<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">ABB</journal-id><journal-title-group><journal-title>Advances in Bioscience and Biotechnology</journal-title></journal-title-group><issn pub-type="epub">2156-8456</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/abb.2020.113007</article-id><article-id pub-id-type="publisher-id">ABB-99213</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Identification and Characterization of Bacterial Community Associated with the Chewed Feeding Waste of Red Palm Weevil in Infested Date Palm Trees
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>AbdulAziz</surname><given-names>M. A. Mohamed</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Muhammad</surname><given-names>Farooq</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Malabika</surname><given-names>Roy Pathak</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Agricultural Biotechnology Program, Department of Life Sciences, Arabian Gulf University, Manama, Kingdom of Bahrain</addr-line></aff><aff id="aff1"><addr-line>Agricultue Affairs, Ministry of Works, Municipalities Affairs and Urban Planning, Manama, Kingdom of Bahrain</addr-line></aff><pub-date pub-type="epub"><day>12</day><month>03</month><year>2020</year></pub-date><volume>11</volume><issue>03</issue><fpage>80</fpage><lpage>93</lpage><history><date date-type="received"><day>27,</day>	<month>January</month>	<year>2020</year></date><date date-type="rev-recd"><day>27,</day>	<month>March</month>	<year>2020</year>	</date><date date-type="accepted"><day>30,</day>	<month>March</month>	<year>2020</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Red palm weevil (RPW),
   
  Rhynchophorus ferrugineus
   (Olivier) (Coleoptera, Curculionidae), is considered one of the most damaging insect pests of date palms in the Kingdom of Bahrain. Large scale infestation of RPW to date palm trees leads to excessive feeding activity of the RPW larvae, which is carried out by microorganisms present within RPW and producing a wet fermenting material inside the trunk. Culture dependent-bacteria were isolated from feeding waste and identified by the sequencing of the 16S rRNA gene using 8F and 1492R universal primers. Among the culture-dependent isolated bacteria, 80% were identified
   
  by comparing 16S rRNA gene sequence in NCBI database, using BLAST program in GenBank. 85% of the identified bacteria were Gram-positive while the rest of them were Gram-negative. A high abundance of bacteria were from the Bacillaceae family and sixteen different species of Bacillus were identified in comparison with NCBI GenBank. The 16S rRNA gene sequences of identified bacterial strains have been submitted to GenBank. The phylogenetic relationship was studied using 16S rRNA gene sequences, the Gram-negative bacteria came in one clade while Gram-positive different Bacillus sp. and strains showed evolutionary closeness to each other and accordingly, they came in one major clade under three different sub-clades in the phylogenetic tree. The findings of new Bacillus strains in the natural habitat of the date plam trees in the Kingdom of Bahrain, pledge a vast area of research on RPW bio-control research arena.
 
</p></abstract><kwd-group><kwd>Red Palm Weevil (RPW)</kwd><kwd> Bacteria</kwd><kwd> Date Palm</kwd><kwd> Feeding Waste</kwd><kwd> 16S rRNA</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The red palm weevil (RPW), Rhynchophorus ferrugineus Olivier (Coleoptera: Curculionidae), is considered one of the most extensively dispersed and invasive pest of different palm genera around the globe while date palm is one of them [<xref ref-type="bibr" rid="scirp.99213-ref1">1</xref>]. RPW was first reported on coconut palm trees (Cocos nucifera) from South and Southeast Asia in the late 1980s. Gradually, the pest expanded its spread to the Middle East, Mediterranean basin, Africa, Europe, Australia, Caribbean islands and USA [<xref ref-type="bibr" rid="scirp.99213-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref5">5</xref>]. Date palm (Phoenix dactylifera, L. Arecales: Arecaceae), is socio-economically important monocotyledon woody perennial plant in the Kingdom of Bahrain. Currently, the main threat of the date palm trees in the country is the red palm weevil, Rhynchophorus ferrugineus (Olivier) (Coleoptera, Curculionidae). The red palm weevil (RPW) is an invasive wood-boring insect that has caused severe damage since its first introduction and attack of date palm trees in the mid-1990s in the Kingdom of Bahrain [<xref ref-type="bibr" rid="scirp.99213-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref7">7</xref>]. The RPW is one of the most destructive pests of date palms, the major fruit tree of arid, tropical and subtropical areas [<xref ref-type="bibr" rid="scirp.99213-ref8">8</xref>]. RPW is considered one of the serious pests for many palm species in the world, and withstand extreme weather [<xref ref-type="bibr" rid="scirp.99213-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref10">10</xref>].</p><p>Being a boring insect, adult RPW penetrates the date palm stem and feed on it. Insect infestation alters the health of palm trees by making hollow tunnels with brownish waste inside the trunk and finally kills the trees. So, the severely infested palms are susceptible to collapse [<xref ref-type="bibr" rid="scirp.99213-ref11">11</xref>]. The attack of RPW leads to the death of date palms within 6 - 8 months if untreated [<xref ref-type="bibr" rid="scirp.99213-ref12">12</xref>]. Wood feeding is known for their complex associations with a variety of microorganisms [<xref ref-type="bibr" rid="scirp.99213-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref14">14</xref>]. The substantial environmental and economic injury caused by this insect may be partially attributable to the symbiotic association of bacteria [<xref ref-type="bibr" rid="scirp.99213-ref15">15</xref>]. The gut microbiota of weevils harbor rich communities of symbiotic bacteria, play an important role in weevils digestive system and nutrient absorption [<xref ref-type="bibr" rid="scirp.99213-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref17">17</xref>]. Moreover, there is a report on the seasonal variation of weevil gut microbiota [<xref ref-type="bibr" rid="scirp.99213-ref18">18</xref>].