<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AS</journal-id><journal-title-group><journal-title>Agricultural Sciences</journal-title></journal-title-group><issn pub-type="epub">2156-8553</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/as.2020.112007</article-id><article-id pub-id-type="publisher-id">AS-98095</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Earth&amp;Environmental Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Impact of Rice Stem Borers and Identification of &lt;i&gt;Orseolia oryzivora&lt;/i&gt; Harris &amp; Gagn&#233;, 1982 (Diptera: Cecidomyiidae) Biotypes in the Southern Cameroon
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Karine</surname><given-names>Moche</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Paul-Alain</surname><given-names>Nana</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Liliane</surname><given-names>Tandzi Ngoune</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Champlain</surname><given-names>Djieto-Lordon</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Noé</surname><given-names>Woin</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Télesphore</surname><given-names>Sime-Ngando</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib></contrib-group><aff id="aff4"><addr-line>Department of Agriculture, College of Basic and Apply Sciences, University of Ghana, Legon, Ghana</addr-line></aff><aff id="aff5"><addr-line>Laboratory of Zoology, Faculty of Science, University of Yaoundé, Yaoundé, Cameroon</addr-line></aff><aff id="aff3"><addr-line>Laboratory Microorganisms: Genome and Environment (LMGE), Clermont Auvergne University, Clermont-Ferrand, France</addr-line></aff><aff id="aff1"><addr-line>Laboratory of Entomology, Institute of Agricultural Research for Development, Yaoundé, Cameroon</addr-line></aff><aff id="aff2"><addr-line>Department of Oceanography and Limnology, Institute of Fisheries and Aquatic Sciences, University of Douala, Douala, Cameroon</addr-line></aff><pub-date pub-type="epub"><day>22</day><month>01</month><year>2020</year></pub-date><volume>11</volume><issue>02</issue><fpage>111</fpage><lpage>123</lpage><history><date date-type="received"><day>10,</day>	<month>September</month>	<year>2019</year></date><date date-type="rev-recd"><day>28,</day>	<month>January</month>	<year>2020</year>	</date><date date-type="accepted"><day>31,</day>	<month>January</month>	<year>2020</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  The study compares the impact due to rice stem borers in two sites (Yaound&#233; and Ntui). It also shows the diversity of the African Rice Gall Midge (AfRGM) biotypes in southern Cameroon (Santchou, Ndop, Tonga, Ebolowa, Ba
  ?gom, Yaound&#233; and Ntui). The New Rice for Africa (NERICA) varieties 3, 8, 9 and 13 sown in Ntui were less attacked than those sown in Yaound&#233;. At both sites, damages ranged from 0.78% to 2.7%. In terms of diversity, the main stem-borer species were 
  <em>O. oryzivora</em>, 
  <em>Diopsis apicalis</em>, 
  <em>D. longiconis</em> and 
  <em>Chilo zacconius</em>. Molecular analyses of 
  <em>Orseolia oryzivora</em> larvae collected in the localities of Santchou, Ndop, Tonga, Ebolowa, Ba
  ?gom and Yaound&#233; showed the existence of more than one 
  <em>O. oryzivora</em> biotype in southern Cameroon’s rice basins. 
 
</p></abstract><kwd-group><kwd>Biotype</kwd><kwd> Larvae</kwd><kwd> NERICA</kwd><kwd> &lt;i&gt;Orseolia sp&lt;/i&gt;</kwd><kwd> PCR</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Rice has become a strategic and priority product for food security in sub-Saharan Africa [<xref ref-type="bibr" rid="scirp.98095-ref1">1</xref>]. Its consumption is increasing faster than the one of all other staples food due to high population growth, rapid urbanization and changes in dietary habits [<xref ref-type="bibr" rid="scirp.98095-ref2">2</xref>]. Rice is the first source of calories in West Africa and the third for the entire African continent [<xref ref-type="bibr" rid="scirp.98095-ref3">3</xref>]. In Cameroon, even though local production has increased rapidly after the 2007-2008 food crises, rice production remains below demand as in most African countries [<xref ref-type="bibr" rid="scirp.98095-ref1">1</xref>]. Demand for milled rice in Sub-Saharan Africa is expected to increase by 30 million tons by 2035, an increase of 130% [<xref ref-type="bibr" rid="scirp.98095-ref4">4</xref>]. NERICA has a great ecological plasticity [<xref ref-type="bibr" rid="scirp.98095-ref5">5</xref>] and increases the production in African countries in general and Cameroon in particular. However, rice cultivation is subject to various constraints, including diseases and insects pests [<xref ref-type="bibr" rid="scirp.98095-ref4">4</xref>]. Two main orders of stem borers, cause large yield losses to rice production in the intertropical regions of Africa. These are Lepidoptera: Noctuidae [<xref ref-type="bibr" rid="scirp.98095-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref7">7</xref>]; Diptera: Diopsidae [<xref ref-type="bibr" rid="scirp.98095-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref9">9</xref>] and Cecidomyiidae [<xref ref-type="bibr" rid="scirp.98095-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref11">11</xref>]. The system of insect pest was mainly based on their morphological