These results also confirm those observed in Hêvié by Padonou et al. in 2020 [2], a neighbouring locality to Ouèdo, where a sensitivity of 100% to deltamethrin was observed. If, despite public health interventions in this locality, Aedes remains sensitive to insecticides, we can therefore affirm that insecticide resistance in vectors is due to agricultural practices.

On the other hand, resistance to deltamethrin and permethrin was observed in the Aedes population in the localities of Tokpa-zoungo, Zoundja and Zoca in the Abomey-Calavi arrondissement. Our results concur with those of Tokponnon et al., 2024 [8] carried out in Cotonou and Abomey-Calavi and in Burkina-Faso by Sombié et al., 2019 [24]. The reasons for these trends are not known, but a number of events may have contributed to them. This resistance to deltamethrin and permethrin is thought to be due to the unregulated use of insecticides for agricultural, domestic and public health purposes [25, 26].

After identification, Aedes aegypti and Aedes albopictus were the two Aedes species found in the Abomey-Calavi district. Aedes aegypti was in the majority, with a percentage of 99.73% (1857 Aedes aegypti and 5 Aedes albopictus). These results are close to those recorded in Hêvié in 2020 by Padonou et al. [2]. The abundance of Aedes aegypti in this locality is due to the poor storage of water in pots, buckets, used tires and domestic containers inside and outside houses as a result of livestock farming. In fact, water used as a beverage for domestic animals remains stored for a long time in buckets, pots and other containers. Worn tires left by mechanics and extension workers are stacked one on top of the other, providing shelter for Aedes when it rains. This facilitates the proliferation of Aedes aegypti. There is a need to raise awareness among the local population of the need to change habits to avoid storing wastewater in households.

PCR genotyping revealed the presence of mutations S989P, F1534C and V1016G among the deltamethrin- and permethrin-resistant Aedes population. These mutations were first detected in Benin in 2024 by Tokponnon et al. [8]. The F1534C mutation has been described as widely distributed worldwide and associated with Aedes resistance to pyrethroids. The S869P mutation is thought to cause more potent resistance to insecticides when combined with V1016G or F1534C or both [27]. We detected the simultaneous presence of two mutations in 23 resistant Aedes, and all three mutations in 06 resistant Aedes. The co-occurrence of two or three kdr mutations has been reported in several countries, in Benin by Tokponnon et al. [8], in China by Li et al. [20], in Nigeria by Agbohun et al. [28] and in Malaysia by Zuharah et al. [29], and results in a higher level of resistance.

With regard to detoxification enzymes, we observed under-expression of esterases (α and β) and over-expression of GSTs and oxidases. Our results corroborate those reported by Konkon et al. [9] in Benin in 2023 and by Ngoagouni et al. [13] in the Central African Republic in 2016. On the other hand, in Saudi Arabia, Algamdi et al. [30] found a significant decrease in the activity of these enzymes. The metabolic mechanisms in which GSTs and oxidases are involved could confer the resistance to deltamethrin observed in Aedes. All comparisons were made with the insecticide-sensitive Rockefeller control strain. In addition, the insecticide resistance mechanisms observed in Aedes populations are characterized by the presence of all three mutations and the overexpression of GST and oxidases.

6. Conclusion

This study revealed a high sensitivity of Aedes aegypti to permethrin, deltamethrin, alphacypermethrin and cyfluthrin in Ouèdo, and high resistance to permethrin and deltamethrin in Zoundja, Zoca and Tokpa-zoungo. We also noted the presence of Aedes albopictus, an invasive mosquito in the Abomey-Calavi district of southern Benin. Mechanisms associated with this resistance included kdr F1534C, S989P and V1016G mutations and the expression of detoxification enzymes. Insecticide resistance can threaten the effectiveness of vector-borne disease control. The worldwide spread of deltamethrin resistance in Aedes mosquitoes and the overexpression of glutathione s-transferases and oxidases underscore the urgent need for additional monitoring studies. In this context, it is therefore necessary to understand which alternative insecticides would be most effective in controlling Aedes and how the resistance that has been detected can be effectively managed.

Author Contributions

Conceptualization: T.F.T., Z.S.D., E.A.K.,O.K., D.G.H., and M.A.; data collection: T.F.T., Z.S.D., E.A.K., O.K., D.G.H., B.G, H.F., G.I., A.O., H.S; formal analysis: T.F.T., Z.S.D., E.A.K.,O.K., D.G.H., M.J.A., L.T., and R.O.; mobilization of funding: T.F.T., Z.S.D., E.A.K., O.K., D.G.H. and R.O.; methodology: T.F.T., R.O., and M.A.; project administration: T.F.T.; original draft preparation formal: T.F.T., Z.S.D., E.A.K., O.K., D.G.H. and M.A., supervision: T.F.T., L.B.M., and M.A. All authors have read and agreed to the published version of the manuscript.

Funding

This work was partially supported by researchers from the Centre de Recherche Entomologique de Cotonou. Permission was requested and obtained before setting up the Aedes oviposition traps. All individuals mentioned in this section provided their consent for acknowledgment.