</p><p>RPW larvae eat heartily within the apical growing point of the palms and produce wet fermented chewed waste material inside the tunnels and creating extensive damage [<xref ref-type="bibr" rid="scirp.99213-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref20">20</xref>]. A healthy, unfermented palm sap contains glucose and sucrose and lacking organic volatiles [<xref ref-type="bibr" rid="scirp.99213-ref21">21</xref>]. However, when it is exposed to bacteria, they use this sugar as substrate to produce fermented chewed waste that contains alcohols, ethyl esters, carbolic acids, acetate and Sulphur compounds and cause the unpleasant odor of the palm sap [<xref ref-type="bibr" rid="scirp.99213-ref22">22</xref>]. The feeding activity of larvae is mediated by facultative and obligate bacteria with fermentative metabolism was reported [<xref ref-type="bibr" rid="scirp.99213-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref15">15</xref>]. The isolation of three different Bacillus spp. was the only report from RPW infested date plam plants in Egypt [<xref ref-type="bibr" rid="scirp.99213-ref23">23</xref>]. Despite the huge damage caused by RPW and its larvae in date palms, very little is acknowledged internationally with no study about microbiota of its habitat in the Kingdom of Bahrain. Therefore, the study of the microbial community in the habitat of the RPW needs investigation that may help the development of biological control measure of RPW population in the Kingdom of Bahrain. The identification of microbial community by using amplification of 16S rRNA: encoding DNA (rDNA) or 16S rRNA by PCR has revealed immense phylogenetic diversity [<xref ref-type="bibr" rid="scirp.99213-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref26">26</xref>]. The 16S rRNA molecules are of valued phylogenetic marker for microorganisms because of their universal distribution, constant function and sequence variation [<xref ref-type="bibr" rid="scirp.99213-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref16">16</xref>]. Therefore, the goal of our study is to identify the culture-dependent bacterial community using PCR amplification of the 16S rRNA region and sequence analysis from chewed waste of RPW, collected from infested date palm trees.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Sampling of RPW Chewed Waste</title><p>The chewed waste of RPW (<xref ref-type="fig" rid="fig1">Figure 1</xref>) was used in all the experiments those were collected (28th December 2017) from trunk of infested date palm plantation located in Hoorat A’ali, Northern Governorate, Kingdom of Bahrain (Latitude: 26.167612 Longitude: 50.527532). Collected chewed materials stored at 4˚C for analysis.</p></sec><sec id="s2_2"><title>2.2. Processing of Chewed Waste for Culture Initiation</title><p>One gram of chewed waste was homogenized in 10 ml sterile distilled water following three different serial dilutions for plating in two different culture media; potato dextrose agar, Sigma Aldrich (PDA) and Luria-Bertani Agar, Difco<sup>TM</sup> Miller (LBA).</p></sec><sec id="s2_3"><title>2.3. Culture of Bacteria</title><p>Inoculum from three different dilutions was plated on PDA and LBA media. All plates were incubated at 37˚C for 72 hrs. Different bacterial colonies were clearly observed on all the plates (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)). Bacteria from the individual colony were isolated and sub-cultured separately in corresponding PDA and LBA media overnight (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)).</p></sec><sec id="s2_4"><title>2.4. Storage of Bacteria</title><p>Bacteria from each individual colony were further allowed to grow in LB broth and incubated on shaker at 37˚C at a speed of 150 rpm for overnight growth. Culture from each isolate was stored in 50% glycerol and stored in −80˚C for further use.</p></sec><sec id="s2_5"><title>2.5. Identification of Bacteria</title><p>At the first step of identification, all of the bacterial isolates were examined morphologically using standard Gram staining technique. Stained slides of bacteria were differentiated as Gram positive/negative class of bacteria using microscopic technique under (100&#215;) with oil immersion.</p></sec><sec id="s2_6"><title>2.6. Extraction of DNA</title><p>DNA was isolated from freshly grown overnight culture. The genomic DNA was isolated using kit (XG-2411-00), following the manufacturer’s instructions. The purity of the extracted DNA was confirmed by 1% agarose gel by visualization of DNA bands.</p></sec><sec id="s2_7"><title>2.7. PCR Amplification of the 16S rRNA Gene</title><p>Isolated DNAs of all bacteria were amplified with 16S rRNA specific universal primers 8F and 1492R (<xref ref-type="table" rid="table1">Table 1</xref>). The amplification was carried out in ABI Veriti</p><p>Thermal Cycler at initial denaturation 94˚C for 3 min, 35 cycles of 94˚C 30 sec, 52˚C 30 sec, and 72˚C 1 min, and a final extension at 72˚C for 7 min (<xref ref-type="table" rid="table2">Table 2</xref>). 1.2% Agarose gel was used to check the PCR amplified products. After visualization of amplified products under UV light using the gel documentation system (Zenith Biosciences, <xref ref-type="fig" rid="fig3">Figure 3</xref>(a), <xref ref-type="fig" rid="fig3">Figure 3</xref>(b)) were processed further for sequencing.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Composition and concentration of reagents used in reaction mixture for PCR of 16S rRNA gene amplification of culture dependent bacteria isolated from chewed waste of RPW</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Sr.</th><th align="center" valign="middle" >Reagents</th><th align="center" valign="middle" >Volume per Reaction (&#181;l)</th></tr></thead><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >DNA (25 ng)</td><td align="center" valign="middle" >1.0 &#181;l</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >8F Forward Primer (10 pM)</td><td align="center" valign="middle" >1.0 &#181;l</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >1492R Reverse Primer (10 pM)</td><td align="center" valign="middle" >1.0 &#181;l</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >2X PCR Master Mix</td><td align="center" valign="middle" >12.5 &#181;l</td></tr><tr><td align="center" valign="middle" >5</td><td align="center" valign="middle" >Nuclease Free Water</td><td align="center" valign="middle" >9.5 &#181;l</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Total Volume</td><td align="center" valign="middle" >25 &#181;l</td></tr></tbody></table></table-wrap><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> List of primers, their sequences and annealing temperature used in PCR amplification of 16SrRNA gene of culture dependent bacteria isolated from feeding waste of RPW chewed waste</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene</th><th align="center" valign="middle" >PCR Primers</th><th align="center" valign="middle" >Primer Sequence 5’-3’</th><th align="center" valign="middle" >Annealing Temp.