Microbial Quality and Molecular Identification of Enterotoxigenic Staphylococcus Strains Isolated from Dried, Smoked, and Braised Fish Sold in Ouagadougou Markets

Abstract

Background: The investigation of toxin genes in strains involved in staphylococcal food poisoning contributes to food safety. The aim of this study was to isolate and identify enterotoxigenic Staphylococcus strains from dried, smoked, and braised fish sold in Ouagadougou markets. Methodology: Staphylococci were isolated using standard microbiology methods. Staphylococcus strains were identified using API Staph kit (Reference # 20500, BioMerieux S.A., Marcy l'Etoile, France). The molecular identification of isolated Staphylococcus aureus strains was specifically confirmed by PCR using the Staur4 and Staur6 primers. The genes encoding enterotoxins, enterotoxin-like toxins, exfoliative toxins, and TSST-1 toxin were detected by multiplex PCR using specific primers from Inquaba Biotec West Africa Ltd, Africa's Genomics Company. Results: The results of the microbiological quality assessment indicated that most of the samples analyzed were found to be of unsatisfactory microbiological quality according to the Staphylococcus aureus microbiological criteria (m = 102). Overall, only 12.55% of samples were satisfactory, while 97.45% were unsatisfactory. The STAPH API gallery allowed the identification of the following species: Staphylococcus aureus, Staphylococcus xylosus, Staphylococcus lugdunensis, Staphylococcus hominis, Staphylococcus haemolyticus, Staphylococcus lentus, Staphylococcus sciuri and Staphylococcus capitis. Of the 108 Staphylococcus isolates, 81 (75%) showed at least one (1) toxin gene. Among the 21 toxin genes tested in this study, 20 genes were detected in all strains analyzed. The staphylococcal toxin genes detected were present in both Staphylococcus aureus and the other coagulase-negative strains isolated in this study. In addition, these genes are found individually or in association in certain strains. The most frequent genes detected in toxin gene-positive strains were: the tsst-1 gene in 45 isolated strains (41.7%), sei (16/14.8%), seg (13/12%), ser (7/6.5%) sec (6/5.5%), and sea (5/4.6%) for staphylococcal enterotoxins, seln (14/12.9%), selq (8/7.4%), for enterotoxin-like toxin gene and eta (3/2.7%) for exfoliative toxin genes. Conclusion: This study highlighted the pathogenicity of Staphylococcus strains isolated from dried, smoked, and braised fish sold in Ouagadougou markets. Monitoring toxin-producing strains of Staphylococcus is invaluable for better prevention of food poisoning.

Share and Cite:

Ouédraogo, A. , Ouédraogo, G. , Ouédraogo, H. , Tchoumbougnang, F. , Zongo, C. and Savadogo, A. (2024) Microbial Quality and Molecular Identification of Enterotoxigenic Staphylococcus Strains Isolated from Dried, Smoked, and Braised Fish Sold in Ouagadougou Markets. Advances in Microbiology, 14, 59-76. doi: 10.4236/aim.2024.141005.

1. Introduction

Fish is one of the fishery products of interest in the human diet as a source of essential nutrients and micronutrients for healthy and varied diets [1] . Given its perishable nature, fish is often smoked, dried, or salted [2] [3] [4] . These techniques improve fish stability and extend its shelf life [5] [6] . Despite these processes, fish can spoil or be contaminated by pathogenic microorganisms if proper storage and sale conditions are not ensured.

Food safety is a major concern worldwide. Staphylococcal food poisoning (SPF) is one of the major public health problems [7] [8] . These foodborne illnesses can be caused by the ingestion of food contaminated with pathogens (viruses, parasites, and bacteria) [9] , or by toxins [10] [11] . Staphylococcus aureus is one of the most common pathogens involved both in infection and intoxication through fish and certain seafood products [12] . Drying and smoking reduce the activity of S. aureus in dried fish, thus slowing down spoilage [13] [14] [15] . However, these techniques do not eliminate the bacterium, which is still capable of surviving and producing toxins [16] . S. aureus is often detected in dried, smoked and braised fish at high loads [17] . This is sometimes due to contamination during sale carried out in improper packaging, storage or display conditions [16] . The pathogenicity of the bacteria is based on its ability to cause infection or produce toxins after ingestion of contaminated food.

Food can be contaminated by hand contact or by the airway secretions of food handlers who carry enterotoxin-producing S. aureus in their hands during preparation and processing. Air, dust, and food contact surfaces are also potential pathways for the transfer of S. aureus into food.

S. aureus is able to grow over a wide range of temperatures, pH, and high sodium chloride concentrations (up to 15% NaCl), as well as at low water activity levels (0.86 water activity) [18] . Mood et al. [16] reported that S. aureus grows better at 10˚C than at 25˚C and 30˚C. These characteristics enable the bacteria to grow in a wide variety of foods. Some strains of Staphylococcus (enterotoxigenic strains) are also able to produce staphylococcal enterotoxins (SEs), responsible for staphylococcal food poisoning (SPF).