and morphometric characters [<xref ref-type="bibr" rid="scirp.98095-ref12">12</xref>]. This technique has limits when it comes to distinguish cryptic, neighbouring or twin species [<xref ref-type="bibr" rid="scirp.98095-ref12">12</xref>]. The identification of differentiated populations in crop pests and their characterization using molecular markers is a necessary basis to define control strategies [<xref ref-type="bibr" rid="scirp.98095-ref13">13</xref>]. Some pest control programs have had very little success; this is partly due to a lack of knowledge about the genetic diversity of their populations and their history’s evolution [<xref ref-type="bibr" rid="scirp.98095-ref14">14</xref>]. The AfRGM, Orseolia oryzivora is an indigenous pest species that causes serious damage to lowland rice crops in Burkina Faso, Nigeria, Mali, Sierra Leone, Cameroon and other sub-Saharan African countries [<xref ref-type="bibr" rid="scirp.98095-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref16">16</xref>]. Host plant resistance is the single most effective means of controlling this insect pest. Screening for resistance over three years at the same location has provided evidence that there are large differences in resistance reactions to AfRGM between locations [<xref ref-type="bibr" rid="scirp.98095-ref17">17</xref>]. However, large differences suggest that there is more than one biotype present in West Africa and their distribution is unknown. In addition to the above, we need to know how virulent are these biotypes? Why and how resistant varieties withstand them? Work done by [<xref ref-type="bibr" rid="scirp.98095-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref18">18</xref>] have revealed that the sequence characterized amplified region (SCAR) primers used in classifying the three Orseolia species (O. oryzivora, O. bonzii and O. nwanzei) in Nigeria could be useful for studies on biotypes and for field diagnostic purposes. The present work aims to find ways and means to improve pest management strategies in rice cultivation. We will evaluate the diversity and impact of stem borers and identify the biotypes of AfRGM using DNA fingerprinting techniques.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Presentation of the Different Sites</title><p>Data collection took place from March 2014 to August 2015 in eight sites in three agro-ecological zones of southern Cameroon: 1) Western Highlands, 2) South and transition zone between coastal plain and 3) highlands (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><sec id="s2_1_1"><title>2.1.1. Western Highlands</title><p>These sites are classified among the oldest rice-growing areas. Characterized by a humid climate with a unimodal rainfall, the agro-ecological zone of West Cameroon presents a very fertile agricultural land. Here, the data were collected in three localities: Dschang (05˚45'70.1''N - 10˚35'53''E, altitude: 1344 m) in the Menoua division, Ndop (06˚04'03.9''N - 010˚27'03.2''E, altitude: 1152 m) in the Ngo-Ketunjia division and Ba&#239;gom (04˚49'09.8''N - 011˚65'29.8''E, altitude: 1150 m) in the Noun division.</p></sec><sec id="s2_1_2"><title>2.1.2. South Region</title><p>In this part of Cameroon, our research was carried out in three localities: Yaound&#233;-Nkolbisson (03˚51'57''N - 011˚27'11''E, altitude: 693 m) in the Mfoundi division, Ntui (04˚30'701''N - 011˚55'53''E., altitude: 509 m) in the Mbam-et-Kim division and Ebolowa (02˚56'52.1''N - 011˚07'9.7''E, altitude: 599 m) in the Mvilla division. In these localities, the climate is hot and humid, sub-tropical transition type, attenuated by altitude (Suchel, 1988). The annual temperature average is 23.5˚C contrasted between 16˚C and 31˚C depending on the season. Rainfall is 1650 mm per year [<xref ref-type="bibr" rid="scirp.98095-ref19">19</xref>]. The annual humidity average is 80% and varies during the day between 35% and 98%. Winds are wet and blow towards the southwest [<xref ref-type="bibr" rid="scirp.98095-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref20">20</xref>].</p></sec><sec id="s2_1_3"><title>2.1.3. Transition Zone between Coastal Plain and Western Highlands</title><p>In this region, we worked in two localities: Santchou (05˚15'47''N - 009˚58'10''E, altitude: 730 m) in the Menoua division and Tonga (04˚97'07''N - 010˚69'35''E, altitude: 1344 m) in the Nd&#233; division. The climate prevailing in Santchou and Tonga is an equatorial type, characterized by the alternation of dry seasons and rainy seasons. With an average temperature of 23.6˚C contrasted between 19 and 31˚C depending on the season and 2478 mm of rain per year.</p></sec></sec><sec id="s2_2"><title>2.2. Vegetal and Animal Material</title><p>The plant material consisted of six rice varieties: four NERICA varieties (3, 8, 9 and 13), Tonga and FKR 60 varieties. The animal material was Orseolia sp. insects. Their collection took place during the second growing season of 2014 (November-December) in the plantations of local producers on the sites of Santchou, Tonga, Ndop, Ba&#239;gom, Dschang, Ebolowa and on our experimental plots in Yaound&#233; and Ntui.