</th><th align="center" valign="middle" >Sequencing Primer</th><th align="center" valign="middle" >Target Group</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >16S rRNA</td><td align="center" valign="middle" >8F</td><td align="center" valign="middle" >AGAGTTTGATCCTGGCTCAG</td><td align="center" valign="middle" >52˚C</td><td align="center" valign="middle" >8F*</td><td align="center" valign="middle"  rowspan="2"  >Universal</td><td align="center" valign="middle"  rowspan="2"  >Turner et al., 1999</td></tr><tr><td align="center" valign="middle" >1492R</td><td align="center" valign="middle" >GGTTACCTTGTTACGACTT</td><td align="center" valign="middle" >52˚C</td><td align="center" valign="middle" >1492R*</td></tr></tbody></table></table-wrap><p>*Bi-directional sequencing.</p></sec><sec id="s2_8"><title>2.8. Sequencing of 16S rRNA Gene</title><p>PCR amplicons were purified and sequenced using BDT v3.1, cycle sequencing kit on ABI 3730xl Genetic Analyzer (Applied Biosystems, USA), bi-directionally using 8F and 1492R primers. The sequencing used was set as 95˚C for 3 min and 25 cycles of (95˚C for 5 sec, 55˚C for 5 sec, and 60˚C for 4 min). Sequences were aligned using Codoncode aligner.</p></sec><sec id="s2_9"><title>2.9. Analysis of Sequences</title><p>The obtained 16S rRNA gene sequences of each isolate were used to carry out the BLAST analysis in NCBI Genbank database. Based on the maximum identity score, using multiple alignment software program ClustalW, sequences were compared. The 16S rRNA gene sequences of successful isolates were deposited in GenBank (<xref ref-type="table" rid="table4">Table 4</xref>).</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Gram Stain and Bacteria</title><p>RPW feeding waste contained an average of 1.2 - 1.9 &#215; 10<sup>9</sup> CFU/ml of bacteria in the serially diluted culture used for study. Twenty four culturable bacterial isolates were studied by Gram staining, among which 16 were Gram-positive (<xref ref-type="fig" rid="fig4">Figure 4</xref>(a)) and 8 were Gram-negative (<xref ref-type="fig" rid="fig4">Figure 4</xref>(b)). Gram-positive bacteria appeared as a purple-colored stain (<xref ref-type="fig" rid="fig4">Figure 4</xref>(a)) by taking crystal violet stain after washing, due to thick peptidoglycan layer of their cell wall. On the other hand, Gram-negative bacteria cannot retain the crystal violet stain after washing, due to their much thinner and sandwiched nature of peptidoglycan layer of their cell wall (<xref ref-type="fig" rid="fig4">Figure 4</xref>(b)).</p></sec><sec id="s3_2"><title>3.2. Identification of Culturable Bacteria from Chewed Waste of RPW</title><p>DNA were isolated and PCR amplified from all the culturable bacteria using 16S rRNA specific universal primers 8F and 1492R for identification as mentioned in</p><p><xref ref-type="table" rid="table1">Table 1</xref>. The PCR amplification was carried out following the conditions as mentioned in <xref ref-type="table" rid="table2">Table 2</xref>. 1.2% Agarose gel showed a single amplified DNA products of 1500 bp of all different bacterial isolatesas shown in <xref ref-type="fig" rid="fig3">Figure 3</xref>(a) and <xref ref-type="fig" rid="fig3">Figure 3</xref>(b) (only two different bacteria has presented). But, the bidirectional DNA sequencing products of PCR amplicons (1500 bp) of different bacterial isolates varied in sequencing results from 1316 bp to 1461 bp and showed in <xref ref-type="table" rid="table3">Table 3</xref>. Bacterial DNA isolated from chewed waste of RPW was identified using 16S rRNA gene sequence by BLAST alignment in NCBI site. The success of obtaining of sequence was 91.66% in this study. Bacteria were identified based on maximum sequence identity level in GenBank. Finally, 79.16% bacteria were identified using the BLAST program in reference to GenBank accession numbers (NCBI) which have been presented. The level of sequence identity percent varied from 94 to 100.</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> List of cultured bacteria, isolated from chewed waste of RPW were identified using 16SrRNA gene sequence by BLAST alignment in NCBI site. Bacteria were identified based on maximum sequence identity (%) level and NCBI accession numbers of compared bacteria have been presented</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Seq. ID</th><th align="center" valign="middle" >Sample ID</th><th align="center" valign="middle" >Sequence Size (bp)</th><th align="center" valign="middle" >Bacteria Showed Identity</th><th align="center" valign="middle" >Maximum Identity (%)</th><th align="center" valign="middle" >Accession Number of Compared Bacteria in NCBI GenBank</th></tr></thead><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >A1</td><td align="center" valign="middle" >1387</td><td align="center" valign="middle" >Bacillus cereus strain DM-5</td><td align="center" valign="middle" >97</td><td align="center" valign="middle" >MF967405.1</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >A2</td><td align="center" valign="middle" >1374</td><td align="center" valign="middle" >Bacillus tequilensis strain HBUM07078</td><td align="center" valign="middle" >99</td><td align="center" valign="middle" >MF662504.1</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >A3</td><td align="center" valign="middle" >1342</td><td align="center" valign="middle" >Bacillus pumilus strain O32</td><td align="center" valign="middle" >99</td><td align="center" valign="middle" >MG594819.1</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >A4</td><td align="center" valign="middle" >1340</td><td align="center" valign="middle" >Bacillus xiamenensis strain OOM58</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >MH542300.1</td></tr><tr><td align="center" valign="middle" >5</td><td align="center" valign="middle" >A5</td><td align="center" valign="middle" >1435</td><td align="center" valign="middle" >Bacillus altitudinis strain pk5</td><td align="center" valign="middle" >99</td><td