These toxins are classified into several serotypes, consisting of superantigens (SAgs) that cause typical food poisoning symptoms such as vomiting and diarrhea, and other staphylococcal superantigens (staphylococcal superantigen-like SSL) without emetic properties. There are more than 23 serotypes of staphylococcal SAgs toxins described, in particular the toxic shock syndrome toxin (TSST-1), staphylococcal enterotoxins (classic: SEA to SEE, new: SEG to SEJ, SEL to SEQ and SER to SET) [19] , and staphylococcal superantigen-like (SEIK to SEIQ, SEIU to SEIX). Among these identified staphylococcal enterotoxins (SE), SEA is highly thermostable, and the most frequent cause of staphylococcal food poisoning worldwide [20] . Staphylococcal enterotoxins are classified as bacterial superantigens (SAgs). The action mechanism of these superantigens consists of binding MHC class II of antigen presenting cell receptors to T cells. This lead to the activation of T cell. SAgs stimulate helper T cells to produce cytokins such as interleukins (IL), gamma interferon, and tumor necrosis factor [21] . Among cytokines produced, IL-2 is responsible for many of the symptoms of staphylococcal gastroenteritis.

Given their low molecular weight, staphylococcal toxins are resistant to heat treatment and proteolytic enzyme activity and are active in small quantities (20 ng). Therefore, the occurrence of Staphylococcus poses a threat to food safety and wholesomeness. Consequently, the investigation of food samples, particularly fish, for the presence of these pathogens is important for the development and implementation of preventive measures and programs to ensure food safety.

The aim of this study was to isolate and identify strains of enterotoxigenic Staphylococcus species from dried, smoked, and braised fish sold in Ouagadougou markets.

2. Material and Methods

2.1. Enumeration and Isolation of Pathogenic Staphylococcus

Staphylococci were detected and isolated on Mannitol Salt Agar (ISO 6888; 2003). A 0.1 ml volume of two successive dilutions was used to spread on the surface of the agar poured into Petri dishes, and incubated at 37˚C for 24 hours. After incubation, all Staphylococci were enumerated according to AFNOR ISO 7218 (2007). Based on their ability to ferment mannitol or not, Staphylococci can be differentiated. Mannitol fermentation induces acidification, leading to a yellow coloration of the medium in the presence of phenol red (pH indicator). The strains were subjected to complementary standard biochemical tests: catalase, DNAse, and coagulase tests. Suspect Staphylococcus aureus colonies were subcultured on Mannitol Salt Agar and the bacterial mass of each strain on the agar was scraped off and stored in cryotubes containing brain broth at 20% glycerol for subsequent identification.

Bacterial load calculation formula

Petri dishes containing 15 to 300 colonies were used to calculate the "N" number of microorganisms. Equation (1) is the formula used to calculate the number of microorganisms:

N = C ( n 1 + 0.1 n 2 ) V × d

where:

N = Number of microorganisms (cfu/g of product)

ΣC: Sum of colonies counted on plates retained from two successive dilutions

n1: Number of plates retained from first dilution

n2: Number of plates retained for the second dilution

d: dilution factor corresponding to the low dilution (first dilution)

V: inoculum volume.

2.2. Assessment of Microbiological Quality of Fish Analyzed

Microbiological results were interpreted using the European regulation N˚ 2073/2005 three-class plan.

m = official microbiological criterion: all results less than or equal to this number are satisfactory.

M = threshold limit of acceptability (10 m): above which results are no longer considered satisfactory, without the product being toxic.

- A result is satisfactory if the value obtained is less than or equal to 3 m;

- A result is unsatisfactory if the value obtained is higher than M;

- A result is acceptable if the value obtained is between 3 m and M.

Specifically, for the interpretation of Salmonella results, a two-class plan was used (presence or absence).

2.3. Phenotypic Identification of Staphylococcus Strains

Staphylococcus strains were identified using the API Staph kit (Reference # 20500, BioMerieux S.A., Marcy l'Etoile, France). For this purpose, the microtubes of each gallery were inoculated with a bacterial suspension of turbidity equal to 0.5 McFarland prepared from each isolate. Tests and gallery readings were carried out according to the manufacturer's instructions. Strain identity was obtained on the basis of digital profiles using Apiweb TM software. Isolates with a staphylococcal compatibility percentage higher than 80% were retained.

2.3. Molecular Analysis of Staphylococcus Isolates

2.3.1. DNA Extraction

Total genomic DNA was extracted using the heat shock method. For this, one to three colonies of each isolate (24 h) on Muller Hinton agar plates were picked using a sterile Pasteur pipette, then introduced into an Eppendorf tube containing 200 μl sterile 1X PBS and the mixture was homogenized by vortexing. Cells were washed by centrifugation at 20,000 × g. The supernatant was discarded and the pellet was used for total genomic DNA extraction. For cell lysis, the pellet was resuspended in 20 μl of nuclease-free water, then frozen for 15 min, and then boiled in a water bath for 10 min.The lysate was then centrifuged at 12,000 rpm in a microcentrifuge (Biofuge fresco, Thermo Scientific) for 10 min [22] . The resulting supernatant was collected and stored at −20˚C in Eppendorf tubes for further analysis.