</p></sec><sec id="s2_3"><title>2.3. Diversity and Impact of Stem Borers</title><sec id="s2_3_1"><title>2.3.1. Planting, Fertilization, Maintenance and Sampling</title><p>Direct planting was carried out on manually ploughed soil and each variety has been planted on 10 m<sup>2</sup>. The spacing was 20 cm between the columns and 20 cm on the line. The distance between two varieties was 50 cm. Two weeks after planting, 300 kg∙ha<sup>−1</sup> NPK (20-10-10) were applied; 65 kg∙ha<sup>−1</sup> of urea spread at 46% of panicle initiation, that is to say 60 - 70 days after sowing according to the life cycle of the variety and 35 kg∙ha<sup>−1</sup> of urea at the flowering stage. Three manual weeding was carried out, respectively 15, 30 and 60 days after planting. The sampling step was two weeks.</p></sec><sec id="s2_3_2"><title>2.3.2. Evaluation Attacks</title><p>Stem borers attack rates were calculated by reporting the number of white heads observed for each variety over the number of total panicles for each variety.</p><p>Attack   rate = ( Number   of   white   heads ) / ( Number   of   panicles )</p></sec></sec><sec id="s2_4"><title>2.4. Soil Physicochemical Parameters</title><p>Soil samples were collected using an auger at a depth of 0 - 20 cm in Ntui and Yaound&#233;. Parameters such as Humidity (%), Organic Material (g∙kg<sup>−1</sup>), Organic Carbon (g∙kg<sup>−1</sup>), Clay (%), Silt (%), Total Nitrogen (g∙kg<sup>−1</sup>), pH, Sand (%) were recorded at the soil laboratory of the Agricultural Research Institute for Development (IRAD) at Yaound&#233;-Cameroon.</p></sec><sec id="s2_5"><title>2.5. SCAR-PCR (Sequence Characterized Amplified Region-Polymerase Chain Reaction) Analysis</title><sec id="s2_5_1"><title>2.5.1. Identification and Conservation of Insects</title><p>The morphological identification, based on the dichotomous key [<xref ref-type="bibr" rid="scirp.98095-ref7">7</xref>] was first made. Forty seven insects, consisting of 46 larvae and 01 adult (obtained after raring) were collected from 04 localities in lowland and irrigated ecologies in Cameroon. These larvae and adult were preserved in absolute ethanol at −20˚C inside 2 mL Eppendorf tubes before genomic DNA extraction [<xref ref-type="bibr" rid="scirp.98095-ref21">21</xref>]. The genomic DNA extraction and SCAR-PCR analysis were carried out at the laboratory.</p></sec><sec id="s2_5_2"><title>2.5.2. Extraction of DNA with CTAB (Cetyl Trimethyl Ammonium Bromide)</title><p>The extraction of the DNA was carried out by adding 600 μL of CTAB buffer (CTAB 2%, 0.1 M TRIS/pH 8, 0.02 M EDTA/pH 8, 1.4 M NaCl) in each tube containing the biological material then, each sample was incubated in a water bath at 60˚C for 30 minutes. Then, 600 μL of a solution containing a mixture in respective proportions 24/1 of chloroform and isoamylic alcohol was added to each tube and the resulting mixture was homogenized for 10 minutes. Centrifugation at 8000 rpm for 15 minutes was carried out, three phases were then distinguished: the aqueous phase was removed and transferred to a new 1.5 mL Eppendorf tube labelled as the old one. A volume of 450 μL of isopropanol gal was added to the volume of the aqueous phase taken. The contents of the tube were homogenized once more (a few seconds this time) and incubated at −20˚C for at least 30 minutes, for the precipitation of the nucleic acids. Centrifugation at 13,000 rpm for 20 minutes and at 4˚C followed, allowing the DNA to settle into a pellet at the bottom of the tube. The supernatant liquid was removed and the pellet was washed with 1 mL of 70˚ ethanol and then centrifuged at 13,000 rpm for 15 minutes and at 4˚C. Once the alcohol evacuated, the DNA pellet was dried and then suspended in 20 &#181;L of sterile water. The extracted DNA was stored at −20˚C until use.</p></sec><sec id="s2_5_3"><title>2.5.3. Identification of Gall Midge Biotypes by SCAR-PCR</title><p>SCAR-PCR amplifies DNA sequences whose primers are designated from DNA sequenced fragments derived from RAPD (Random amplified polymorphic DNA) profiles.</p><p>Identification of the gall midge individuals was made by amplification of DNA sequences [<xref ref-type="bibr" rid="scirp.98095-ref14">14</xref>]. Each pair of primers used is specific to African Rice Gall Midge DNA (<xref ref-type="table" rid="table1">Table 1</xref>). The amplifications were carried out in a 25 μL reaction containing: the DNA extract, 2.5 μL, the 10 X TBE PCR buffer, 2.5 μL, 1 μL of the mixture of the deoxynucleotide triphosphates (dATP, dCTP, dGTP and dTTP), (10 mM), 1 μL of each primer of the SCAR primer pair considered concentrated at 10 Μm. 1 μL of MgCl<sub>2</sub> (25 mM), 0.1 μL of Taq polymerase (5 units/μL). The</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Sequences of primers used for identification of AfRGM species in Nigeria [<xref ref-type="bibr" rid="scirp.98095-ref14">14</xref>]</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >SCAR primer</th><th align="center" valign="middle" >Primer size</th><th align="center" valign="middle" >Sequence (5'-3')</th></tr></thead><tr><td align="center" valign="middle" >OSSP-1</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >Reverse: GATTACGCCCAGGTCACTGT Forward: ATTACGCCCAGGTACCACAA</td></tr><tr><td align="center" valign="middle" >OSSP-5</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >Reverse: CGCCCAGGTACCATAACAAC Forward: AGTGATTACGCCCAGGTCAG</td></tr><tr><td align="center" valign="middle" >OSSP-6</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >Reverse: ACGCCCAGGTACCATAACAA Forward: AGTGATTACGCCCAGGTCAG</td></tr></tbody></table></table-wrap><p>amplifications were done in a thermocycler and the amplification program included: an initial denaturation step of the DNA at 94˚C for 4 min, 35 cycles each containing a denaturation step of the DNA at 94˚C for 1 min, a primer hybridization step at 60˚C for 1 min and an elongation step at 72˚C for 2 min, a final extension step at 72˚C for 7 min.