Electron Micrographic Representations of Mechanisms of Action of Murine Norovirus on ATCC TIB-71 Cells and Level of Gene Expression

Abstract

Human noroviruses (HuNoV) are the number one cause of viral gastroenteritis worldwide resulting in a significant cause of morbidity and mortality in all age groups. However, despite the medical relevance of HuNoV, effective treatment against norovirus infection is yet to be developed. In this study, we investigated the anti-Noroviral activity of Hibiscus sabdariffa (HS) calyces and Zanthoxylum armatum (ZA) seeds using murine norovirus, a surrogate of human norovirus. The antiviral mechanisms of action were also examined using a gene expression studies and transmission electron microscopy. Our results showed that virus-infected cells were left potentially void of all the cell machineries whereas uninfected cells represent healthy normal and dividing cells. The infected treated cells with extracts showed restoration of the dense cytoplasm, cytoplasmic membrane, and the nucleus. These cells were also associated with the expression of ORF genes. This study demonstrates the antiviral properties of Hibiscus sabdariffa (HS) calyces and Zanthoxylum armatum (ZA) and thus indicates their potential as natural remedies to treat noroviruses.

Share and Cite:

Iloghalu, U. , Miller, S. , Ewunkem, A. , Khatiwada, J. , Davis, S. and Williams, L. (2023) Electron Micrographic Representations of Mechanisms of Action of Murine Norovirus on ATCC TIB-71 Cells and Level of Gene Expression. Advances in Microbiology, 13, 32-47. doi: 10.4236/aim.2023.131003.

1. Introduction

Norovirus outbreaks are rampant in the nursing homes, military, and cruise ships. The HuNoV is sporadic [1] and occurs mostly in winter [2]. The virus causes about 75% - 90% of nonbacterial gastroenteritis [3] [4], with vomiting and diarrhea as its earliest symptoms [5]. Approximately 685 million cases occur annually worldwide, and approximately 21 million cases occur every year in the United States alone [6]. Nearly 71,000 hospitalizations, 800 deaths, and $493 million in economic losses are accrued because of norovirus infection per year in the United States [3] [7].

The management of this viral infection is presently only through practices such as confinement of infected persons, constant handwashing, and drinking a lot of fluid [8]. There is a dire need for more permanent treatment options as well as their mechanism of actions. Plants are natural resources that have been proved to be effective against viruses with little or no side effect [9]. Therefore, developing resistance against plants is unlikely [10]. Plants contain phytochemicals that naturally protect them from microbe and insect attacks [11]. These phytochemicals carry out their antimicrobial activity through various drug targets, for example, destruction of virulence factors, inhibition of toxin and enzyme activities, and bacterial membrane [12]. Studies have demonstrated that Warbuga ugandensis plectrunthus barbatus, Withania somnifera, and Prunus africana exhibited fungicidal, bactericidal, and immunopotentiation as likely mechanisms of action [13]. Another studies confirmed mechanisms of action of plants by leakage of cellular contents and permeabilization of the inner membrane [14] and also that Polygonum chinense is a multi-targeted inhibitor of influenza A and B [15]. The use of herbal plants to treat human diseases has opened an alternative door for treating some of the diseases that are eluding orthodox medicine. The surge in traditional plant use to find permanent solutions to ever emerging humans’ disease may provide the long-awaited answer to handling human noroviruses. The curative potential of herbal plants has been sought by scientists over a couple of years. These plants have proven to possess anti-inflammatory, antiviral, antitumor, antimalarial and analgesic properties [16].

Our objective of this study was to determine the mechanism of action through which the phytochemicals modulate virus infection. Bioactive compounds such as polyphenols, flavonoids, and organic acids are known to have therapeutic potentials for most human ailments. Flavonoids block prostaglandin synthesis, cell cycle progression, and protect the cell against injury caused by X-rays [17]. Polyphenol and organic acids are known to regulate enzyme activities and proliferation of bacteria, respectively [18]. The plants of interest in this study are Hibiscus sabdariffa and Zanthoxylum armatum, which are known to possess flavonoids, polyphenols, and organic acids. Flavonoids like l-epicatechin, tangeretin, and naringenin showed antiviral effect against feline calicivirus (FCV-F9) [19].

Negative staining, a conventional method used in diagnostic microscopy for contrasting a thin specimen with an optically opaque fluid, is an essential technique in electron microscopy [18] [20]. Negative staining requires acidic dye such as uranyl acetate; this means that the stain gives up a proton (a hydrogen ion) and the chromophore of the dye becomes negatively charged [21]. The background is stained, leaving the actual specimen untouched [22] [23]. The virus cell surface repels the stain because the surface of most viral cells is negatively charged. The virus will show up as thin spots against a dark background [23].