2.3.2. Identification of Staphylococcus aureus Strains by PCR

Molecular identification of isolated Staphylococcus aureus strains was performed using Staur4 5'ACGGAG TTACAAAGGACGAC 3' and Staur6 5'AGCTCAGCCTTAACGAGTAC 3' primers to amplify specific regions of the 23S rDNA of the Staphylococcus aureus species as described by Straub et al. 1999. The specific sense primer nucF 5'GCGATTGATGGTGATACGGT 3' and antisense primer nucR 5'AGCCAAGCCTTGACGAACTAAAGC 3' (Inquaba Biotec West Africa Ltd, Africa's Genomics Company) were used to amplify the segment of the nuc gene encoding the thermostable endonuclease of coagulase-positive Staphylococcus.

The reaction mixture was prepared in 25 μl according to the OneTaq master mix as follows: 12.5 μl of OneTaq® Quick-Laord® 2X Master Mix with Standard Buffer (New England Biolabs®), 0.5 μl of sense primer (10 μM), 0.5 μl of reverse primer (10 μM), 2.5 μl of DNA extract and 9 μl of Nuclease free water (DNA/DNAse/RNAse free Sterile, PCR Inhibitor free, Bioconcepts).

PCR reactions were performed in a thermal cycler (2720 Thermal Cycler, Applied Biosystem). The PCR program used for Staur primers was: predenaturation 94˚C/5min, 35 cycles (94˚C/30sec; 55˚C/40 seconds; 72˚C/1.2minutes), and final elongation at 72˚C/5minutes. For the nuc gene, the following steps were applied: initial denaturation 95˚C for 5 min, 30 cycles of (denaturation 94˚C for 60 sec, hybridization 55˚C for 30 sec, elongation 72˚C for 90 sec), final extension at 72˚C for 5 min. Amplicons were stored at +4˚C.

The amplified PCR fragments were visualized by dropping 10 μl of each amplicon into agarose wells (Agarose CSL-AG500, LE Multi-Purpose Agarose, Cleaver Scientific, UK) stained with SafeviewTM Classic Cat≠ G108, Canada (5 μl in 100 ml agarose). Migration was performed in TAE 1X (Tris-Acetate-EDTA) buffer for 20 min at 100 V to separate fragments by electrophoresis.

2.3.3. Detection of Genes Encoding Staphylococcal Toxins in Staphylococcus Isolates

The genes encoding enterotoxins, enterotoxin-like toxins, exfoliative toxins, and TSST-1 were detected using specific primers presented in Table 1. Primers were supplied by Inquaba Biotec West Africa Ltd, Africa's Genomics Company. Detection was performed by multiplex PCR (Fijalkowski et al., 2016; Chajecka-Wierzchowska, 2020).

The PCR mixture was prepared with Nuclease-free water (DNA/DNAse/RNAse free Sterile, PCR Inhibitor free, Bioconcepts) with a final concentration of the individual components as follows: One Taq® Quick-Laord® 1X Master Mix with

Table 1. Sequences of primers used to detect gene fragments encoding staphylococcal enterotoxins (SEs), staphylococcal toxic shock toxin (TSST-1), and exfoliative toxins in isolated Staphylococcus strains.

Standard Buffer (New England Biolabs®), 0.2 - 0.4 µM of each primer and 20 - 50 ng of DNA.

PCR was performed in a thermal cycler (2720 Thermal Cycler, Applied Biosystem). The PCR program used was: predenaturation 95˚C for 10 min for initial DNA denaturation, 35 cycles (denaturation at 95˚C for 30 s, annealing of the primers at 55˚C for 45 s, extension at 72˚C for 60 s), and final elongation 72˚C for 7 min. Amplicons were stored at +4˚C.

PCR fragments were visualized by depositing 10 μl of each amplicon in agarose gel (1.5%) wells (Agarose CSL-AG500, LE Multi-Purpose Agarose, Cleaver Scientific, UK) stained with SafeviewTM Classic Cat≠ G108, Canada (5 μl in 100 ml agarose). Migration was performed in TAE 1X (Tris-Acetate-EDTA) buffer for 20 min at 100 V to separate fragments by electrophoresis. Amplicon bands were visualized under UV light with UV Transilluminator (UVP Transilluminator, Analytikjena, US) and Gel Doc (Gel DocTM XR+ with Image LabTM Software, Molecular Imager®). Amplicon sizes were determined using a 100 bp molecular weight marker (Gel Loading Dye Purple (6X), SDS B7025S, 100 bp DNA Ladder N3231L, New England Biolabs®).

A negative control (reaction mixture without DNA extract) to verify any contamination of the DNA extract.

3. Results

3.1. Microbiological Quality of Fish Analyzed

The average load of presumed pathogenic staphylococci in the samples analyzed is shown in Table 2.

The average loads of presumed pathogenic staphylococci ranged from (1.27 ± 1.42) × 105 CFU/g to (2.11 ± 0.11) × 106 CFU/g respectively. Most of the samples analyzed were of unsatisfactory microbiological quality according to the microbiological criterion for Staphylococcus aureus (m = 102): 100% for samples of smoked Oreochromis niloticus, smoked Clarias gariepinus, smoked Anguilla bengalensis labiata, smoked Heterotis niloticus, dried Chrysichthys nigrodigitatus, smoked Chrysichthys nigrodigitatus, smoked Mormyrus rume, dried Mormyrus rume, braised Cyprinus carpio and 78.26% and 75% respectively for dried

Table 2. Average Staphylococcus load (CFU/g) and assessment of microbiological quality of fish analyzed.

