The two tail mutations, studied in this Short Communication, were isolated by the Berget Laboratory [17] . They were studied here because they were the only two mutations found to be located in the P22 TSP NTD [17] . The P22 TSP NTD domain is an important research focus of this laboratory. They were: hmH4-1 (G29R; GGG < codon 29 > AGG) and hmH3 (G71D; GGT < codon 71 > GAT). The following primers were used to transfer the Berget NTD mutations onto pET11a-TSP. The primers for the mutation hmH4-1 were: 5-G28R (or: aaagctgttgctaataggaaaatttacattggt) and 3-G28R (or: ac caatgtaaattttcctattagcaacagctt). The primers for the muta-

tion hmH3 were: 5G70D (or: attatcaacgcagccgataaaatcgtatacaac) and 3G70D (or: gttgtatacgattttatcggctgcgttgataat). The tail mutations were transferred from primers to the pET11a-TSP DNA by the StratagenQuikChange Mutagenesis protocol. The E. coli strain BL21/DE3, used for gene expression, was from Novagen.

The biological, recombinant and expression protocols have been described [16] [18] . The expression plasmid, pET11a-TSP containing a wild type copy of the P22 tailspike gene, was from Dr Peter Prevelige (University of Alabama at Birmingham, UAB). The protein function of the expressed cloned tail gene or gene variant was determined by the Berget Assay [16] . The Berget Assay is a high-expression variant of the functional petri plate assay devised by Schwarz and Berget [17] . It has been described in detail recently [16] .

Two previously identified mutations were localized to the gene region corresponding to the NTD. These mutations hmH4-1 and hmH3 were transferred to pET11a-TSP by the QuikChange Mutagenesis protocol and plasmid mutational sequences were confirmed by DNA sequencing using the sequencing facilities of the University of Alabama at Birmingham (UAB Heflin Genome Sequencing Facility).

The functional nature of hmH4-1 (pET11a-TSP-G29R), hmH3 (pET11a-TSP-G71D) and the wild type tail gene (pET11a-TSP) was determined by the Berget Assay [16] . This test measures but does not distinguish between all three tail activities: binding to the viral particle (NTD function), binding LPS and LPS hydrolysis by tail endorhamnosidase activity (both functions of the β-helix domain). By this simple yet extremely sensitive petri plate assay these tail variants had no detectable tail function while the wild type tail gene, carried on plasmid, pET11a-TSP, had tail activity. These data confirmed the previous determination of the tail function of these two tail mutations [17] . The amino acid substitutions at amino acid positions aa29 and aa71 (out of 666aa) were both localized to the surface of the NTD [15] . To determine if the mutational inactivation of tail function could be due to structural alteration, a SDS-PAGE analysis was carried out as described in the following section.

Protein separation by SDS-PAGE normally results in denaturation of the applied proteins and their separation according to size. If the protein sample is heated prior to application to SDS PAGE, all protein will migrate according to their molecular size with the fastest migration occurring with the smaller proteins. However, there are a very small number of proteins that are refractory to SDS denaturation (without prior heating), including the P22 TSP [19] . The P22 TSP migrates as a trimeric protein with no prior heating [13] . However, there is another example of altered tailspike electrophoretic migration. Tailspike mutants have been found that destabilize the NTD and a thermal intermediate has been identified both of which destabilize the NTD resulting in the same migration which is slightly faster than the unheated trimeric TSP [16] [20] [21] .

Thus the fully denatured, the NTD-denatured and wild type TSP conformations can be distinguished via electrophoretic migration study in SDS-PAGE with unheated samples. Such a study has been carried out and is depicted in Figure 2 and Figure 3. Figure 2 displays the partially purified extracts of WT TSP and TSP-G29K mutant protein while the gel figure (Figure 3) displays the partially purified extracts of WT TSP and TSP-G71D mutant protein. In both gels the WT TSP migrates above the 180 kDa marker (TSP is 210 kDa). In both cases, the fully denatured TSP migrates below the 90 kDa marker (TSP is 72 kDa monomer). The unheated forms of the TSP-G29K and TSP-G71D (Figure 2, Lane 5 and Figure 3, Lane 4 respectively) migrate below the WT TSP but well above their denatured forms (Figure 2, Lane 3 and Figure 3, Lane 2 respectively). This is the location of the previously identified TSP forms whose NTD was denatured but not the other domains.