2. Materials and Methods

Specimen processing for transmission electron microscopy (TEM): Both treated and untreated RAW 264.7 cells (controls) were fixed in 4% buffered glutaraldehyde and kept in the refrigerator until use. Treated means that RAW 264.7 cells were initially exposed to murine norovirus for few hours and then treated separately with extracts of H. sabdariffa and Z. armatum. The control groups were normal cells without virus exposure and cells with virus exposure respectively. Glutaraldehyde is incomparable in cell structure preservation [18]. The glutaraldehyde was aspirated and carefully washed with 0.1 M sodium cacodylate buffer containing 7.5% sucrose, three changes for 15 minutes each. Sucrose increases the osmolality of the sample. The samples were post-fixed in 1.0% osmium (OsO4) in 0.10 M sodium cacodylate buffer for 1 hour on the rotator, washed in 3 changes of 0.11 M veronal acetate (VA) working buffer, 15 minutes each change. The samples were into en bloc stain (Figure 1(A)) (0.5% uranyl acetate in veronal acetate buffer) for 1 hour and dehydrated in a series of ascending acetone concentration [70%, 95%, 100% (X2)] for at least 10 minutes each. Furthermore, the samples were placed in a 50/50 mixture of acetone and 100% epoxy resin for at least 1 hour on a rotator. The 50/50 mixture was replaced with 100% epoxy resin for 30 minutes at room temperature on a rotator. The second change of 100% epoxy was made and incubated for another 30 minutes at room temperature on a rotator. The samples were placed into molds with a label and baked for 24 hours for embedding. Sections of grid were cut

Figure 1. Thin-section process. Samples in bloc (A), ultra-microtome ((B) and (C)), Sections are cut under water (C).

with a diamond knife on an ultramicrotome (Figure 1(B) and Figure 1(C)) to produce thin slices of samples that were semitransparent to electrons. The sections were about 70 nm thick and stained with uranyl acetate. Uranyl acetate is a heavy metal that gives quality contrast to the image as electrons are scattered for good eye contrast. The grids were air-dried and carefully loaded into the electron microscope (EM) (Phillips CM12) for view while the room was kept dark.

Northern blotting: We employed the northern blotting technique to measure the amount and size of RNA in both treated and untreated samples [24]. We employed a previously described method [24] with modifications. Briefly, samples were run on a denaturing gel to separate RNA according to their sizes (28 S & 18 S). The agarose gel (Invitrogen, Lot no 00607575) was run at 75 V for 55 mins and then moved to a positively charged Biodyne B Pre-Cut modified nylon membrane (0.45 µM, Thermo Scientific Rockford, IL) for 2 hours using NorthernMax-Gly kit (Thermofisher, AM1946).

The labeled probe corresponding to the gene of interest was generated with RT-qPCR as well with traditional PCR products. We used Fotodyne (Incorporated Foto/Analyst luminary FX with darkroom controls) to determine probe efficiency. We hybridized the generated probe to the nylon membrane with transferred RNA in the nylon membrane. Unhybridized probes were removed by washing in several changes of buffer. The solid nylon membrane with probe precisely bound to RNA of interest subjected to analysis (data not shown).

The reverse transcriptase of polymerase chain reaction of ORF 1, ORF 2, and ORF 3 Genes: ORF (1, 2, 3) levels of gene ID 4246735-7 (A-4) were determined using quantitative reverse-transcriptase real-time polymerase chain reaction (RT-qPCR). ORF (Open Reading Frame) is a norovirus gene which is of three parts: 1, 2, and 3. Each of them encodes different proteins. ORF1 has the specific function of encoding polypeptide with regions of close relationship to cysteine proteinase, helicase, and RNA-dependent RNA polymerase (RdRp)-encoding regions. ORF2 encodes viral capsid protein (VP1) while ORF3 encodes small structural protein (VP2) linked with VP1 strength.

Briefly, total RNA was isolated from control and experimental cells using the isolation RNeasy Mini Kit (50) (Qiagen Inc. catalog number 74104), according to the manufacturer’s instruction. The total RNA 2 µg was then reverse transcribed using SuperScript-III enzyme (Invitrogen, New York, USA), a 2 pmol of gene specific primer. A non-viral tag sequence attached at the 5’ end of the strand specific viral sequence was part of the reverse transcription primer (RT-primer) (A-8). The RT-qPCR targeted the ORFs (1, 2, and 3) genes using gene-specific primers (2 pmol) from Integrated DNA Technologies (IDT) (Ref. no. 187223698). The resulting cDNAs were subjected to RT-qPCR using the MESA Blue qPCR Master Mix Plus for Syber Assay (Eurogentech, Seraing, Belgium). We used a previously described method for the RT-qPCR [25]. Briefly, 2× Mesa blue master mix and the respective primers were mixed with 2 μl of diluted cDNA (A-7). Each strand was at a final concentration of 125 nM before enzyme activation by incubation at 95˚C for 10 min. The cycling parameters in an Eppendorf realplex2 (Mastercycler ep gradient S) real time PCR were as follows: 50 cycles of 94˚C, 15 secs; 58˚C, 20 secs; 72˚C, 20 sec. Each sample and a standard curve were run in triplicate to ensure reproducibility.

The ORF 1-3 primers obtained from IDT, Inc. (A-8). ORF 1, 2, 3 PCR primers (TposGpos: 3’-CGGGAAGGCGACTGGAGTGCCCAAACATCTTTCCCTTGTTC-5), qPCR-Tpos Forward: 3’-CGGGAAGGCGACTGGAGTGCC-5’, qPCR-RGneg Reverse: 3’-TGGACAACGTGGTGAAGGAT-5’) and TnegGneg 3’-GGCCGTCATGGTGGCGCGAATAATGGACAACGTGGTGAAGGAT-5’, and qPCR-FTneg GGCCGTCATGGTGGCGAATAA, qPCR-RGpos 3’-CAAACATCTTTCCCTTGTTC-5’ utilized were custom synthesized. The log10-transcribed RNA genomic replicas were plotted against the threshold cycle (Ct) value. The positive amplification control and negative amplification control (Escherichia coli) were incorporated in each RT-qPCR run.