N: number of samples; ONF: Oreochromis niloticus (smoked); CGF: Clarias gariepinus (smoked); ABLF: Anguilla bengalensis labiata (smoked); HNF: Heterotis niloticus (smoked); ONS: Oreochromis niloticus (dried); CNS: Chrysichthys nigrodigitatus, dried; CNF: Chrysichthys nigrodigitatus (smoked); MRF: Mormyrus rume (smoked); MRS: Mormyrus rume (dried); CCB: Cyprinus carpio (braised); TTB: Trachurus trachurus (braised). S: Satisfactory; A: Acceptable; NS: Not Satisfactory.

Oreochromis niloticus and braised Trachurus trachurus. Of the total, only 2.55% of samples were of satisfactory quality, and 97.45% were of unsatisfactory quality.

The API STAPH gallery allowed the identification and conservation of 108 strains of Staphylococcus. Among the strains identified, 45 were Staphylococcus aureus, 50 Staphylococcus xylosus, 3 Staphylococcus lugdunensis, 2 Staphylococcus hominis, 3 Staphylococcus haemolyticus, 2 Staphylococcus lentus, 1 Staphylococcus sciuri and 1 Staphylococcus capitis.

3.1. Prevalence and Distribution of Staphylococcal Superantigens (SAgs)

A total of 81 (75%) strains of 108 Staphylococcus isolates were positive for at least one (1) toxin gene (Table 3). The most frequent genes detected in toxin gene-positive strains were: tsst-1 gene in 45 isolated strains (41.7%), sei (16/14.8%), seg (13/12%), ser (7/6.5%), sec (6/5.5%), and sea (5/4.6%) for enterotoxins, seln (14/12.9%), selq (8/7.4%) for enterotoxin-like proteins and eta

Table 3. Distribution of staphylococcal toxin genes detected in isolated Staphylococcus strains (Number/%).

(3/2.7%) for exfoliative toxin genes. However, see was not detected in all strains.

In particular, the sea gene was detected in Staphylococcus aureus (3/6.7%), Staphylococcus hominis (1/50%) and Staphylococcus haemolyticus (1/33.3%). The eta gene was only detected in Staphylococcus aureus (3/6.7%). The tsst-1 gene was present in Staphylococcus aureus (18/40%), Staphylococcus xylosus (24/48%) Staphylococcus, lugdunensis (1/33.3%), Staphylococcus sciuri (1/100%) Staphylococcus capitis (1/100%).

A high percentage of each isolated species had SAgs toxin genes (Table 3): Staphylococcus aureus (86.6%), Staphylococcus xylosus (66%), Staphylococcus lugdunensis (66.7%), Staphylococcus hominis (50%), Staphylococcus haemolyticus (66.7%), Staphylococcus lentus (66.7%), Staphylococcus sciuri (100%), Staphylococcus capitis (100%).

Considering the distribution of Staphylococcus strains harboring toxin genes by type of sample analyzed (Table 4), all strains isolated from braised Trachurus trachurus possessed at least one toxin gene (100%). Large numbers of toxin gene-positive Staphylococcus were also observed in smoked Oreochromis niloticus (84.2%), smoked Clarias gariepinus (79.2%), smoked Heterotis niloticus (71.4%), smoked Anguilla bengalensis labiata (80%), and smoked Cyprinus carpio (75%).

The different combinations of toxin genes (genotypes) in each Staphylococcus species isolated from fish are presented in Table 5. Seventeen (17) toxin gene combinations were obtained in Staphylococcus aureus strains. Eleven (11/24.4%) Staphylococcus aureus strains presented only the tsst-1 gene. The most frequent gene combination was seg, sei, seln, found in 8 (17.8%) Staphylococcus aureus strains. Ten (10) distinct combinations of toxin genes were observed in Staphylococcus xylosus strains. The presence of tsst-1 alone was observed in 18 (36%) Staphylococcus xylosus strains. The combination sei, seln was the most frequent, found in 3 (6%) Staphylococcus xylosus strains.

Table 4. Distribution of toxin gene-positive strains in the different types of fish analyzed.

Legend: ONS: Oreochromis niloticus (Smoked), CGS: Clarias gariepinus (Smoked), ABLS: Anguilla bengalensis labiata (Smoked), HNS: Heterotis niloticus (Smoked), OND: Oreochromis niloticus (Dried), CND: Chrysichthys nigrodigitatus (Dried), CNS: Chrysichthys nigrodigitatus (Smoked), MRS: Mormyrus rume (Smoked), MRD: Mormyrus rume (Dried), CCB: Cyprinus carpio (Braised), TTB: Trachurus trachurus (Braised). N: Number of sample; PS: number of positive strains.

Table 5. Combinations of enterotoxin genes in each Staphylococcus species isolated from fish.

4. Discussion

In this study, we isolated and identified strains of Staphylococcus from dried, smoked, and braised fish. The results of the microbiological quality assessment indicated that most of the samples analyzed were found to be of unsatisfactory microbiological quality according to the microbiological criterion on Staphylococcus aureus (m = 102). Indeed, only 12.55% of samples were of satisfactory quality, while 97.45% were of unsatisfactory quality. This could be explained by the multiple cross-contaminations at the sales sites [23] .