align="center" valign="middle" >MH538127.1</td></tr><tr><td align="center" valign="middle" >6</td><td align="center" valign="middle" >A6</td><td align="center" valign="middle" >1359</td><td align="center" valign="middle" >Bacillus pumilus strain 2216E-X-48</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >MF594160.1</td></tr><tr><td align="center" valign="middle" >7</td><td align="center" valign="middle" >A7</td><td align="center" valign="middle" >1400</td><td align="center" valign="middle" >Bacillus wiedmannii strain K3</td><td align="center" valign="middle" >99</td><td align="center" valign="middle" >MK696254.1</td></tr><tr><td align="center" valign="middle" >8</td><td align="center" valign="middle" >A8</td><td align="center" valign="middle" >1462</td><td align="center" valign="middle" >Bacillus altitudinis strain FJAT-4778</td><td align="center" valign="middle" >99</td><td align="center" valign="middle" >MG651124.1</td></tr><tr><td align="center" valign="middle" >10</td><td align="center" valign="middle" >B1a</td><td align="center" valign="middle" >1461</td><td align="center" valign="middle" >Bacillus wiedmannii strain MOB-9</td><td align="center" valign="middle" >96</td><td align="center" valign="middle" >MH041258.1</td></tr><tr><td align="center" valign="middle" >11</td><td align="center" valign="middle" >B2</td><td align="center" valign="middle" >1374</td><td align="center" valign="middle" >Bacillus aerius R1.13</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >LC414168.1</td></tr><tr><td align="center" valign="middle" >12</td><td align="center" valign="middle" >B2a</td><td align="center" valign="middle" >1374</td><td align="center" valign="middle" >Bacillus stratosphericus strain MVGA162</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >KJ672346.1</td></tr><tr><td align="center" valign="middle" >13</td><td align="center" valign="middle" >B3</td><td align="center" valign="middle" >1386</td><td align="center" valign="middle" >Bacillus velezensis strain JK-XZ8</td><td align="center" valign="middle" >99</td><td align="center" valign="middle" >MK182932.1</td></tr><tr><td align="center" valign="middle" >14</td><td align="center" valign="middle" >B4</td><td align="center" valign="middle" >1316</td><td align="center" valign="middle" >Bacillus sp. SC24</td><td align="center" valign="middle" >98</td><td align="center" valign="middle" >KU353549.1</td></tr><tr><td align="center" valign="middle" >16</td><td align="center" valign="middle" >B6</td><td align="center" valign="middle" >1411</td><td align="center" valign="middle" >Achromobacter xylosoxidans strain R8-558</td><td align="center" valign="middle" >98</td><td align="center" valign="middle" >JQ659958.1</td></tr><tr><td align="center" valign="middle" >17</td><td align="center" valign="middle" >C1</td><td align="center" valign="middle" >1419</td><td align="center" valign="middle" >Bacillus methylotrophicus strain HGPY-3</td><td align="center" valign="middle" >99</td><td align="center" valign="middle" >KR708855.1</td></tr><tr><td align="center" valign="middle" >18</td><td align="center" valign="middle" >C2</td><td align="center" valign="middle" >1360</td><td align="center" valign="middle" >Bacillus amyloliquefaciens strain HTTM-X9894</td><td align="center" valign="middle" >99</td><td align="center" valign="middle" >KJ733016.1</td></tr><tr><td align="center" valign="middle" >19</td><td align="center" valign="middle" >C3</td><td align="center" valign="middle" >1366</td><td align="center" valign="middle" >Bacillus siamensis strain FL45</td><td align="center" valign="middle" >99</td><td align="center" valign="middle" >KY818963.1</td></tr><tr><td align="center" valign="middle" >21</td><td align="center" valign="middle" >C5</td><td align="center" valign="middle" >1366</td><td align="center" valign="middle" >Acetobacter ghanensis strain SKU7</td><td align="center" valign="middle" >94</td><td align="center" valign="middle" >AB906410.1</td></tr><tr><td align="center" valign="middle" >24</td><td align="center" valign="middle" >D3</td><td align="center" valign="middle" >1432</td><td align="center" valign="middle" >Vibrio alginolyticus strain NBRC 15630</td><td align="center" valign="middle" >99</td><td align="center" valign="middle" >NR_122059.1</td></tr></tbody></table></table-wrap></sec><sec id="s3_3"><title>3.3. Identified Bacteria and Phylogeny</title><p>The 16S rRNA gene sequence of identified bacteria has been submitted to NCBI GenBank and their sequence size, name and accession numbers have been presented in <xref ref-type="table" rid="table4">Table 4</xref>. The comparison of sequences with the global multiple sequence alignment (MSA), and the identification and submission of sequences in NCBI GenBank were adopted in this study. Sixty six percent of the identified bacteria were Gram-positive while the rest of them were Gram-negative. In the study, 86% of the bacteria were of different Bacillus species of different strains (Phylum: Firmicutes) and 14% were other bacteria (Achromobacter xylosoxidans strain MPF-B6, Acetobacter ghanensis strain MPF-C5, Vibrio alginolyticus strain MPF-D3). The Gram-positive Bacillus spp. (Family, Bacillaceae) belongs to Phylum Firmicutes and Gram-negative bacteria were of Proteobactera from three different families. The molecular phylogenic affinity was analyzed using sequences of 16S rRNA and a phylogenetic tree was constructed in <xref ref-type="fig" rid="fig5">Figure 5</xref>. The</p><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> List of GenBank (NCBI) accession number of culture dependent bacteria, isolated from chewed waste of RPW from RPW infested date palm tree in the Kingdom of Bahrain. The bacteria were identified based on 16S rRNA gene sequences</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Seq. ID.