</p><p>After PCR, the amplification products were separated by electrophoresis on a 2% agarose gel. The migration was made under the effect of an electrophoresis generator, at 100 volts for 1 hour, and after this, the gel is stained in a 0.5 mg∙mL<sup>−1</sup> ethidium bromide solution. For the interpretation of the results, a molecular weight marker was added during the migration.</p></sec></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Physico-Chemical Parameters of Soils at the Yaound&#233; and Ntui Sites</title><p>At these two sites, abiotic soil variables revealed similarities and differences for some parameters (<xref ref-type="table" rid="table2">Table 2</xref>). Thus, it appears that the percentage of clay in Yaound&#233; (57.91%) is almost double that of Ntui (29.23%). The same observation is made for the percentage of fine silt that is doubly lower in Ntui (7.95%) compared to Yaound&#233; (14.07%). The humidity of the Yaound&#233; (9.52%) was more than 03 times higher than the one of Ntui (2.98%). Parameters such as organic matter, organic carbon, total nitrogen, potassium and magnesium showed non-significant</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Physico-chemical parameters of the study sites</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Parameters</th><th align="center" valign="middle" >Ntui</th><th align="center" valign="middle" >Yaound&#233;</th></tr></thead><tr><td align="center" valign="middle" >Humidity (%)</td><td align="center" valign="middle" >2.98</td><td align="center" valign="middle" >9.52</td></tr><tr><td align="center" valign="middle" >Organic material (g∙kg<sup>−1</sup>)</td><td align="center" valign="middle" >20.80</td><td align="center" valign="middle" >19.33</td></tr><tr><td align="center" valign="middle" >Organic carbon (%) (g∙kg<sup>−1</sup>)</td><td align="center" valign="middle" >12.06</td><td align="center" valign="middle" >11.21</td></tr><tr><td align="center" valign="middle" >Total nitrogen (g∙kg<sup>−1</sup>)</td><td align="center" valign="middle" >1.22</td><td align="center" valign="middle" >1.90</td></tr><tr><td align="center" valign="middle" >pH (H<sub>2</sub>O)</td><td align="center" valign="middle" >5.53</td><td align="center" valign="middle" >5.79</td></tr><tr><td align="center" valign="middle" >pH (KCl)</td><td align="center" valign="middle" >4.57</td><td align="center" valign="middle" >4.73</td></tr><tr><td align="center" valign="middle" >Clay (%)</td><td align="center" valign="middle" >29.32</td><td align="center" valign="middle" >57.91</td></tr><tr><td align="center" valign="middle" >Fine silt (%)</td><td align="center" valign="middle" >7.95</td><td align="center" valign="middle" >14.07</td></tr><tr><td align="center" valign="middle" >Coarse silt (%)</td><td align="center" valign="middle" >5.68</td><td align="center" valign="middle" >3.63</td></tr><tr><td align="center" valign="middle" >Fine sand (%)</td><td align="center" valign="middle" >27.08</td><td align="center" valign="middle" >14.74</td></tr><tr><td align="center" valign="middle" >Exchangeable bases (meq per 100 g soil)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Na<sup>+</sup></td><td align="center" valign="middle" >0.22</td><td align="center" valign="middle" >0.18</td></tr><tr><td align="center" valign="middle" >K<sup>+</sup></td><td align="center" valign="middle" >0.31</td><td align="center" valign="middle" >0.40</td></tr><tr><td align="center" valign="middle" >Mg<sup>2+</sup></td><td align="center" valign="middle" >0.88</td><td align="center" valign="middle" >1.01</td></tr><tr><td align="center" valign="middle" >Ca<sup>2+</sup></td><td align="center" valign="middle" >2.98</td><td align="center" valign="middle" >3.66</td></tr><tr><td align="center" valign="middle" >CEC</td><td align="center" valign="middle" >7.90</td><td align="center" valign="middle" >11.92</td></tr></tbody></table></table-wrap><p>fluctuations between the two sites. Overall, the soils at both sites were acidic.</p></sec><sec id="s3_2"><title>3.2. Diversity and Impact of Stem Borers</title><sec id="s3_2_1"><title>3.2.1. Gall Midge</title><p>During this study, Gall Midges were observed in the plots at the second week after planting. The frequency of these symptoms has been relatively low. These symptoms were observed only at the Yaound&#233; site (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)).</p></sec><sec id="s3_2_2"><title>3.2.2. White Heads</title><p>The first white heads were observed third week after planting on the Yaound&#233; site. Here, the most vulnerable varieties were: NERICA 3, NERICA 8, NERICA 9 and NERICA 13. The highest percentage of white heads (2.7%) was observed on the NERICA 3 variety, the lowest percentage (0.78%) was observed on the NERICA 9 variety (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)). Midge appeared at the vegetative stage of the host plant. At Ntui, the white heads did not appear until the ninth week after planting. FKR 60 had no white heads. In contrast, NERICA 3 had only one white head and NERICA 9 and 8 had the highest number of white heads (09 in total) (<xref ref-type="fig" rid="fig2">Figure 2</xref>(c)).