Many species of Staphylococcus were identified: Staphylococcus aureus, Staphylococcus xylosus, Staphylococcus lugdunensis, Staphylococcus hominis, Staphylococcus haemolyticus, Staphylococcus lentus, Staphylococcus sciuri and Staphylococcus capitis. These species are frequently isolated from foods [24] [25] [26] [27] . Staphylococcus aureus (45/108) and Staphylococcus xylosus (50/108) were the predominant species isolated. Food handlers and food-contact surfaces are a source of staphylococcal contamination [28] [29] [30] .

Many studies investigated the presence of toxin genes in strains implicated in staphylococcal food poisoning. Staphylococcal toxin genes were found in the strains isolated from fish analyzed. Among the 21 toxin genes tested, 20 genes were detected in all strains analyzed excepted the see gene. The genes detected included staphylococcal enterotoxin genes (sea, seb, sec, sed, seg, seh, sei, ser), enterotoxin-like toxin genes (selj-selq and selu), exfoliative toxin genes (eta) and toxic shock syndrome toxin-1 (tsst-1). The most frequent staphylococcal enterotoxin genes detected in positive strains involved sei (16/14.8%), seg (13/12%), sec (6/5.5%) and sea (5/4.6%). The staphylococcal enterotoxin genes sea-sei are frequently isolated from strains involved in staphylococcal food poisoning cases [31] [32] [28] [25] . SEA is the toxin most implicated in these intoxications [33] .

The eta gene was only detected in Staphylococcus aureus (3/6.7%). Exfoliative toxins can be implicated in diseases such as skin syndrome in children and also in some infections of the blood, urinary tract etc. [34] [35] . In addition, the tsst-1 gene was the most frequently detected in all strains isolated (41.7%). This gene was found individually or in combination in isolates of Staphylococcus aureus (18/40%), Staphylococcus xylosus (24/48%), Staphylococcus lugdunensis (1/33.3%), Staphylococcus sciuri (1/100%), Staphylococcus capitis (1/100%). Vitale et al. [36] also detected the tsst-1 gene in the majority (42%) of strains isolated from foods implicated in food poisoning. However, Fijałkowski et al. [25] did not detect tsst-1 gene in their study. The tsst-1 gene is located on different pathogenicity islands such as SaPI1, SaPI2 and SaPIbov1 and encodes the protein toxic shock syndrome toxin 1 (TSST-1) with a size of 22 kDa [37] . This toxin is implicated in vaginal toxic shock syndrome [38] . Some studies have shown that this toxin purified can induce fever, mucosal suffusion, renal failure, liver damage, hypocalcemia, lymphocytopenia, and hypotension in animals [39] .

Enterotoxin-like toxin genes were also detected among the strains analyzed, and the most frequent were seln (14/12.9%) and selq (8/7.4%). These toxin genes are present in both Staphylococcus aureus and the other coagulase-negative strains isolated in this study (Staphylococcus xylosus, Staphylococcus lugdunensis, Staphylococcus hominis, Staphylococcus haemolyticus, Staphylococcus lentus, Staphylococcus sciuri and Staphylococcus capitis). These strains had at least one toxin gene. Some strains, such as Staphylococcus xylosus, are known for their non-pathogenicity and are commonly used in food fermentation processes [40] [41] .

However, the identification of toxin genes in these species in recent studies is increasingly clarifying their potential implication in food poisoning [42] [43] , the toxigenic ability of coagulase-negative Staphylococcus should not be ignored and should also be investigated in food on an ongoing basis.

Staphylococcus aureus and Staphylococcus xylosus are the strains that simultaneously harbor several toxin genes. The most frequent combinations of toxin genes found were seg, sei and seln. Although the presence of toxin genes does not automatically mean production of toxins by strains, the detection of these genes requires special attention [44] . Expression of these genes can lead to the production of toxins implicated in cases of staphylococcal food poisoning.

The distribution of Staphylococcus strains harboring toxin genes by type of sample analyzed showed that enterotoxinogenic Staphylococcus strains are present in all types of fish analyzed, with a high prevalence in braised Trachurus trachurus (100%), smoked Oreochromis niloticus (84.2%), smoked Clarias gariepinus (79.2%), smoked Heterotis niloticus (71.4%), smoked Anguilla bengalensis labiata (80%), and smoked Cyprinus carpio (75%). Given that food handlers are a source of staphylococcal contamination, enterotoxigenic Staphylococcus would be introduced into fish by sellers through manual contact or respiratory secretions during sale [28] [30] . To this end, many studies have demonstrated the presence of enterotoxinogenic strains in fish samples and workers [45] [46] [47] [48] .

5. Conclusion

In this study, we isolated and identified strains of Staphylococcus contaminating dried, smoked and braised fish. The results of the microbiological quality assessment indicated that most of the samples analyzed were of unsatisfactory microbiological quality. The strains isolated from the fish analyzed were found to harbor staphylococcal toxin genes. Of the 21 toxin genes examined in this study, 20 were detected in all the strains tested. This demonstrates the pathogenicity of Staphylococcus strains isolated from fish collected in Ouagadougou markets. The staphylococcal toxin genes detected were present in both Staphylococcus aureus and the other coagulase-negative strains isolated in this study. The results of this study provide an important database that will enable people to control the consumption of smoked, dried, and braised fish to avoid staphylococcal food poisoning.