</th><th align="center" valign="middle" >Sample ID</th><th align="center" valign="middle" >Gram Stain</th><th align="center" valign="middle" >Sequence Size (bp)</th><th align="center" valign="middle" >Name of Identified Bacteria</th><th align="center" valign="middle" >Accession Number of Identified Bacteria</th></tr></thead><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >A1</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1387</td><td align="center" valign="middle" >Bacillus cereus strain MPF-A1</td><td align="center" valign="middle" >MK9491150</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >A2</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1374</td><td align="center" valign="middle" >Bacillus tequilensis strain MPF-A2</td><td align="center" valign="middle" >MK949341</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >A3</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1342</td><td align="center" valign="middle" >Bacillus pumilus strain MPF-A3</td><td align="center" valign="middle" >MK949342</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >A4</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1340</td><td align="center" valign="middle" >Bacillus xiamenensis strain MPF-A4</td><td align="center" valign="middle" >MK949343</td></tr><tr><td align="center" valign="middle" >5</td><td align="center" valign="middle" >A5</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1435</td><td align="center" valign="middle" >Bacillus altitudinis strain MPF-A5</td><td align="center" valign="middle" >MK949344</td></tr><tr><td align="center" valign="middle" >6</td><td align="center" valign="middle" >A6</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1359</td><td align="center" valign="middle" >Bacillus pumilus strain MPF-A6</td><td align="center" valign="middle" >MK949345</td></tr><tr><td align="center" valign="middle" >7</td><td align="center" valign="middle" >A7</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1400</td><td align="center" valign="middle" >Bacillus wiedmannii strain MPF-A7</td><td align="center" valign="middle" >MK949346</td></tr><tr><td align="center" valign="middle" >8</td><td align="center" valign="middle" >A8</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1462</td><td align="center" valign="middle" >Bacillus altitudinis strain MPF-A8</td><td align="center" valign="middle" >MK949347</td></tr><tr><td align="center" valign="middle" >10</td><td align="center" valign="middle" >B1a</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1461</td><td align="center" valign="middle" >Bacillus wiedmannii strain MPF-B1a</td><td align="center" valign="middle" >MK949348</td></tr><tr><td align="center" valign="middle" >11</td><td align="center" valign="middle" >B2</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1374</td><td align="center" valign="middle" >Bacillus aerius strain MPF-B2</td><td align="center" valign="middle" >MK949349</td></tr><tr><td align="center" valign="middle" >12</td><td align="center" valign="middle" >B2a</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1374</td><td align="center" valign="middle" >Bacillus stratosphericus strain MPF-B2a</td><td align="center" valign="middle" >MK949350</td></tr><tr><td align="center" valign="middle" >13</td><td align="center" valign="middle" >B3</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1386</td><td align="center" valign="middle" >Bacillus velezensis strain MPF-B3</td><td align="center" valign="middle" >MK949351</td></tr><tr><td align="center" valign="middle" >14</td><td align="center" valign="middle" >B4</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1316</td><td align="center" valign="middle" >Bacillus sp. strain MPF-B4</td><td align="center" valign="middle" >MK949352</td></tr><tr><td align="center" valign="middle" >16</td><td align="center" valign="middle" >B6</td><td align="center" valign="middle" >Gram negative</td><td align="center" valign="middle" >1411</td><td align="center" valign="middle" >Achromobacter xylosoxidans strain MPF-B6</td><td align="center" valign="middle" >MK949353</td></tr><tr><td align="center" valign="middle" >17</td><td align="center" valign="middle" >C1</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1419</td><td align="center" valign="middle" >Bacillus methylotrophicus strain MPF-C1</td><td align="center" valign="middle" >MK949354</td></tr><tr><td align="center" valign="middle" >18</td><td align="center" valign="middle" >C2</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1360</td><td align="center" valign="middle" >Bacillus amyloliquefaciens strain MPF-C2</td><td align="center" valign="middle" >MK949355</td></tr><tr><td align="center" valign="middle" >19</td><td align="center" valign="middle" >C3</td><td align="center" valign="middle" >Gram positive</td><td align="center" valign="middle" >1366</td><td align="center" valign="middle" >Bacillus siamensis strain MPF-C3</td><td align="center" valign="middle" >MK949356</td></tr><tr><td align="center" valign="middle" >21</td><td align="center" valign="middle" >C5</td><td align="center" valign="middle" >Gram negative</td><td align="center" valign="middle" >1366</td><td align="center" valign="middle" >Acetobacter ghanensis strain MPF-C5</td><td align="center" valign="middle" >MK949357</td></tr><tr><td align="center" valign="middle" >24</td><td align="center" valign="middle" >D3</td><td align="center" valign="middle" >Gram negative</td><td align="center" valign="middle" >1432</td><td align="center" valign="middle" >Vibrio alginolyticus strain MPF-D3</td><td align="center" valign="middle" >MK949358</td></tr></tbody></table></table-wrap><p>phylogenic relationship and evolutionary history was drawn using neighbor-joining method [<xref ref-type="bibr" rid="scirp.99213-ref27">27</xref>] in MEGA7 software [<xref ref-type="bibr" rid="scirp.99213-ref28">28</xref>]. According to the 16S rRNA gene sequences, B. amyloliquefaciens strain MPF-C2, B. siamensis strain MPF-C3, B. methylotrophicus strain MPF-C1, B. tequilensis strain MPF-A2, B. wiedmannii strain MPF-B1a, all showed closeness and came in one clade in the phylogenic tree. The analysis of pairwise distance data and evolutionary divergence between the sequences uses the Kimura-2-parameter following transitions and transversions of the codons as mentioned in program. It showed 67%, 70% and 70% distance between B. amyloliquefaciens and the sequences of V. alginolyticus strain MPF-D3, Acetobacter ghanensis strain MPF-C5, Achromobacter xylosoxidans strain MPF-B6 respectively within their evolutionary history.