Statistical Analysis

Data are shown as means ± standard error (SE). T-test and one-way ANOVA were performed to compare the means. All statistical analyses were performed using Graph-Pad Prism version 7. Differences of p < 0.05 were considered significant.

3. Result

To evaluate the mechanisms of action of the virus, we examined virus-infected RAW 264.7 cells by negative staining [18] and thin sectioning. Thin sectioning is a diagnostic procedure, which enhances beam penetration in tissues and cells. Cells were centrifuged and fixed with glutaraldehyde to hold them together. Our result showed that virus-infected cells were left potentially void of all the cell machinery (Figure 2(A1) and Figure 2(A2)), whereas uninfected cells depict healthy normal and dividing cells (Figure 2(B1) and Figure 2(B2)). Organelles like the mitochondria, endoplasmic reticulum, cytoplasmic membrane were evident in Figure 2(B1) and Figure 2(B2). Treated cells with extracts showed a noticeable difference from the untreated virus-infected cells. The changes in the treated depicted the gentle restoration of some of the virus eroded cell organelles. Typical is the presence of cytoplasmic membrane, dense cytoplasm, and the nucleus (Figure 3). In Figure 4, we showed the presence and the devastative impact of the murine norovirus in the cytoplasm. Note that this figure consists of untreated virus-infected cells. Murine norovirus is an RNA non-enveloped virus. Our RT-qPCR result shows levels of ORF (1, 2 & 3) gene expression in both treated and untreated cells (Figure 5).

To show effects of the extracts Hibiscus sabdariffa (HS) calyces and Zanthoxylum armatum (ZA) seeds on expression of ORF genes during norovirus infection, active doses of the Hibiscus sabdariffa (HS) calyces and Zanthoxylum armatum (ZA) seed extracts were added to murine norovirus, a surrogate of human norovirus. Subsequently, the cells were infected with norovirus for 2 hours. mRNA expression levels for ORF family were investigated by utilizing RT-qPCR

Figure 2. Electron micrographs of untreated samples. MNV+ RAW264.7 ((A1) and (A2)); RAW 264.7 cell line only ((B1) and (B2)).

Figure 3. EM micrographs of treated infected cells. Treated with Hibiscus sabdariffa extracts ((A1) - (A3)) and extracts of Zanthoxylum armatum ((B1) - (B3)).

Figure 4. Images of murine norovirus in the cytoplasm. Arrow shows murine norovirus.

Figure 5. qPCR representation of treated and untreated samples against MNV. P: Positive control, N: Negative, SP1 & SN1: Treated with Hs (+ve & −ve), SP2: Treated with Za (+ve & −ve).

using the MESA Blue qPCR Master Mix. Uninfected cells were used as a negative control. The infected but not plant extract exposed cells were used as positive control. Based on the ORF genes expression analysis results, the expression levels were mainly up (Figure 5). The ORF affected by extracts were Hibiscus sabdariffa (HS) calyces and Zanthoxylum armatum (ZA) seed extracts. Treatment with Hibiscus sabdariffa (HS) calyces and Zanthoxylum armatum (ZA) seed extracts during norovirus infection resulted in the upregulation or expression of ORF as indicated by the Ct values. The Ct values associated with the treated cells (Sp1 and Sp2) were significantly (p < 0.05) lower the Ct associated with the control cells (Sn1 and Sn2) (Figure 5). The number of expressed gene is inversely proportional to Ct values. The Ct value is inversely proportional to the amount of viral nucleic acid in specimens (i.e., lower Ct values indicate higher amount of virus), so it can be used as a proxy of viral load.

4. Discussion

Plants naturally contain a wide range of secondary metabolites (phytochemicals) which indeed protect them from microbial attack [26] [27]. Phytochemicals are also known to treat an array of human ailments [28] such as cardiovascular diseases [29], diabetes mellitus [30], gastrointestinal tract infection [31], obesity [32], and periodontal diseases [33]. The mechanism through which the studied plants destroy or affect the viral unit is not yet known. In this study, murine norovirus acts as a model to human norovirus to evaluate the inhibitory effects of crude extracts of Zanthoxylum armatum and Hibiscus sabdariffa.

The plants of interest in this study, Hibiscus sabdariffa and Zanthoxylum armatum. H. sabdariffa, have been widely used as herbal medicine and drinks, food, hot and cold beverages, and as a flavoring agent [34]. The extract has evidently proven to possess antioxidant, neuro-protective [35], antidiabetic, anti-hypertensive [36], anti-cholesterol effects [37]. Zanthoxylum armatum has been shown to be anthelminthic, stomachic, and carminative [38]. Both the fruits and seeds control dyspepsia and fever [39].

The objective of this study, therefore, is to determine the mechanism of action of calyces of Hibiscus sabdariffa and seeds of Zanthoxylum armatum extracts on murine norovirus. Transmission electron microscopy (TEM) was used to observe any structural changes to the extract-treated-cell-murine norovirus complex directly. Transmission electron microscopy (TEM) has aided many virus discoveries—evaluations of virus-host cell interactions as well as diagnosis of various viral infections [40]. TEM has long been used to discover and describe the structure of viruses [41]. The use of TEM has also revealed to have an insight into different virus-cell interactions [42]. In our study, with the help of TEM, we observed the extract-treated-cell-murine norovirus complex directly. We were able to see restoration of cytoplasmic membrane, dense cytoplasm, and the nucleus in the treated cells and the control showing grievously eroded by noroviruses (Figure 3) suggesting the extracts acted by arresting viral replication.