Acknowledgements

We would like to express our gratitude to the AFRIDI project which granted us a mobility grant to carry out a part of our PhD research work at the University of Douala. The financial support of the project allowed us to carry out the phenotypic and the detection of genes encoding staphylococcal toxins.

Authors’ Contributions

OA performed the collection of the fish samples, carried out the analyses and wrote the manuscript. TF supervised the work in the laboratory. OGA and OHS read and corrected the manuscript. ZC and SA read and approved the final version of the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

References

[1] Tacon, A.G.J., Lemos, D. and Metian, M. (2020) Fish for Health: Improved Nutritional Quality of Cultured Fish for Human Consumption. Reviews in Fisheries Science & Aquaculture, 28, 449-458.
[2] Pittia, P. and Antonello, P. (2016) Safety by Control of Water Activity: Drying, Smoking, and Salt or Sugar Addition. In: Prakash, V., et al., Eds., Regulating Safety of Traditional and Ethnic Foods, Elsevier, Amsterdam, 7-28.
[CrossRef]
[3] Sikorski, Z.E. (2016) Smoked Foods: Principles and Production. In: Caballero, B., et al., Eds., Encyclopedia of Food and Health, Elsevier, Amsterdam, 1-5.
[CrossRef]
[4] Sikorski, Z.E. and Sinkiewicz, I. (2014) Smoking|Traditional. In: Dikeman, M. and Devine, C., Eds., Encyclopedia of Meat Sciences, Elsevier, Amsterdam, 321-327.
[CrossRef]
[5] Ashie, I.N.A., Smith, J.P., Simpson, B.K. and Haard, N.F. (1996) Spoilage and Shelf-Life Extension of Fresh Fish and Shellfish. Critical Reviews in Food Science and Nutrition, 36, 37-41.
[CrossRef] [PubMed]
[6] Turan, H. and Erkoyuncu, I. (2012) Salting Technology in Fish Processing. In: Bhat, R., et al., Eds., Progress in Food Preservation, John Wiley & Sons Ltd., Hoboken, 297-313.
[CrossRef]
[7] Heredia, N. and García, S. (2018) Animals as Sources of Food-Borne Pathogens: A Review. Animal Nutrition, 4, 250-255.
[CrossRef] [PubMed]
[8] Cohen, N. and Karib, H. (2006) Risque hygiénique lié à la présence des Escherichia coli dans les viandes et les produits carnés: Un réel problème de santé publique? Les Technologies de Laboratoire, 1, 4-9.
[9] Watari, T., Takayuki, M., Ba, T., Okada, A., Nishikawa, K., Otsuki, K., Nobuhiro, B.A., Ba, N., Abe, H., Nakano, Y., Soshi, B.A., Ba, T. and Amano, Y. (2021) A Review of Food Poisoning Caused by Local Food in Japan. Journal of General and Family Medicine, 22, 15-23.
[CrossRef] [PubMed]
[10] Dietrich, R., Jessberger, N., Ehling-schulz, M., Märtlbauer, E. and Granum, P.E. (2021) The Food Poisoning Toxins of Bacillus cereus. Toxins (Basel), 13, 1-48.
[CrossRef] [PubMed]
[11] Hernández-cortez, C., Palma-Martínez, I., Gonzalezavila, L.U., Guerrero-mandujano, A., Solís, C.R. and Castro-Escarpulli, G. (2017) Food Poisoning Caused by Bacteria (Food Toxins). In: Malangu, N., Ed., Poisoning: From Specific Toxic Agents to Novel Rapid and Simplified Techniques for Analysis, Intechopen, London, 33-72.
[Google Scholar] [CrossRef]
[12] Afreen, M. and Ucak, I. (2021) Food-Borne Pathogens in Seafood. Eurasian Journal of Agricultural Research, 5, 44-58.
[13] Zaki, H.M.B.A., Emara, M.M.T. and Abdallah, M.R.S. (2018) Effect of Smoke Duration on Compositional Analysis, Deterioration Criteria, Microbial Profile and Sensory Attributes of Marine and Freshwater Fish: A Comparative Study. Advances in Animal and Veterinary Sciences, 9, 1259-1266.
[14] Saklani, P., Manjusha, L., Binaya, B.N. and Sanath, K. (2020) Survival of Methicillin-Resistant Staphylococcus aureus in Fish and Shrimp under Different Storage Conditions. Journal of Food Protection, 83, 844-848.
[CrossRef]
[15] Bahrndorff, S., Menanteau-Ledouble, S., Stidsborg, S., Jørgensen, N.O.G., Hoque, M.S. and Nielsen, J.L. (2022) Bacterial Composition Associated with Different Traditions of Salted and Dried Fish across Countries. Food Bioscience, 50, Article ID: 101991.
[CrossRef]
[16] Moon, H., Min, K., Park, N., Park, H. and Yoon, K. (2017) Survival of Staphylococcus aureus in Dried Fish Products as a Function of Temperature. Food Science and Biotechnology, 26, 823-828.