</p><p>In the Ntui site, only Lepidoptera larvae were present. We observed that many Lepidopteron larvae can coexist in the same stem, while Dipterans larvae such as Diopsis sp. and Orseolia sp. were usually solitary (only one larvae per rice stem).</p><p>In Ndop site, no white head was observed. Rice farmers told us not to know about the white head phenomenon. However, some gall midges were observed in the plots where the rice was still at the vegetative stage.</p></sec></sec><sec id="s3_3"><title>3.3. SCAR-PCR Analysis</title><p>From the six primer pairs tested, three successfully amplified our sample’s DNA extracts. Successful amplification results in the appearance on the agarose gel of an observable ultraviolet band. We can determine the molecular weight of the protein (1000 bp) with the position of this band.</p><p>The DNA extracts corresponding to samples number 2, 16, 18, 19, 20, 22, 26, 28, 29, 30, 38, 39, 40, 41 and 42 were amplified by OSSP primer pair 5F/R (<xref ref-type="fig" rid="fig3">Figure 3</xref>(a)). The OSSP 1F/R primer pair amplified the DNA extracts corresponding to samples number 16, 18, 19, 20, 22, 25, 29, 30, 38, 39, 40, 41 and 42 (<xref ref-type="fig" rid="fig3">Figure 3</xref>(b)). The observation and interpretation of these bands obtained after amplification suggest that there is more than one biotype of the Orseolia genus in our samples.</p><p>From the larvae collected at Ebolowa, only the DNA extracts of samples no 22 and 47 were amplified (<xref ref-type="table" rid="table2">Table 2</xref>). Globally, only the DNA extracts from the larvae samples collected in the Ebolowa and Yaound&#233; sites were amplified (<xref ref-type="table" rid="table3">Table 3</xref>).</p><p>This result suggests that in Cameroon there are many biotypes of O. orizyvora among which the DNA extracts from Ebolowa and Yaound&#233; were amplified with three of the six primer pairs tested in Nigeria. At the Ebolowa site only DNA extracts from two individuals could be amplified. This suggests the potential existence of biotypes whose specific primer pairs are not among the six tested. This observation is also valid for individuals collected at the Yaound&#233;, Santchou and Ndop sites.</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Larvae’s DNA samples that amplified</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Sample’s number</th><th align="center" valign="middle" >OSSP 1F/R</th><th align="center" valign="middle" >OSSP 6F/R</th><th align="center" valign="middle" >OSSP 5F/R</th><th align="center" valign="middle" >Sites</th></tr></thead><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >7</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >16</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >17</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >18</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >19</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >20</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >22</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Ebolowa</td></tr><tr><td align="center" valign="middle" >25</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >26</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >28</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >29</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >30</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >31</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >38</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >39</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >40</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >41</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >42</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Yaound&#233;</td></tr><tr><td align="center" valign="middle" >47</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >Ebolowa</td></tr></tbody></table></table-wrap><p>1 = amplified.</p></sec></sec><sec id="s4"><title>4. Discussion</title><sec id="s4_1"><title>4.1. Physico-Chemical Parameters</title><p>Biotic parameters measured at the Ntui and Yaound&#233; sites, showed differences for several variables, including nutrient ions and soil moisture content. This could be explained by the soil texture and climatic variables in these two localities.</p><p>Indeed, it has already been proven that enriching the soil with potassium improves rice yields [<xref ref-type="bibr" rid="scirp.98095-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref23">23</xref>]. This enrichment could further reduce pesticide intake due to the negligible presence of pests, reduce yield losses and increase farmers’ incomes for the sustainable development of rice. On the other hand, the incidence of midge increases with increasing levels of nitrogen fertilization [<xref ref-type="bibr" rid="scirp.98095-ref24">24</xref>]. The latter also showed that stem borers’ attack was positively correlated with soil moisture and nitrogen content, hence the strong presence of white panicles and Yaound&#233;, compared to Ntui. In general, stem borers are still concentrated where food resources are most abundant [<xref ref-type="bibr" rid="scirp.98095-ref25">25</xref>]. The resistance of rice plants to stem borers in Ntui is thought to be related to a considerable range of phenotypic and/or genotypic characteristics [<xref ref-type="bibr" rid="scirp.98095-ref26">26</xref>]. However, environmental factors would be responsible for the variation in the level of resistance from year to year or season to season [<xref ref-type="bibr" rid="scirp.98095-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref27">27</xref>].