</p><p>The phylogenetic relationship was studied using 16S rRNA gene sequences, the Gram-negative bacteria came in one clade while Gram-positive different Bacillus sp. of different strains showed evolutionary closeness to each other and accordingly, they came in one major clade under three different sub-clades in the phylogenetic tree (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion</title><sec id="s4_1"><title>4.1. Impact of 16S rRNA Sequence Analysis</title><p>The identification of bacteria was done by using 16S rRNA gene sequence analysis using NCBI site with comparison (<xref ref-type="table" rid="table3">Table 3</xref> and <xref ref-type="table" rid="table4">Table 4</xref>). Comparison of the bacterial 16S rRNA gene sequence has characterized as a preferred genetic technique to identify poorly described, rarely isolated, or phenotypically aberrant strains of bacteria from any source [<xref ref-type="bibr" rid="scirp.99213-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref30">30</xref>]. Sequence identity searching, specifically using the BLAST program in NCBI, is the most widely used and most reliable, for identifying and characterizing newly determined sequences with great reliability [<xref ref-type="bibr" rid="scirp.99213-ref31">31</xref>]. Among the culture-dependent isolated bacteria, 80% were identified by comparing 16S rRNA gene sequence in NCBI database, using BLAST. Among the identified bacteria, 85% were Gram-positive while the rest of them were Gram-negative. A high abundance of bacteria from the Bacillaceae family of Firmicutes phylum and sixteen different species of Bacillus were identified in comparison with NCBI GenBank. Other Gram-negative bacteria belong to Phylum Proteobacteria of three different families.</p></sec><sec id="s4_2"><title>4.2. Identified Bacteria and Phylogenetic Relation</title><p>The highest percentage of identified bacteria was of different Bacillus sp. of different strains that were present in feeding waste of RPW. There are several reports on RPW gut microbiota where mostly Bacillus sp. together with other bacteria observed. Those bacteria play an important role in RPW’s digestive system, nutrient absorption, degradation of lignocellulose, and their survival [<xref ref-type="bibr" rid="scirp.99213-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref32">32</xref>]. Several Bacillus sp has great medical, biotechnological and economic importance [<xref ref-type="bibr" rid="scirp.99213-ref33">33</xref>]. They are resistant to heat, radiation, chemicals, oxidizing agents and desiccation, due to spore production, which is an important condition for their adaptation to different ecological niches [<xref ref-type="bibr" rid="scirp.99213-ref34">34</xref>]. The identified organism B. tequilensis strain MPF-A2 showed a 99% sequence identity with B. tequilensis strain HBUM07078 and Bacillus subtilis strain 5723. Similarly, B. tequilensis sp. nov., showed close realation with Bacillus subtilis [<xref ref-type="bibr" rid="scirp.99213-ref35">35</xref>]. In another report, B. tequilensis GYLH001 regarded as endophytic bacteria and was used as biocontrol agent of fungus Magnaporthe oryzae causing rice blast [<xref ref-type="bibr" rid="scirp.99213-ref36">36</xref>]. Moreover, Bacillus altitudinis P-10 worked as potential bioprotectant against Xanthomonas oryzae pv. oryzae, isolated from rice rhizosphere in Java, Indonesia [<xref ref-type="bibr" rid="scirp.99213-ref37">37</xref>]. B. altitudinis, B. xiamenensis and B. pumilus are the phenotypically and genotipically very closely related species and they produce acid from cellobiose, glucose and mannose [<xref ref-type="bibr" rid="scirp.99213-ref38">38</xref>]. B. aerius and B. stratosphericus are recognized as enzyme producers with probiotic activity inindustrial uses [<xref ref-type="bibr" rid="scirp.99213-ref37">37</xref>]. Several Bacillus sp. viz. B. megaterium, B. laterosporus and B. sphaericus were isolated from natural habitats associated with RPW insect-damaged date palms in Egypt and their bioassay showed 40% - 60% killing of RPW larvae in feeding study [<xref ref-type="bibr" rid="scirp.99213-ref23">23</xref>]. Considering the huge economic and environmental damage caused by RPW, some attention has been paid to the efficacy of different chemical and biocontrol strategies [<xref ref-type="bibr" rid="scirp.99213-ref39">39</xref>] in regard to several bacterial species to use as biological control [<xref ref-type="bibr" rid="scirp.99213-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.99213-ref20">20</xref>].</p><p>In the phylogenetic study, the Gram-negative bacteria came in one clade while Gram-positive Bacillus sp. showed evolutionary closeness to each other and accordingly they came under one main clade with three different sub-clades in the phylogenetic tree.</p></sec></sec><sec id="s5"><title>5. Conclusion</title><p>Red palm weevil (RPW) is one of the major insect pests of date palm. In the current study, different bacteria were isolated and identified based on 16S rRNA sequence from the feeding waste of RPW. The identified strains of bacteria are mostly different species of Bacillus. As different studies showed the great significance of Bacillus spp. in infection control, this study intensifies the searching of new biocontrol agent of RPW pest management program.</p></sec><sec id="s6"><title>Acknowledgements</title><p>The research was supported by the Research Grant # “LS_AA_2017” from College of Graduate studies, Agricultural Biotechnology Program, Department of Life Sciences, Arabian Gulf University. The authors would like to thank Mr. Ahmed Ali Al-Asfoor, Plant Wealth Directorate, Agriculture Affairs, Ministry of Work, Municipalities and Urban Planning, for the technical help in the field and processing of red palm weevil feeding waste samples. We like to Acknowledge Mr. Ali Ebrahim Al-Mahmeed, AGU and Xcelrislabs, India for their support in analysis.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflict of interest.</p></sec><sec id="s8"><title>Cite this paper</title><p>Mohamed, A.M.A., Farooq, M. and Pathak, M.R. (2020) Identification and Characterization of Bacterial Community Associated with the Chewed Feeding Waste of Red Palm Weevil in Infested Date Palm Trees. Advances in Bioscience and Biotechnology, 11, 80-93. https://doi.org/10.4236/abb.2020.113007</p></sec></body><back><ref-list><title>References</title><ref id="scirp.99213-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Giblin-Davis, R. and Roda, A. (2013) Real Time Internet Invasive Pest Identification Training: A Case Study with Rhynchophorus Weevils. Florida Entomologist, 96, 741-745. https://doi.org/10.1653/024.096.0306</mixed-citation></ref><ref id="scirp.99213-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Dembilio, O., Jacas, J.A. and Llacer, E. (2009) Are the Palms Washingtonia filifera and Chamaerops humilis Suitable Hosts for the Red Palm Weevil, Rhynchophorus ferrugineus (Col. Curculionidae)? Journal of Applied Entomology, 133, 565-567.  