Acknowledgements

The observations and conclusions presented in this manuscript reflect only the opinion of the author(s). We express our gratitude to the Director of the Centre for Entomological Research of Cotonou, Mr. Germain Gil Padonou, and to his entire team, both in the field and in the laboratory, for their valuable support.

Data Availability Statement

All data used in this study are included within the article.

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

References

[1] WHO (2024) Dengue and severe dengue.
https://www.who.int/fr/news-room/fact-sheets/detail/dengue-and-severe-dengue
[2] Padonou, G.G., Ossè, R., Salako, A.S., Aikpon, R., Sovi, A., Kpanou, C., et al. (2020) Entomological Assessment of the Risk of Dengue Outbreak in Abomey-Calavi Commune, Benin. Tropical Medicine and Health, 48, Article No. 20.[CrossRef] [PubMed]
[3] Rohaizat Hassan, M., Atika Azit, N., Mohd Fadzil, S., Abd Ghani, S.R., Ahmad, N. and Mohammed Nawi, A. (2021) Insecticide Resistance of Dengue Vectors in South East Asia: A Systematic Review. African Health Sciences, 21, 1124-1140.[CrossRef] [PubMed]
[4] Chuaycharoensuk, T., Juntarajumnong, W., Boonyuan, W., Bangs, M.J., Akratanakul, P., Thammapalo, S., et al. (2011) Frequency of Pyrethroid Resistance in Aedes aegypti and Aedes albopictus (Diptera: Culicidae) in Thailand. Journal of Vector Ecology, 36, 204-212.[CrossRef] [PubMed]
[5] Nkya, T.E., Akhouayri, I., Kisinza, W. and David, J. (2013) Impact of Environment on Mosquito Response to Pyrethroid Insecticides: Facts, Evidences and Prospects. Insect Biochemistry and Molecular Biology, 43, 407-416.[CrossRef] [PubMed]
[6] Hemingway, J., Hawkes, N.J., McCarroll, L. and Ranson, H. (2004) The Molecular Basis of Insecticide Resistance in Mosquitoes. Insect Biochemistry and Molecular Biology, 34, 653-665.[CrossRef] [PubMed]
[7] Yadouleton, A., Martin, T., Padonou, G., Chandre, F., Asidi, A., Djogbenou, L., et al. (2011) Cotton Pest Management Practices and the Selection of Pyrethroid Resistance in Anopheles gambiae Population in Northern Benin. Parasites & Vectors, 4, Article No. 60.[CrossRef] [PubMed]
[8] Tokponnon, T.F., Ossè, R., Zoulkifilou, S.D., Amos, G., Festus, H., Idayath, G., et al. (2024) Insecticide Resistance in Aedes aegypti Mosquitoes: Possible Detection of KDR F1534C, S989P, and V1016G Triple Mutation in Benin, West Africa. Insects, 15, Article 295.[CrossRef] [PubMed]
[9] Konkon, A.K., Padonou, G.G., Osse, R., Salako, A.S., Zoungbédji, D.M., Sina, H., et al. (2023) Insecticide Resistance Status of Aedes aegypti and Aedes albopictus Mosquitoes in Southern Benin, West Africa. Tropical Medicine and Health, 51, Article No. 22.[CrossRef] [PubMed]
[10] Padonou, G.G., Konkon, A.K., Salako, A.S., Zoungbédji, D.M., Ossè, R., Sovi, A., et al. (2023) Distribution and Abundance of Aedes aegypti and Aedes albopictus (Diptera: Culicidae) in Benin, West Africa. Tropical Medicine and Infectious Disease, 8, Article 439.[CrossRef] [PubMed]
[11] Labbé, P., Alout, H., Djogbénou, L., Pasteur, N. and Weill, M. (2011) Evolution of Resistance to Insecticide in Disease Vectors. In: Tibayrenc, M., Ed., Genetics and Evolution of Infectious Disease, Elsevier, 363-409.[CrossRef]
[12] Mukhtar, M.M. and Ibrahim, S.S. (2022) Temporal Evaluation of Insecticide Resistance in Populations of the Major Arboviral Vector Aedes aegypti from Northern Nigeria. Insects, 13, Article 187.[CrossRef] [PubMed]
[13] Ngoagouni, C., Kamgang, B., Brengues, C., Yahouedo, G., Paupy, C., Nakouné, E., et al. (2016) Susceptibility Profile and Metabolic Mechanisms Involved in Aedes aegypti and Aedes albopictus Resistant to DDT and Deltamethrin in the Central African Republic. Parasites & Vectors, 9, Article No. 599.[CrossRef] [PubMed]
[14] Wang, L., Fontaine, A., Gaborit, P., Guidez, A., Issaly, J., Girod, R., et al. (2022) Interactions between Vector Competence to Chikungunya Virus and Resistance to Deltamethrin in Aedes aegypti Laboratory Lines? Medical and Veterinary Entomology, 36, 486-495.[CrossRef] [PubMed]