</p></sec><sec id="s4_2"><title>4.2. Impact of Stem Borers</title><p>Damage caused by stem borers in rice cultivation results in the appearance of dead hearts, midge in the vegetative stage of the plant and white heads in the flowering stage. Mechanically, the freshly hatched larvae bore into stem and feed internally causing death of central shoot dead hearts in vegetative stage and white head at flowering stage, respectively. This results in chaffy grains. The larvae feed on green tissue of leaf sheath [<xref ref-type="bibr" rid="scirp.98095-ref28">28</xref>].</p><p>The low rates of attacks in Ntui, observed at the end of flowering and the total absence of dead hearts during the vegetative stage could be related to climatic factors. It should be noted that, in Yaound&#233;, rice cultivation is still primitive and doesn’t even exist in Ntui. These data confirm the hypothesis that Orseolia sp. expansion on the African continent is linked to the intensification of rice cultivation [<xref ref-type="bibr" rid="scirp.98095-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref30">30</xref>]. These results would then confirm the performance of NERICA varieties against insects [<xref ref-type="bibr" rid="scirp.98095-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref31">31</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref32">32</xref>].</p></sec><sec id="s4_3"><title>4.3. SCAR-PCR Analysis</title><p>After amplification and migration on agarose gel, observation of the bands revealed the presence of amplicons of different molecular weights, suggesting that there may be more than one biotype of Orseolia sp. in Cameroon; as already demonstrated in Nigeria [<xref ref-type="bibr" rid="scirp.98095-ref14">14</xref>]. DNA extracts from amplified samples appear to be genetically similar to those described in Nigeria [<xref ref-type="bibr" rid="scirp.98095-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref18">18</xref>]. DNA extracts from several individuals, particularly those collected at Ebolowa, could not be amplified by the PCR technique. This could be due either to the low sensitivity of the primers, or the genetic material could be that of another species of the genus Orseolia, whose primers could not hybridize to DNA sequences.</p><p>Our results confirm the existence of differences between Orseolia biotypes at the molecular level. To date, three biotypes of Orseolia have been officially described in Africa [<xref ref-type="bibr" rid="scirp.98095-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.98095-ref18">18</xref>]. This study suggests the existence of various other biotypes to be characterized. The genus Orseolia is probably less species-rich in Africa than on the Asian continent, where 24 species have been described on the family Poaceae [<xref ref-type="bibr" rid="scirp.98095-ref33">33</xref>]. The existence of genetic variations between the three Orseolia biotypes, revealed by the RAPD and SCAR analysis, constitutes an effective discrimination tool that could be used to complement morphological traits to separate different biotypes present in Africa [<xref ref-type="bibr" rid="scirp.98095-ref14">14</xref>].</p></sec></sec><sec id="s5"><title>5. Conclusion</title><p>The objective of our study was to identify the Orseolia oryzivora biotypes and to study the impact of the main stem borer’s species in the rice growing basins of southern Cameroon. Analysis of the physico-chemical parameters of soil samples taken in Yaound&#233; and Ntui showed the role that moisture, potassium and nitrogen can play in the sensitivity of rice varieties to stem borers. Although NERICA varieties have been weakly attacked, no NERICA variety has complete resistance to stem borers. We observed larvae of O. oryzivora and Chilo zacconius in the attacked rice stalks. However, even if the variety NERICA 3 was attacked, only twenty samples out of forty-seven of the DNA extracts could be amplified. Our study shows that Orseolia sp. identified in Cameroon has several biotypes. For our future work, we intend to fully identify these biotypes using the high throughput sequencing technique.</p></sec><sec id="s6"><title>Acknowledgements</title><p>Authors thank the Institute of Agricultural Research for Development authorities for their financial support. They also thank all the farmers at the different sites for their sincere collaboration.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s8"><title>Cite this paper</title><p>Moche, K., Nana, P.