Negative staining [18] and thin sectioning were both used in our study. Negative staining is a quick technique used for viewing tiny particles in fluids, typically viruses [43] [44]. Untreated virus-infected-RAW 264.7 exhibited a higher infection rate characterized by the dead cells. Also, the mitochondria cytoplasm, endoplasmic reticulum, ribosome, and nuclei lost their structural integrity (Figure 2 upper). In contrast, uninfected cells were healthy (Figure 2 lower). Loss of normal cell integrity (organelles) possibly suggests that the cells may have lost normal physiological processes. Our result agrees with a study of Usutu virus on human neural cells. The study shows that non-treated cells show higher viral infection rate and more cell death [45].

There was evidence of clathrin-mediated endocytosis, a process through which cells absorb proteins, viruses, hormones, and metabolites [46] [47]. Nuclear proteins imported into the nucleus through the nuclear pore complexes (NPCs) [48]. NPCs are large molecular machines that attach to the nuclear envelope [49]. Stages of cell divisions were seen in this group, chromatins which package RNA were beginning to stick together in the healthy cells. The chromatin aids cell’s mitosis and avoids chromosome rupture [50] and hence sustains cell RNA integrity and controls RNA replication and subsequently gene expression [51]. Moreover, the extract treated virus-infected cells showed evidence of change in ultrastructure. The extract acted as a therapy to the infected cells. Our result showed that the extract ordered the cell’s machinery in a way that virus could not further replicate. There was evidence of dense cytoplasm, the distinct nuclear membrane separating the nucleus from the cytoplasm. This simply implies that these extracts could potentially be used to treat or control norovirus infection.

Studies have shown that plant extracts have gained a science-based foundation in the treatment of bacterial diseases [52]. For example, the alcoholic extracts of Hemidesmus indicus, Leucas aspera, and Tridax procumbens have shown to involve blebbing and leakage of cellular contents and disruption of membrane potential [14] Antifungal activity of Momordica charantia seed extracts is known to cause a loss of integrity of cell wall, disruption of the cell membrane, and deformation of cells with irregular budding [53]. A study of the antiviral effect of Brazillian Cerrado against the avian metapneumovirus suggested that the extract acted during the adsorption phase as 99% viral replication was inhibited [54].

Z. armatum has a wide medicinal use. Both the fruits and seeds are typically used in controlling fever and dyspepsia, anthelmintic, stomachic, and carminative, asthma, bronchitis. It has been scientifically proven to be anti-oxidative, anti-inflammatory, antimicrobial, anti-tumor, hepatic-protective, piscidal, insecticidal and larvicidal activities [55].

H. sabdariffa is widely used as herbal medicine and drinks, food, hot and cold beverages, as flavoring agent. H. sabdariffa is known to treat various cardiovascular risk factors including hypertension, hypotension, hyperlipidemia in Jordan, Greece, Brazil, and obesity [56] [57] [58]. The extract of H. sabdariffa has evidently proven to possess antioxidant, hepatic- and nephroprotective, antidiabetic, anti-hypertensive, anti-cholesterol effects. Anti-toxicity effect of this plant has been proven to be culprit for these multifactorial jobs [59].

The Real-time quantitative polymerase chain reaction (RT-qPCR) is the standard method for gene expression analysis. It is a convenient and fast method that gives the user the opportunity to monitor the PCR reaction in real time [60]. Gene expression is inversely proportional to Ct values (threshold cycle) [61]. The threshold is a point where threshold line intersects reaction curve and a level above background fluorescence usually located at the beginning of the exponential phase. Our study has shown that the positive control had a Ct value of 28 whereas the negative control has a Ct value of 38. This suggests more expression of the gene of interest. We found that higher gene expression of ORF was significantly associated cells treated were Hibiscus sabdariffa (HS) calyces and Zanthoxylum armatum (ZA) seed extracts. The expression of ORF genes could potentially code for proteins thus providing evidence or support the theory of the role of restoration of cells organelles in response to plants extracts from the effect of norovirus infection.

It has been shown that Ct values below 29 cycles indicate much availability of targeted nucleic acid and Ct values above 38 cycles show very small amounts of targeted nucleic acids [62]. Our treated samples showed very low Ct values of 10 and 8 (HS and ZA positive) and 15 and 12 (HS and ZA negative), respectively. These values suggest that the amount of gene expression in ZA is insignificantly higher than that those in HS. The genome of interest embodies three open reading frames (ORFs), the gene. The ORF1 has the specific function of encoding polypeptide with regions of close relationship to cysteine proteinase, helicase, and RNA-dependent RNA polymerase (RdRp)-encoding regions. The second ORF (ORF2) encodes viral capsid protein (VP1), and ORF3 encodes small structural protein (VP2) linked with VP1 strength [63]. Treated HS and ZA have shown approximately three-fold and four-fold changes respectively. The fold change reflects the impact of the extracts on the ORF 1 and 2 genes. This further strengthened the activities of macrophages to maintaining structural integrity of the cell. Murine norovirus acts in different ways to the cells including eroding the cytoplasmic contents and invariably affecting the intact nucleus. These norovirus influences invariably cause changes in gene expression of cells treated with plant extracts [64]. In another study, doxorubicin involved in enzyme inhibition and DNA damage subsequently cause changes in gene expression of treated cells [65]. Viral replication depends on the metabolic pathways of the host cell. Many viruses have also evolved to modify many host pathways [66]. Studies have shown that the MNV genome shows a high degree of structural resemblance to that of human norovirus, with the three essential ORFs encoded inside the human norovirus genome having a straight homolog in MNV (A-4) [67]. The murine norovirus genes of interest are three overlapping open reading frames (ORFs). The ORFs encode cysteine proteinase, helicase (ORF-1), viral capsid (ORF2), and minor structural protein connected with VP1 firmness [68].