https://doi.org/10.1111/j.1439-0418.2009.01385.x</mixed-citation></ref><ref id="scirp.99213-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">El-mergawy, R., Nasr, M.I., Abdallah, N. and Silvain, J.F. (2011) Mitochondrial Genetic Variation and Invasion History of Red Palm Weevil, Rhynchophorus ferrugineus (Coleoptera; Crrculionidae), in Middle-East and Mediterranean Basin. International Journal of Agriculture and Biology, 13, 631-637.</mixed-citation></ref><ref id="scirp.99213-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Fiaboe, K.K.M., Peterson, A.T., Kairo, M.T.K. and Roda, A.L. (2012) Predicting the Potential Worldwide Distribution of the Red Weevil, Rhynchophorus ferrugineus (Olivier) Coleoptera: Curculionidae Using Ecological Niche Modeling. Florida Entomologist, 95, 659-673. https://doi.org/10.1653/024.095.0317</mixed-citation></ref><ref id="scirp.99213-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Wang, G., Zhang, X., Hou, Y. and Tang, B. (2015) Analysis of the Population Genetic Structure of Rhynchophorus ferrugineus in Fujian, China, Revealed by Microsatellite Loci and Mitochondrial COI Sequences. Entomologia Experimentalis et Applicata, 155, 28-38. https://doi.org/10.1111/eea.12282</mixed-citation></ref><ref id="scirp.99213-ref6"><label>6</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Long</surname><given-names> S. </given-names></name>,<etal>et al</etal>. (<year>2006</year>)<article-title>The Asian Red Palm Weevil, a Serous Pest of Canary Palm in Sicily</article-title><source> Informatore Fitopatologico</source><volume> 56</volume>,<fpage> 40</fpage>-<lpage>44</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.99213-ref7"><label>7</label><mixed-citation publication-type="book" xlink:type="simple">Almansoori, T., Al-Khalifa, A.M. and Mohamed, A. (2015) Date Palm Status and Perspective in Bahrain, p.353-386. In: Al-Khayri, J., Jain, S. and Johnson, D., Eds., Date Palm Genetic Resources and Utilization, Springer, Dordrecht, 353-386.  
https://doi.org/10.1007/978-94-017-9707-8_11</mixed-citation></ref><ref id="scirp.99213-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Bokhari, U.G. and Abuzuhira, R. (1992) Diagnostic Tests for Redpalm Weevil, Rhynchophorus ferrugineus Infested Date Palm Trees. Arab Journal of Scientific Research, 10, 93-104.</mixed-citation></ref><ref id="scirp.99213-ref9"><label>9</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Faleiro</surname><given-names> J. </given-names></name>,<etal>et al</etal>. (<year>2006</year>)<article-title>A Review of the Issues and Management of the Red Palm Weevil Rhynchophorus ferrugineus (Coleoptera: Rhynchophoridae) in Coconut and Date Palm during the Last One Hundred Years</article-title><source> International Journal of Tropical Insect Science</source><volume> 26</volume>,<fpage> 135</fpage>-<lpage>154</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.99213-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Valzano, M., et al. (2012) Deciphering Microbiota Associated to Rhynchophorus ferrugineus in Italian Samples: A Preliminary Study. Journal of Entomological and Acarological Research, 44, 85-89. https://doi.org/10.4081/jear.2012.e16</mixed-citation></ref><ref id="scirp.99213-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Kaakeh, W. (2006) Toxicity of Imidacloprid to Developmental Stages of Rhynchophorus ferrugineus (Curculionidae: Coleoptera): Laboratory and Field Tests. Crop Protection, 25, 432-439. https://doi.org/10.1016/j.cropro.2005.07.006</mixed-citation></ref><ref id="scirp.99213-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Murphy, S.T. and Briscoe, B.R. (1999) The Red Palm Weevil as an Alien Invasive: Biology and the Prospects for Biological Control as a Component of IPM. Biocontrol News and Information, 20, 35-45.</mixed-citation></ref><ref id="scirp.99213-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Khiyami, M. and Alyamani, E. (2008) Aerobic and Facultative Aneorobic Bacteria from Gut of Red Palm Weevil (Rhinocophorus ferrugineus). African Journal of Biotechnology, 7, 1432-1437.</mixed-citation></ref><ref id="scirp.99213-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Engel, P. and Moran, N.A. (2013) The Gut Microbiota of Insects: Diversity in Structure and Function. FEMS Microbiology Reviews, 37, 699-735.  
https://doi.org/10.1111/1574-6976.12025</mixed-citation></ref><ref id="scirp.99213-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Tagliavia, M., et al. (2014) The Gut Microbiota of Larvae of Rhinochophorus ferrugineus Olivar (Coleoptra: Curculionidae). BMC Microbiology, 14, Article No. 136.  
https://doi.org/10.1186/1471-2180-14-136</mixed-citation></ref><ref id="scirp.99213-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Muhammad, A., et al. (2017) The Gut Entomotype of Red Palm Weevil Rhynchophorus ferrugineus Olivier (Coleoptera: Dryophthoridae) and Their Effect on Host Nutrition Metabolism. Frontiers in Microbiology, 8, 2291.  
https://doi.org/10.3389/fmicb.2017.02291</mixed-citation></ref><ref id="scirp.99213-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Hosokawa, T., et al. (2015) Nardonella Endosymbionts of Japanesepest and Non-Pest Weevils (Coleoptera: Curculionidae). Applied Entomology and Zoology, 50, 223-229.  
https://doi.org/10.1007/s13355-015-0326-y</mixed-citation></ref><ref id="scirp.99213-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Jia, S., et al. (2013) Seasonally Variable Intestinal Metagenomes of the Red Palm Weevil (Rhynchophorus ferrugineus). Environmental Microbiology, 15, 3020-3029.  
https://doi.org/10.1111/1462-2920.12262</mixed-citation></ref><ref id="scirp.99213-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Berenbaum, M. (2003) Frass-Eating Grins. American Entomologist, 49,132-133.  
https://doi.org/10.1093/ae/49.3.132</mixed-citation></ref><ref id="scirp.99213-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Butera, G., et al. (2012) The Cultural Bacterial Community of Frass Produced by Larvae of Rhynchophorus ferrugineus Olivier (Coleoptera: Curculionidae) in the Canary Island Date Palm. Letters in Applied Microbiology, 54, 530-536.  