[CrossRef] [PubMed]
[17] Tchigui Manga Maffouo, S., Mouafo, H.T., Mouokeu, R.S., Manet, L., Tchuenchieu, A.K. Simo, B.N., Djeuachi, H.T., Medoua, G.N. and Tchoumbougnang, F. (2021) Evaluation of Sanitary Risks Associated with the Consumption of Street Food in the City of Yaoundé (Cameroon): Case of Braised Fish from Mvog-Ada, Ngoa Ekélé, Simbock, Ahala and Olézoa. Heliyon, 7, e07780.
[CrossRef] [PubMed]
[18] Bergdoll, M.S. (1990) Analytical Methods for Staphylococcus aureus. International Journal of Food Microbiology, 10, 91-99.
[CrossRef]
[19] Hennekinne, J., De Buyser, M. and Dragacci, S. (2012) Staphylococcus aureus and Its Food Poisoning Toxins: Characterization and Outbreak Investigation. FEMS Microbiology Reviews, 36, 815-836.
[CrossRef] [PubMed]
[20] Kadariya, J., Smith, T.C. and Thapaliya, D. (2014) Staphylococcus aureus and Staphylococcal Food-Borne Disease: An Ongoing Challenge in Public Health. BioMed Research International, 2014, Article ID: 827965.
[CrossRef] [PubMed]
[21] Oliveira, D., Anabela, B. and Manuel, S. (2018) Staphylococcus aureus Toxins and Their Molecular Activity in Infectious Diseases. Toxins, 10, Article No. 252.
[CrossRef] [PubMed]
[22] Madadgar, O., Tadjbakhsh, H., Salehi, T.Z., Mahzounieh, M. and Feizabadi, M. (2008) Evaluation of Random Amplified Polymorphic DNA Analysis and Antibiotic Susceptibility Application in Discrimination of Salmonella typhimurium Isolates in Iran. New Microbiologica, 31, 211-216.
[23] Ouedraogo, A., Zongo, C., Tapsoba, F., Cissé, H., Traoré, Y. and Savadogo, A. (2021) Evaluation of Contamination Risks Due to the Sale and Storage Conditions of Smoked, Dried and Fresh Fishes in Ouagadougou. Current Journal of Applied Science and Technology, 40, 42-54.
[CrossRef]
[24] Çanak, Ö. and Timur, G. (2020) An Initial Survey on the Occurrence of Staphylococcal Infections in Turkish Marine Aquaculture (2013-1014). Journal of Applied Ichthyology, 36, 932-941.
[Google Scholar] [CrossRef]
[25] Fijałkowski, K., Peitler, D. and Karakulska, J. (2016) Staphylococci Isolated from Ready-to-Eat Meat—Identification, Antibiotic Resistance and Toxin Gene Profile. International Journal of Food Microbiology, 238, 113-120.
[CrossRef] [PubMed]
[26] Külahcı, M.B. and Gündoğan, N. (2021) Occurrence and Characteristics of Staphylococci and Enterococci in Retail Fish Used for Human Consumption in Turkey. European Journal of Science and Technology, No. 28, 911-916.
[CrossRef]
[27] Sivaraman, G.K., Gupta, S.S., Visnuvinayagam, S., Muthulakshmi, T., Elangovan, R., Perumal, V., Balasubramanium, G., Lodha, T. and Yadav, A. (2022) Prevalence of S. aureus and/or MRSA from Seafood Products from Indian Seafood Products. BMC Microbiology, 22, Article No. 233.
[CrossRef] [PubMed]
[28] Avila-novoa, M.G., Iñiguez-moreno, M., González-gómez, J.P., Zacarías-castillo, E., Guerrero-medina, P.J., Padilla-frausto, J.J., Navarro-villarruel, C.L. and Gutiérrez-lomelí, M. (2018) Detection of Enterotoxin Genes of Staphylococcus aureus Isolates from Food Contact Surfaces in the Dairy Industry of Jalisco, Mexico. Biotecnia, 20, 72-78.
[CrossRef]
[29] Cortés-Sánchez, A.D.J., Díaz-Ramírez, M., Salgado-Cruz, M.D. la P. and Hernandez-Nava, R.G. (2020) Food Safety and Fish Production the Case of Staphylococcus aureus: A Review. OnLine Journal of Biological Sciences, 20, 293-306.
[CrossRef]
[30] Sheng, L. and Wang, L. (2021) The Microbial Safety of Fish and Fish Products: Recent Advances in Understanding Its Significance, Contamination Sources, and Control Strategies. Comprehensive Reviews in Food Science and Food Safety, 20, 738-786.
[CrossRef] [PubMed]
[31] Akineden, O., Annemuller, C., Hassan, A.A., Lammler, C., Wolter, W. and Zschock, M. (2001) Toxin Genes and Other Characteristics of Staphylococcus aureus Isolates from Milk of Cows with Mastitis. Clinical and Diagnostic Laboratory Immunology, 8, 959-964.
[CrossRef]
[32] Arfatahery, N., Davoodabadi, A. and Abedimohtasab, T. (2016) Characterization of Toxin Genes and Antimicrobial Susceptibility of Staphylococcus aureus Isolates in Fishery Products in Iran. Scientific Reports, 6, Article No. 34216.