5. Conclusion

Current advances in molecular diagnostics have helped to establish norovirus as the most common cause of outbreaks of acute gastroenteritis across all ages. Hibiscus sabdariffa (HS) calyces and Zanthoxylum armatum (ZA) exhibit antiviral activities. Cells treated with HS and ZA extracts were associated with dense cytoplasm, the distinct nuclear membrane separating the nucleus from the cytoplasm from the extract-treated cells which impair replication. Replication was also affected by the expression of several genes.

Acknowledgements

This research was financially supported in part by Agriculture and Food Research Initiative grant No. 2011-6800-30395 from the USDA National Institute of Food and Agriculture through the NoroCore project. The authors are grateful to Hal Makeel and Dr. Ricardo Vancin from Duke Pathology Department for their contributions. We also extend our sincere gratitude to Mr. John Teleha for his assistance with the transfer from EndNote to RefWorks citation management.

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

References

[1] Niendorf, S., Jacobsen, S., Faber, M., Eis-Hübinger, A.M., Hofmann, J. and Bock, C.T. (2016) Steep Rise in Norovirus Cases and Emergence of a New Recombinant Strain GII.P16-GII.2, Germany, Winter 2016. Eurosurveillance, 22, 30447.
[CrossRef]
[2] Cannon, J.L., Barclay, L., Collins, N.R., Wikswo, M.E., Castro, C.J., Magaña, L.C. and Vinjé, J. (2017) Genetic and Epidemiologic Trends of Norovirus Outbreaks in the United States from 2013 to 2016 Demonstrated Emergence of Novel GII.4 Recombinant Viruses. Journal of Clinical Microbiology, 55, 2208-2221.
[CrossRef]
[3] Fu, J.-G., Shi, C., Xu, C., Lin, Q., Zhang, J., Yi, Q. and Xing, Z. (2017) Outbreaks of Acute Gastroenteritis Associated with a Re-Emerging GII.P16-GII.2 Norovirus in the Spring of 2017 in Jiangsu, China Public Library of Science. PLOS ONE, 12, e0186090.
[CrossRef] [PubMed]
[4] Iaconelli, M., Muscillo, M., Della Libera, S., Fratini, M., Meucci, L., De Ceglia, M. and La Rosa, G. (2017) One-Year Surveillance of Human Enteric Viruses in Raw and Treated Wastewaters, Downstream River Waters, and Drinking Waters. Food and Environmental Virology, 9, 79-88.
[CrossRef] [PubMed]
[5] Iloghalu, U. and Khatiwada, P. (2015) Phytochemicals: Natural Remedies for Emerging Viral Infection. Medicinal & Aromatic Plants, 4, Article 213.
[6] Moore, M.D., Goulter, R.M. and Jaykus, L. (2015) Human Norovirus as a Foodborne Pathogen: Challenges and Developments. Annual Review of Food Science and Technology, 6, 411-433.
[CrossRef] [PubMed]
[7] Saxena, K., Blutt, S.E., Ettayebi, K., Zeng, X., Broughman, J.R., Crawford, S.E. and Estes, M.K. (2016) Human Intestinal Enteroids: A New Model to Study Human Rotavirus Infection, Host Restriction, and Pathophysiology. Journal of Virology, 90, 43-56.
[CrossRef]
[8] Rajagopalan, S. and Yoshikawa, T.T. (2016) Norovirus Infections in Long-Term Care Facilities. Journal of the American Geriatrics Society (JAGS), 64, 1097-1103.
[CrossRef] [PubMed]
[9] Lucht, J.M. (2015) Public Acceptance of Plant Biotechnology and GM Crops. Viruses, 7, 4254-4281.
[CrossRef] [PubMed]
[10] Scarpellini, E., Ianiro, G., Attili, F., Bassanelli, C., De Santis, A. and Gasbarrini, A. (2015) The Human Gut Microbiota and Virome: Potential Therapeutic Implications. Digestive and Liver Disease, 47, 1007-1012.
[CrossRef] [PubMed]
[11] Nisa, H., Kamili, A.N., Nawchoo, I.A., Shafi, S., Shameem, N. and Bandh, S.A. (2015) Fungal Endophytes as Prolific Source of Phytochemicals and Other Bioactive Natural Products: A Review. Microbial Pathogenesis, 82, 50-59.
[CrossRef] [PubMed]
[12] Shakeri, A., Zirak, M.R. and Sahebkar, A. (2018) Ellagic Acid: A Logical Lead for Drug Development? Current Pharmaceutical Design, 24, 106-122.
[CrossRef] [PubMed]
[13] Mwitari, P.G., Ayeka, P.A., Ondicho, J., Matu, E.N. and Bii, C.C. (2013) Antimicrobial Activity and Probable Mechanisms of Action of Medicinal Plants of Kenya: Withania Somnifera, Warbugia Ugandensis, Prunus Africana and Plectrunthus Barbatus. PLOS ONE, 8, e65619.
[CrossRef] [PubMed]