-A., Ngoune, L.T., Djieto-Lordon, C., Woin, N. and Sime-Ngando, T. (2020) Impact of Rice Stem Borers and Identification of Orseolia oryzivora Harris &amp; Gagn&#233;, 1982 (Diptera: Cecidomyiidae) Biotypes in the Southern Cameroon. Agricultural Sciences, 11, 111-123. https://doi.org/10.4236/as.2020.112007</p></sec></body><back><ref-list><title>References</title><ref id="scirp.98095-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Macauley, H. and Ramadjita, T. (2015) Les cultures céréalières: Riz, ma&amp;iuml;s, millet, sorgho et blé. Nourrir l’Afrique, Centre International de Conférences Abdou Diouf de Dakar-Sénégal, Dakar, Sénégal, 21-23 Octobre 2015, 38 p.</mixed-citation></ref><ref id="scirp.98095-ref2"><label>2</label><mixed-citation publication-type="book" xlink:type="simple">Seck, P.A., Touré, A.A., Coulibaly, J.Y., Diagne, A. and Wopereis, M.C.S. (2013) Impact of Rice Research on Income, Poverty and Food Security in Africa: An Ex-Ante Analysis. In: Wopereis, M.C.S., Johnson, D.E., Ahmadi, N., Tollens, E. and Jalloh, A., Eds., Realizing Africa’s Rice Promise, CAB International, Wallingford, 24-33.</mixed-citation></ref><ref id="scirp.98095-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Sasaki, T. and Burr, B. (2000) International Rice Genome Sequence Project: The Effort to Complete the Sequence of Rice Genome. Current Opinion in Plant Biology, 3, 138-141. https://doi.org/10.1016/S1369-5266(99)00047-3</mixed-citation></ref><ref id="scirp.98095-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Seck, P.A., Diagne, A., Mohanty, S. and Wopereis, M.C.S. (2012) Crops that Feed the World 7: Rice. Food Security, 4, 7-24. https://doi.org/10.1007/s12571-012-0168-1</mixed-citation></ref><ref id="scirp.98095-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Akintayo, I., Cisse, B. and Zadji, L.D. (2008) Guide Pratique de la Culture des NERICA de Plateau. Africa Rice Center, Africa, 36 p.</mixed-citation></ref><ref id="scirp.98095-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">L&amp;ocirc;, E.M. (2010) Diagnostic agronomique de la culture du riz en Haute-Casamance et au Sénégal Oriental. Mémoire d’ingénieur agronome de conception. Ecole Nationale Supérieure d’Agriculture de Thiès, Sénégal, 51 p.</mixed-citation></ref><ref id="scirp.98095-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Heinrichs, E.A. and Barrion, A.T. (2004) Rice Feeding Insects and Selected Natural Enemies in West Africa, Biology, Ecology Identification. International Rice Research Institute, Los Ba&amp;ntilde;os, 243 p. http://books.irri.org/9712201902_content.pdf</mixed-citation></ref><ref id="scirp.98095-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Brenière, J. (1983) Principaux ennemis du riz en Afrique de l’Ouest et leur contr&amp;ocirc;le. 2nd Edition. ADRAO, Monrovia, Liberia, 87 p.</mixed-citation></ref><ref id="scirp.98095-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Olalekan, O.B. (2002) Management of Major Insect Pests of Rice in Tanzania (Review). Plant Protection Science, 38, 108-113. https://doi.org/10.17221/4860-PPS</mixed-citation></ref><ref id="scirp.98095-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Williams, C.T., Harris M.K., Ukwungwu, N.M., Nacro, S., Dakouo, D., Nwilene, E.F., Singh, N.B. and Okhidievbie, O. (2002) African Rice Gall Midge. Research Guide. CABI Bioscience/WARDA, 27 p.</mixed-citation></ref><ref id="scirp.98095-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Moche, K., Djieto-Lordon, C., Tadu, Z., Mokam, D.G., Nana, P.A., Fokam, Z. and Woin, N. (2015) Diversity and Agronomic Impact of Rice Stem Borer at Nkolbisson, Yaoundé-Cameroon (Central Africa). International Journal of Agronomy and Agricultural Research, 6, 181-189.</mixed-citation></ref><ref id="scirp.98095-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Betelli, L. (2013) Développement et évaluation d'une méthode fondée sur la PCR temps réel pour la caractérisation des bioaérosols: Application au groupe des actinomycètes. Sciences agricoles. Université de Bourgogne, Dijon, 207 p.</mixed-citation></ref><ref id="scirp.98095-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Sezonlin, M. (2006) Phylogéographie et génétique des populations du foreur de tiges de céréales Busseola fusca (Fuller) (Lepidoptera, Noctuidae) en Afrique subsaharienne, imlications pour la lutte biologique contre cet insecte. Université de Paris-Sud 11, IRD, Orsay, 152 p.</mixed-citation></ref><ref id="scirp.98095-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Nwilene, F.E., Harris, K.M., Okhidievbie, O., Onasanya, A., Sere, Y. and Ingelbrecht, I. (2006) Morphological Diversity and Genomic DNA Fingerprinting of the African Rice Gall Midge Orseolia oryzivora (Diptera Cecidomyiidae) and of Two Other Species of African Orseolia. International Journal of Tropical Insect Science, 26, 256-265. https://doi.org/10.1017/S1742758406694058</mixed-citation></ref><ref id="scirp.98095-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Ogah, E.O., Smart, L.E., Woodcock, C.M., Caulfield, J.C., Birkett, M.A., Pickett, J.A., Nwilene, F.E. and Bruce, T.J. (2017) Electrophysiological and Behavioural Responses of Female African Rice Gall Midge, Orseolia oryzivora Harris and Gagné, to Host Plant Volatiles. Journal of Chemistry Ecology, 43, 13-16. https://doi.org/10.1007/s10886-016-0788-6</mixed-citation></ref><ref id="scirp.98095-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Sama, K., Nacro, S., Thiaw, C. and Dakouo, D. (2016) Incidence of the African Rice Gall Midge (AfRGM), Orseolia oryzivora H. &amp; G. in Relation with Period of Rice Transplanting in the Kou Valley, Burkina