[CrossRef] [PubMed]
[33] Argudín, M.Á., Mendoza, M.C. and Rodicio, M.R. (2010) Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins (Basel), 2, 1751-1773.
[CrossRef] [PubMed]
[34] Kooshaa, R.Z., Fooladi, A.A.I., Hosseini, H.M. and Aghdam, E.M.A. (2014) Prevalence of Exfoliative Toxin A and B Genes in Staphylococcus aureus Isolated from Clinical Specimens. Journal of Infection and Public Health, 7, 177-185.
[CrossRef] [PubMed]
[35] Mohseni, M., Rafiei, F. and Ghaemi, E.A. (2018) High Frequency of Exfoliative Toxin Genes among Staphylococcus aureus Isolated from Clinical Specimens in the North of Iran: Alarm for the Health of Individuals under Risk. Iranian Journal of Microbiology, 10, 158-165.
[36] Vitale, M., Scatassa, M.L., Cardamone, C., Oliveri, G., Piraino, C., Alduina, R. and Napoli, C. (2014) Staphylococcal Food Poisoning Case and Molecular Analysis of Toxin Genes in Staphylococcus aureus Strains Isolated from Food in Sicily, Italy. Foodborne Pathogens and Disease, 12, 21-23.
[CrossRef] [PubMed]
[37] Que, Y. and Moreillon, P. (2015) Staphylococcus aureus (Including Staphylococcal Toxic Shock Syndrome). In: Bennett, J.E., et al., Eds., Mandell, Douglas, and Bennett’s Principles and Practice of Infectious Diseases, 8th Edition, Elsevier Inc., Amsterdam, 2237-2271.e5.
[Google Scholar] [CrossRef]
[38] Macphee, R.A., Miller, W.L., Gloor, G.B., McCormick, J.K., Hammond, J., Burton, J.P. and Reid, G. (2013) Influence of the Vaginal Microbiota on Toxic Shock Syndrome Toxin 1 Production by Staphylococcus aureus. Applied and Environmental Microbiology, 79, 1835-1842.
[CrossRef]
[39] Sharma, H., Turner, C.E., Siggins, M.K., El-bahrawy, M., Pichon, B., Kearns, A. and Sriskandan, S. (2019) Toxic Shock Syndrome Toxin 1 Evaluation and Antibiotic Impact in a Transgenic Model of Staphylococcal Soft Tissue Infection. mSphere, 4, e00665-19.
[CrossRef]
[40] Semedo-lemsaddek, T., Carvalho, L., Tempera, C., Fernandes, M.H., Fernandes, M.J., Elias, M., Barreto, A.S. and Fraqueza, M.J. (2016) Characterization and Technological Features of Autochthonous Coagulase-Negative Staphylococci as Potential Starters for Portuguese Dry Fermented Sausages. Journal of Food Science, 81, M1197-M1202.
[CrossRef] [PubMed]
[41] Wang, J., Xu, J., Kong, B., Liu, Q., Xia, X. and Sun, F. (2022) Wang, Purification and Characterization of the Protease from Staphylococcus xylosus A2 Isolated from Harbin Dry Sausages. Foods, 11, Article No. 1094.
[CrossRef] [PubMed]
[42] Chajecka-Wierzchowska, W., Gajewska, J., Wisniewski, P. and Zadernowska, A. (2020) Enterotoxigenic Potential of Coagulase-Negative Staphylococci from Ready-to-Eat Food. Pathogens, 9, Article No. 734.
[CrossRef] [PubMed]
[43] Rajkovic, A. (2016) Staphylococcus: Food Poisoning. In: Caballero, B., et al., Eds., Encyclopedia of Food and Health, Elsevier, Amsterdam, 133-139.
[CrossRef]
[44] McLauchlin, J.M.C., Narayanan, G.L., Mithani, V. and O’Neill, G. (2000) The Detection of Enterotoxins and Toxic Shock Syndrome Toxin Genes in Staphylococcus aureus by Polymerase Chain Reaction. Journal of Food Protection, 63, 479-488.
[CrossRef]
[45] Mehrotra, M., Wang, G. and Johnson, W.M. (2000) Multiplex PCR for Detection of Genes for Staphylococcus aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin Resistance. Journal of Clinical Microbiology, 38, 1032-1035.
[CrossRef]
[46] Omoe, K., Hu, D. and Takahashi-omoe, H. (2005) Comprehensive Analysis of Classical and Newly Described Staphylococcal Superantigenic Toxin Genes in Staphylococcus aureus Isolates. FEMS Microbiology Letters, 246, 191-198.
[CrossRef] [PubMed]
[47] Saito, E., Yoshia, N., Kawano, J., Shimizu, A. and Igimi, S. (2011) Isolation of Staphylococcus aureus from Raw Fish in Relation to Culture Methods. The Journal of Veterinary Medical Science, 73, 287-292.
[CrossRef] [PubMed]
[48] Simon, S.S. and Sanjeev, S. (2007) Prevalence of Enterotoxigenic Staphylococcus aureus in Fishery Products and Fish Processing Factory Workers. Food Control, 18, 1565-1568.
[CrossRef]

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.