[14] Saritha, K., Rajesh, A., Manjulatha, K., Setty, O.H. and Yenugu, S. (2015) Mechanism of Antibacterial Action of the Alcoholic Extracts of Hemidesmus indicus (L.) R. Br. ex Schult, Leucas aspera (Wild.), Plumbago zeylanica L., and Tridax procumbens (L.) R. Br. ex Schult. Frontiers in Microbiology, 6, Article 577.
[CrossRef] [PubMed]
[15] Tran, T.T., Kim, M., Jang, Y., Lee, H., Nguyen, H., Nguyen, T., Park, H., Dang, Q. and Kim, J.-C. (2017) Characterization and Mechanisms of Anti-Influenza Virus Metabolites Isolated from the Vietnamese Medicinal Plant Polygonum chinense. BMC Complementary and Alternative Medicine, 17, Article No. 162.
[CrossRef] [PubMed]
[16] Raina, H., Soni, G., Jauhari, N., Sharma, N. and Bharadvaja, N. (2014) Phytochemical Importance of Medicinal Plants as Potential Sources of Anticancer Agents. Turkish Journal of Botany, 38, 1027-1035.
[CrossRef]
[17] Domaszewska-Szostek, A., Puzianowska-Kuźnicka, M. and Kuryłowicz, A. (2021) Flavonoids in Skin Senescence Prevention and Treatment. International Journal of Molecular Sciences, 22, Article 6814.
[CrossRef] [PubMed]
[18] Iloghalu, U., Holmes, B., Khatiwada, J. and Williams, L.L. (2019) Selected Plant Extracts Show Antiviral Effects against Murine Norovirus Surrogate. Advances in Microbiology, 9, 372-384.
[CrossRef]
[19] Su, X. and D’Souza, D. (2013) Naturally Occurring Flavonoids against Human Norovirus Surrogates. Food and Environmental Virology, 5, 97-102.
[CrossRef] [PubMed]
[20] Laue, M. and Bannert, N. (2010) Detection Limit of Negative Staining Electron Microscopy for the Diagnosis of Bioterrorism-Related Micro-Organisms. Journal of Applied Microbiology, 109, 1159-1168.
[CrossRef] [PubMed]
[21] Garcia, A., Pratap, P.R., Lüpfert, C., Cornelius, F., Jacquemin, D., Lev, B., Allen, T. and Clarke, R.J. (2017) The Voltage-Sensitive Dye RH421 Detects a Na+, K+-ATPase Conformational Change at the Membrane Surface. Bochimica et Biophysica Acta-Biomembranes, 1859, 813-823.
[CrossRef] [PubMed]
[22] Carmona-Rivera, C. and Kaplan, M.J. (2016) Induction and Quantification of NETosis. Current Protocols in Immunology, 115, 14.41.1-14.41.14.
[CrossRef] [PubMed]
[23] Miller, S.E. (2010) Electron Microscopy of Viral Infections. In: Jerome, K.R., Ed., Lennette’s Laboratory Diagnosis of Viral Infections, CRC Press, Boca Raton, 173-196.
[CrossRef]
[24] He, S.L. and Green, R. (2013) Northern Blotting. In: Colowick, S.P. and Kaplan, N.O., Eds., Methods in Enzymology, Elsevier Science & Technology, United States, 75-87.
[CrossRef]
[25] Vashist, S., Urena, L. and Goodfellow, I. (2012) Development of a Strand Specific Real-Time RT-qPCR Assay for the Detection and Quantitation of Murine Norovirus RNA. Journal of Virological Methods, 184, 69-76.
[CrossRef] [PubMed]
[26] Soliman, S., Mohammad, M.G., El-Keblawy, A.A., Omar, H., Abouleish, M., Madkour, M. and Hosni, R.M. (2018) Mechanical and Phytochemical Protection Mechanisms of Calligonum Comosum in Arid Deserts Public Library of Science. PLOS ONE, 13, e0192576.
[CrossRef] [PubMed]
[27] Nunes, M.A., Rodrigues, F., Alves, R.C. and Oliveira, M.B.P.P. (2017) Herbal Products Containing Hibiscus sabdariffa L., Crataegus spp., and Panax spp.: Labeling and Safety Concerns. Food Research International, 100, 529-540.
[CrossRef] [PubMed]
[28] Ashafa, A.O.T. and Alayande, K.A. (2017) Evaluation of Cytotoxic Effects and Antimicrobial Activities of Lecaniodiscus cupanioides (Planch.) Leaf Extract. Transactions of the Royal Society of South Africa, 72, 33-38.
[CrossRef]
[29] Šmejkal, K., Malaník, M., Zhaparkulova, K., Sakipova, Z., Ibragimova, L., Ibadullaeva, G. and Žemlička, M. (2016) Kazakh Ziziphora Species as Sources of Bioactive Substances. Molecules (Basel, Switzerland), 21, Article 826.
[CrossRef] [PubMed]
[30] Raafat, K.M. and Samy, W. (2018) Phytochemical and Biological Evaluation of Ultrasound-Assisted Spray Dried Lonicera Etrusca for Potential Management of Diabetes. Records of Natural Products, 12, 367-379.
[CrossRef]
[31] Anand, S., Mandal, S., Patil, P. and Tomar, S.K. (2016) Pathogen-Induced Secretory Diarrhea and Its Prevention. European Journal of Clinical Microbiology & Infectious Diseases, 35, 1721-1739.
[CrossRef] [PubMed]