https://doi.org/10.1111/j.1472-765X.2012.03238.x</mixed-citation></ref><ref id="scirp.99213-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Ogbulie, T.E., Ogbulie, J.N. and Njoku, H.O. (2007) Comparative Study on the Shelf Life Stability of Palm Wine from Elaeisguineensis and Raphiahookeri Obtained from Okigwe, Nigeria. African Journal of Biotechnology, 6, 914-922.</mixed-citation></ref><ref id="scirp.99213-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Naknean, P., Meenune, M. and Roudaut, G. (2010) Characterization of Palm Sap Harvested in Songkhla Province, Southern Thailand. International Food Research Journal, 17, 977-986.</mixed-citation></ref><ref id="scirp.99213-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Salama, H.S., Foda, M.S., El-Bendary, M.A. and Razek, A.A. (2004) Infection of Red Palm Weevil, Rhynchophorus ferrugineus, by Spore-Forming Bacilli Indigenous to Its Natural Habitat in Egypt. Journal of Pest Science, 77, 27-31.  
https://doi.org/10.1007/s10340-003-0023-4</mixed-citation></ref><ref id="scirp.99213-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Britschgi, T.B. and Giovannoni, S.J. (1991) Phylogenetic Analysis of a Natural Marine Bacterioplankton Population by rRNA Gene Cloning and Sequencing. Applied and Environmental Microbiology, 57, 1707-1713.  
https://doi.org/10.1128/AEM.57.6.1707-1713.1991</mixed-citation></ref><ref id="scirp.99213-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">DeLong, E.F., Franks, D.G. and Alldredge, A.L. (1993) Phylogenetic Diversity of Aggregate-Attached vs. Free-Living Marine Bacterial Assemblages. Limnology and Oceanography, 38, 924-934. https://doi.org/10.4319/lo.1993.38.5.0924</mixed-citation></ref><ref id="scirp.99213-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Weidner, S., Arnold, W. and Puhler, A. (1996) Diversity of Uncultured Microorganisms Associated with the Seagrass Halophilastipulacea Estimated by Restriction Fragment Length Polymorphism Analysis of PCR-Amplified 16S rRNA Genes. Applied and Environmental Microbiology, 62, 766-771.  
https://doi.org/10.1128/AEM.62.3.766-771.1996</mixed-citation></ref><ref id="scirp.99213-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Saitou, N. and Nei, M. (1987) The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Molecular Biology and Evolution, 4, 406-425.</mixed-citation></ref><ref id="scirp.99213-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Edgar, R.C. (2004) MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput. Nucleic Acids Research, 32, 1792-1797.  
https://doi.org/10.1093/nar/gkh340</mixed-citation></ref><ref id="scirp.99213-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Kolbert, C. and Persing, D. (1999) Ribosomal DNA Sequencing as a Tool for Identification of Bacterial Pathogens. Current Opinion in Microbiology, 2, 299-305.  
https://doi.org/10.1016/S1369-5274(99)80052-6</mixed-citation></ref><ref id="scirp.99213-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Clarridge, J.E. (2004) Impact of 16S rRNA Gene Sequence Analysis for Identification of Bacteria on Clinical Microbiology and Infectious Diseases. Clinical Microbiology Reviews, 17, 840-862. https://doi.org/10.1128/CMR.17.4.840-862.2004</mixed-citation></ref><ref id="scirp.99213-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Pearson, W.R. (2013) An Introduction to Sequence Similarity (“Homology”) Searching. Current Protocols in Bioinformatics.</mixed-citation></ref><ref id="scirp.99213-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Shangang, J., et al. (2013) Seasonally Variable Intestinal Metagenomes of the Red Palm Weevil (Rhynchophorus ferrugineus). Environmental Microbiology, 15, 3020-3029.</mixed-citation></ref><ref id="scirp.99213-ref33"><label>33</label><mixed-citation publication-type="book" xlink:type="simple">Logan, N.A. and De Vos, P. (2009) Genus Bacillus Cohn 1872. In: De Vos, P., et al., Eds., Bergey’s Manual of Systematic Bacteriology, 2nd Edition, Vol. 3, Springer, New York, 21-128.</mixed-citation></ref><ref id="scirp.99213-ref34"><label>34</label><mixed-citation publication-type="book" xlink:type="simple">Stackebrandt, E. and Swiderski, J. (2008) From Phylogeny to Systematics: The Dissection of the Genus Bacillus. In: Berkeley, R., et al., Eds., Applications and Systematics of Bacillus and Relatives, Blackwell Science, Oxford, 8-22.  
https://doi.org/10.1002/9780470696743.ch2</mixed-citation></ref><ref id="scirp.99213-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Gatson, J.W., et al. (2006) Bacillus tequilensis sp. nov., Isolated from a 2000-Year-Old Mexican Shaft-Tomb, Is Closely Related to Bacillus subtilis. International Journal of Systematic and Evolutionary Microbiology, 56, 1475-1484.  
https://doi.org/10.1099/ijs.0.63946-0</mixed-citation></ref><ref id="scirp.99213-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Li, H., et al. (2018) Isolation and Evaluation of Endophytic Bacillus tequilensis GYLH001 with Potential Application for Biological Control of Magnaporthe oryzae. PLoS ONE, 13, e0203505. https://doi.org/10.1371/journal.pone.0203505</mixed-citation></ref><ref id="scirp.99213-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Budiharjo, A., et al. (2017) Complete Genome Sequence of Bacillus altitudinis P-10, a Potential Bioprotectant against Xanthomonasoryzaepv. oryzae, Isolated from Rice Rhizosphere in Java, Indonesia. Genome Announcements, 5, e01388-17.  
https://doi.org/10.1128/genomeA.01388-17</mixed-citation></ref><ref id="scirp.99213-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Branquinho, R., et al. (2014) Bacillus invictae sp. nov., Isolated from a Health Product. International Journal of Systematic and Evolutionary Microbiology, 64, 3867-3876.  
https://doi.org/10.1099/ijs.0.067850-0</mixed-citation></ref><ref id="scirp.99213-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Pu, Y., Ma, T., Hou, Y. and Sun, M. (2017) An Entomopathogenic Bacterium Strain, Bacillus thuringiensis, as a Biological Control Agent against the Red Palm Weevil, Rhynchophorus ferrugineus (Coleoptera: Curculionidae). Pest Management Science, 73, 494-1502. https://doi.org/10.1002/ps.4485</mixed-citation></ref></ref-list></back></article>