[15] Davies, T.G.E., Field, L.M., Usherwood, P.N.R. and Williamson, M.S. (2007) DDT, Pyrethrins, Pyrethroids and Insect Sodium Channels. IUBMB Life, 59, 151-162.[CrossRef] [PubMed]
[16] Marcombe, S., Darriet, F., Tolosa, M., Agnew, P., Duchon, S., Etienne, M., et al. (2011) Pyrethroid Resistance Reduces the Efficacy of Space Sprays for Dengue Control on the Island of Martinique (Caribbean). PLOS Neglected Tropical Diseases, 5, e1202. [Google Scholar] [CrossRef] [PubMed]
[17] Kawada, H., Higa, Y., Futami, K., Muranami, Y., Kawashima, E., Osei, J.H.N., et al. (2016) Discovery of Point Mutations in the Voltage-Gated Sodium Channel from African Aedes aegypti Populations: Potential Phylogenetic Reasons for Gene Introgression. PLOS Neglected Tropical Diseases, 10, e0004780.[CrossRef] [PubMed]
[18] WHO (2016) Test Procedures for Insecticide Resistance Monitoring in Malaria Vector Mosquitoes. 2nd Edition, World Health Organization.
https://apps.who.int/iris/handle/10665/250677
[19] Fontenille, D., Traore-Lamizana, M., Diallo, M., Thonnon, J., Digoutte, J.P. and Zeller, H.G. (1998) New Vectors of Rift Valley Fever in West Africa. Emerging Infectious Diseases, 4, 289-293.[CrossRef] [PubMed]
[20] Li, C., Kaufman, P.E., Xue, R., Zhao, M., Wang, G., Yan, T., et al. (2015) Relationship between Insecticide Resistance and KDR Mutations in the Dengue Vector Aedes aegypti in Southern China. Parasites & Vectors, 8, Article No. 325.[CrossRef] [PubMed]
[21] Pichon, G. and Gayral, P. (1970) Population Dynamics of Aedes aegypti in three West African Savanna villages: Seasonal Fluctuations and Epidemiological Incidence. Cahier ORSTOM, Série Entomologie Médicale et Parasitologie, 8, 49-68.
https://www.documentation.ird.fr/hor/fdi:18897
[22] Okoye, C.F., Onyido, A.E. and Chikwendu, J.I. (2023) Abundance of Mosquito Vectors of Human Diseases at the AWKA Campus of Nnamdi Azikiwe University, Awka Anambra State Nigeria. Microbes and Infection, 4, 259-267.
[23] Nascimento, K.L.C., Silva, J.F.M.d., Zequi, J.A.C. and Lopes, J. (2020) Comparison between Larval Survey Index and Positive Ovitrap Index in the Evaluation of Populations of Aedes (Stegomyia) Aegypti (Linnaeus, 1762) North of Paraná, Brazil. Environmental Health Insights, 14, 1-8.[CrossRef] [PubMed]
[24] Sombié, A., Saiki, E., Yaméogo, F., Sakurai, T., Shirozu, T., Fukumoto, S., et al. (2019) High Frequencies of F1534C and V1016I KDR Mutations and Association with Pyrethroid Resistance in Aedes aegypti from Somgandé (Ouagadougou), Burkina Faso. Tropical Medicine and Health, 47, Article No. 2.[CrossRef] [PubMed]
[25] Awolola, T.S., Oduola, A.O., Oyewole, I.O., Obansa, J.B., Amajoh, C.N., Koekemoer, L.L. and Coetzee, M. (2007) Dynamics of Knockdown Pyrethroid Insecticide Resistance Alleles in a Field Population of Anopheles gambiae s.s. in Southwestern Nigeria. Journal of Vector Borne Diseases, 44, 181-188.
[26] Yadouleton, A.W., Padonou, G., Asidi, A., Moiroux, N., Bio-Banganna, S., Corbel, V., et al. (2010) Insecticide Resistance Status in Anopheles gambiae in Southern Benin. Malaria Journal, 9, Article No. 83.[CrossRef] [PubMed]
[27] Moyes, C.L., Vontas, J., Martins, A.J., Ng, L.C., Koou, S.Y., Dusfour, I., et al. (2017) Contemporary Status of Insecticide Resistance in the Major Aedes Vectors of Arboviruses Infecting Humans. PLOS Neglected Tropical Diseases, 11, e0005625.[CrossRef] [PubMed]
[28] Agbohun, I.K., Idowu, E.T., Oyeniyi, T.A., Adeogun, A.O., Adesalu, K., Nwanya, O., Okonkwo, F., Oladosu, Y. and Otubanjo, O. (2021) First Detection and Co-Occurrence of KDR (F1534C and S989P) Mutations in Multiple Insecticide Resistant Aedes aegypti in Nigeria.[CrossRef]
[29] Zuharah, W.F. and Sufian, M. (2021) The Discovery of a Novel Knockdown Resistance (KDR) Mutation A1007G on Aedes aegypti (Diptera: Culicidae) from Malaysia. Scientific Reports, 11, Article No. 5180.[CrossRef] [PubMed]
[30] Algamdi, A.G. and Mahyoub, J.A. (2022) Detection of Insecticide Detoxification Enzymes Activities in Aedes aegypti Mosquito, the Vector of Dengue Fever in Saudi Arabia. Main Group Chemistry, 21, 1053-1063.[CrossRef]

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.