[32] Zhang, T., Wen, F., Wu, Y., Goh, G.S.H., Ge, Z., Tan, L.P. and Yang, Z. (2015) Cross-Talk between TGF-Beta/SMAD and Integrin Signaling Pathways in Regulating Hypertrophy of Mesenchymal Stem Cell Chondrogenesis under Deferral Dynamic Compression. Biomaterials, 38, 72-85.
[CrossRef] [PubMed]
[33] Varela-López, A., Bullón, P., Giampieri, F. and Quiles, J.L. (2015) Non-Nutrient, Naturally Occurring Phenolic Compounds with Antioxidant Activity for the Prevention and Treatment of Periodontal Diseases. Antioxidants, 4, 447-481.
[CrossRef] [PubMed]
[34] Zheng, D., Zou, Y., Cobbina, S.J., Wang, W., Li, Q., Chen, Y. and Wu, X. (2016) Purification, Characterization and Immunoregulatory Activity of a Polysaccharide Isolated from Hibiscus sabdariffa L. Journal of the Science of Food and Agriculture, 97, 1599-1606.
[CrossRef] [PubMed]
[35] Rajab, N.F., Musa, S.M., Munawar, M.A., Mun, L.L., Yen, H.K., Ibrahim, F.W. and Meng, C.K. (2016) Anti-Neuroinflammatory Effects of Hibiscus Sabdariffa Linn. (Roselle) on Lipopolysaccharides-Induced Microglia and Neuroblastoma Cells. Kesan Anti-Neuroinflammatori Hibiscus sabdariffa Linn. (Roselle) Pada Aruhan Lipopolisakarida Sel Mikroglia dan Neuroblastoma. Jurnal Sains Kesihatan Malaysia, 14, 111-117.
[CrossRef]
[36] Riaz, G. and Chopra, R. (2018) A Review on Phytochemistry and Therapeutic Uses of Hibiscus sabdariffa L. Biomedicine & Pharmacotherapy, 102, 575-586.
[CrossRef] [PubMed]
[37] Hajifaraji, M., Matlabi, M., Ahmadzadeh-Sani, F., Mehrabi, Y., Rezaee, M.S., Hajimehdipour, H. and Roghani, K. (2018) Effects of Aqueous Extracts of Dried Calyx of Sour Tea (Hibiscus sabdariffa L.) on Polygenic Dyslipidemia: A Randomized Clinical Trial. Avicenna Journal of Phytomedicine, 8, 24-32.
[38] Purohit, S., Jugran, A.K., Bhatt, I.D., Palni, L.M.S., Bhatt, A. and Nandi, S.K. (2017) In Vitro Approaches for Conservation and Reducing Juvenility of Zanthoxylum armatum Dc: An Endangered Medicinal Plant of Himalayan Region. Trees: Structure & Function, 31, 1101-1108.
[CrossRef]
[39] Negi, J.S., Bisht, V.K., Bhandari, A.K., Bisht, R. and Negi, S.K. (2012) Major Constituents, Antioxidant and Antibacterial Activities of Zanthoxylum armatum DC. Essential Oil. Iranian Journal of Pharmacology & Therapeutics, 11, 68-72.
[40] Roingeard, P. (2008) Viral Detection by Electron Microscopy: Past, Present and Future. Biology of the Cell, 100, 491-501.
[CrossRef]
[41] Goldsmith, C.S. and Miller, S.E. (2009) Modern Uses of Electron Microscopy for Detection of Viruses. Clinical Microbiology Reviews, 22, 552-563.
[CrossRef]
[42] Madani, T.A., El-Tayb, M.E.A., et al. (2017) Electron Microscopy of Alkhumra Hemorrhagic Fever Virus. Mary Ann Liebert, 17, 195-199.
[CrossRef] [PubMed]
[43] Monninger, M.K., Nguessan, C.A., Blancett, C.D., Kuehl, K.A., Rossi, C.A., Olschner, S.P., et al. (2016) Preparation of Viral Samples within Biocontainment for Ultrastructural Analysis: Utilization of an Innovative Processing Capsule for Negative Staining. Journal of Virological Methods, 238, 70-76.
[CrossRef] [PubMed]
[44] Yu, Y., Tan, Q., Zhao, W., Zhang, X., Ma, J., Wu, Z., Zhu, Z. and Cui, Y. (2017) Characterization of an Orf Virus Isolated from an Outbreak in Heilongjiang Province, China. Archives of Virology, 162, 3134-3149.
[CrossRef] [PubMed]
[45] Carrasco, L. (2018) Mechanisms of Viral Toxicity in Animal Cells. CRC Press, Boca Raton.
[CrossRef]
[46] Ailte, I., Lingelem, A.B.D., Kvalvaag, A.S., Kavaliauskiene, S., Brech, A., Koster, G. and Sandvig, K. (2017) Exogenous Lysophospholipids with Large Head Groups Perturb Clathrin-Mediated Endocytosis. Traffic, 18, 176-191.
[CrossRef] [PubMed]
[47] Prosser, D.C. and Wendland, B. (2016) DePFth Perception in Clathrin-Mediated Endocytosis. Developmental Cell, 37, 387-388.
[CrossRef] [PubMed]
[48] Ruba, A. and Yang, W. (2016) O-GlcNAc-ylation in the Nuclear Pore Complex. Cellular and Molecular Bioengineering, 9, 227-233.
[CrossRef] [PubMed]
[49] Lin, D.H., Stuwe, T., Schilbach, S., Rundlet, E.J., Perriches, T., Mobbs, G. and Hoelz, A. (2016) Architecture of the Symmetric Core of the Nuclear Pore. Science (American Association for the Advancement of Science), 352, aaf1015.
[CrossRef] [PubMed]
[50] Lieberman, P.M. (2008) Chromatin Organization and Virus Gene Expression. Journal of Cellular Physiology, 216, 295-302.
[CrossRef] [PubMed]
[51] Wang, X., Ma, Z., Kong, X. and Lv, Z. (2016) Effects of RNAs on Chromatin Accessibility and Gene Expression Suggest RNA-Mediated Activation. The International Journal of Biochemistry & Cell Biology, 79, 24-32.
[CrossRef] [PubMed]
[52] Schmidt, H.B. and Görlich, D. (2016) Transport Selectivity of Nuclear Pores, Phase Separation, and Membraneless Organelles. Trends in Biochemical Sciences, 41, 46-61.
[CrossRef] [PubMed]
[53] Wang, S.Z., Zheng, Y.L., Xiang, F., Li, S. and Yang, G.L. (2016) Antifungal Activity of Momordica charantia Seed Extracts toward the Pathogenic Fungus Fusarium solani L. Journal of Food and Drug Analysis, 24, 881-887.
[CrossRef] [PubMed]
[54] Kohn, L.K., Foglio, M.A., Rodrigues, R.A., Sousa, I.D.O., Martini, M.C., Padilla, M.A. and Arns, C.W. (2015) In-Vitro Antiviral Activities of Extracts Of plants of the Brazilian Cerrado against the Avian Metapneumovirus (aMPV). Revista Brasileira de Ciência Avícola, 17, 275-280.
[Google Scholar] [CrossRef]
[55] Latika, B., Aseesh, P. and Sushma, T. (2013) An Overview on Phytomedicinal Approaches of Zanthoxylum armatum DC. An Important Magical Medicinal Plant. Journal of Medicinal Plants Research, 7, 366-370.
[56] Abu-Irmaileh, B.E. and Afifi, F.U. (2003) Herbal Medicine in Jordan with Special Emphasis on Commonly Used Herbs. Journal of Ethnopharmacology, 89, 193-197.
[CrossRef]
[57] AbouZid, S.F. and Mohamed, A.A. (2011) Survey on Medicinal Plants and Spices Used in Beni-Sueif, Upper Egypt. Journal of Ethnobiology and Ethnomedicine, 7, Article No. 18.
[CrossRef] [PubMed]
[58] Alzweiri, M., Al Sarhan, A., Mansi, K., Hudaib, M. and Aburjai, T. (2011) Ethnopharmacological Survey of Medicinal Herbs in Jordan, the Northern Badia Region. Journal of Ethnopharmacology, 137, 27-35.
[CrossRef] [PubMed]
[59] Da-Costa-Rocha, I., Bonnlaender, B., Siever, H., Pischel, I. and Heinrich, M. (2014) Hibiscus sabdafiffa L.—A Phytochemical and Pharmacological Review. Food Chemistry, 165, 424-443.
[CrossRef] [PubMed]
[60] Wagner, E.M. and Jones, J. (2013) Monitoring Gene Expression: Quantitative Real-Time RT-PCR. In: Freeman, L., Ed., Lipoproteins and Cardiovascular Disease. Methods in Molecular Biology, Humana Press, Totowa, NJ, 19-45.
[CrossRef] [PubMed]
[61] Nguyen, T.T.-T.N., Shynlova, O. and Lye, S.J. (2016) Matrix Metalloproteinase Expression in the Rat Myometrium during Pregnancy, Term Labor, and Postpartum. Biology of Reproduction, 95, 1-14.
[CrossRef] [PubMed]
[62] Farrar, J.S. and Wittwer, C.T. (2017) High-Resolution Melting Curve Analysis for Molecular Diagnostics. In: Patrinos, G.P., Ed., Molecular Diagnostics, Academic Press, Cambridge, MA, 79-102.
[CrossRef]
[63] Bull, R.A., Hansman, G.S., Clancy, L.E., Tanaka, M.M., Rawlinson, W.D. and White, P.A. (2005) Norovirus Recombination in ORF1/ORF2 Overlap. Emerging Infectious Diseases, 11, 1079-1085.
[CrossRef] [PubMed]
[64] Fraisse, A., Coudray-Meunier, C., Martin-Latil, S., Hennechart-Collette, C., Delannoy, S., Fach, P. and Perelle, S. (2017) Digital RT-PCR Method for Hepatitis A Virus and Norovirus Quantification in Soft Berries. International Journal of Food Microbiology, 243, 36-45.
[CrossRef] [PubMed]
[65] Drozd, E., Krzysztoń-Russjan, J. and Gruber, B. (2016) Doxorubicin Treatment of Cancer Cells Impairs Reverse Transcription and Affects the Interpretation of RT-qPCR Results. Cancer Genomics & Proteomics, 13, 161-170.
[66] Sanchez, E.L. and Lagunoff, M. (2015) Viral Activation of Cellular Metabolism. Virology, 479-480, 609-618.
[CrossRef] [PubMed]
[67] Herod, M.R., Salim, O., Skilton, R.J., Prince, C.A., Ward, V.K., Lambden, P.R. and Clarke, I.N. (2014) Expression of the Murine Norovirus (MNV) ORF1 Polyprotein is Sufficient to Induce Apoptosis in a Virus-Free Cell Model. PLOS ONE, 9, e90679.
[CrossRef] [PubMed]
[68] de Graaf, M., van Beek, J. and Koopmans, M.P.G. (2016) Human Norovirus Transmission and Evolution in a Changing World. Nature Reviews Microbiology, 14, 421-433.
[CrossRef] [PubMed]

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.