Faso. Advances in Entomology, 4, 97-103. https://doi.org/10.4236/ae.2016.42011</mixed-citation></ref><ref id="scirp.98095-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Nwilene, F.E., Williams, C.T., Ukwungwu, M.N., Dakouo, D. and Nacro, S. (2002) Reactions of Differential Rice Genotypes to African Rice Gall Midge in West Africa. International Insect Pest Management, 48, 195-201.https://doi.org/10.1080/09670870110103890</mixed-citation></ref><ref id="scirp.98095-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Nwilene, F.E., Onasanya, A., Agunbiade, T.A., Ukwungwu, M.N., Sere, Y., Ingelbrecht, I., Togola, A., Dakouo, D., Ba, M., Nacro, S., Hamadoun, A., Woin, N. and Charles, J. (2010) Identification and Differentiation of Orseolia Species in Nigeria as Revealed by SCAR-PCR Analysis. Trends in Applied Sciences Research, 5, 188-196.https://doi.org/10.3923/tasr.2010.188.196</mixed-citation></ref><ref id="scirp.98095-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Wethé, J. (2001) Use of Macrophytes for Domestics Waste Water Treatment in Developing Countries. 25ème journée scientifique en sciences et techniques de l’environnement. Université Paris 12, ENPC, CEREVE, Paris.</mixed-citation></ref><ref id="scirp.98095-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Suchel, J.B. (1987) Les climats du Cameroun. Thèse Doctorat d’état, Université de Bordeaux III, Pessac, 1186 p.</mixed-citation></ref><ref id="scirp.98095-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Navajas, M., Lagnel, J., Gutierrez, J. and Boursot, P. (1998) Species-Wide Homogeneity of Nuclear Ribosomal ITS2 Sequences in the Spider Mite of Tetranychus urticae Contrasts with Extensive Mitochondrial COI Polymorphism. Heredity, 80, 742-752. https://doi.org/10.1046/j.1365-2540.1998.00349.x</mixed-citation></ref><ref id="scirp.98095-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Quampah, A., Wang, R.M., Shamsi, I.H., Jilani, G., Zhang, Q., Hua, S. and Xu, H. (2011) Improving Water Productivity by Potassium Application in Various Rice Genotypes. International Journal of Agricultural Biology, 13, 9-17.</mixed-citation></ref><ref id="scirp.98095-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Dong, H., Xiangqiang, K., Li, W., Wei, T. and Dongmei, Z. (2011) Effects of Plant Density and Nitrogen and Potassium Fertilization on Cotton Yield and Uptake of Major Nutrients in Two Fields with Varying Fertility. Field Crops Reserved, 119, 106-113. https://doi.org/10.1016/j.fcr.2010.06.019</mixed-citation></ref><ref id="scirp.98095-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Ogah, E.O., Echezona, B.C. and Umeh, E.-D.N. (2005) Effects of N-Fertilization and Spacing on Africa Rice Gall Midge, Orseolia oryzivora Harris and Gagne in a Sub-Humid Area of South Eastern Nigeria. Agro-Science, 4, 15-18. https://doi.org/10.4314/as.v4i2.1531</mixed-citation></ref><ref id="scirp.98095-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Alfonce, L. and Gration, M.R. (2015) Abundance and Spatial Dispersion of Rice Stem Borer Species in Kahama, Tanzania. Journal of Insect Science, 15, 132. https://doi.org/10.1093/jisesa/iev106</mixed-citation></ref><ref id="scirp.98095-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Bux, M., Khan, M.H., Ahmad, N., Tofique, M. and Ismail, M. (2013) Field Comparison of Different Rice (Oryza sativa l.) Genotypes for Their Resistance against Rice Stem Borers (Pyralidae: Lepidoptera). Pakistan Journal of Agriculture, Agricultural Engineering and Veterinary Sciences, 29, 137-145.</mixed-citation></ref><ref id="scirp.98095-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Ogah, E.O., Odebiyi, J.A., Omoloye, A.A. and Nwilene, F.E. (2012) Evaluation of Some Rice Genotypes for Incidence of African Rice Gall Midge and Its Parasitoid (P. diplosisae). African Crop Science Journal, 20, 137-147.</mixed-citation></ref><ref id="scirp.98095-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Ogah, E.O. and Nwilene, F.E. (2017) Incidence of Insect Pests on Rice in Nigeria: A Review. Journal of Entomology, 14, 58-72. https://doi.org/10.3923/je.2017.58.72</mixed-citation></ref><ref id="scirp.98095-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Ukwungwu, M.N. and Joshi, R.C. (1992) Distribution of the African Rice Gall Midge Orseolia oryzivora Harris and Gagné and Its Parasitoids in Nigeria. Tropical Pest Management, 38, 241-244. https://doi.org/10.1080/09670879209371700</mixed-citation></ref><ref id="scirp.98095-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Cubry, P., Tranchant-Dubreuil, C., Thuillet, A.C., Monat, C., Ndjiondjop, M.N., Labadie, K., Cruaud, C., Engelen, S., Scarcelli, N., Rhoné, B., Burgarella, C., Dupuy, C., Larmande, P., Wincker, P., Franois, O., Sabot, F. and Vigouroux, Y. (2018) The Rise and Fall of African Rice Cultivation Revealed by Analysis of 246 New Genomes. Current Biology, 28, 2274-2282. https://doi.org/10.1016/j.cub.2018.05.066</mixed-citation></ref><ref id="scirp.98095-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">WARDA (1992) Report of the Monitoring Tour to Nigeria and Cameroon. Task Force Meeting Series 10, 21 p.</mixed-citation></ref><ref id="scirp.98095-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Moche, K., Djieto-Lordon, C., Melie Feyem, M.N., Tadu, Z., Nana, P.A., et al. (2014) Agro-Morphological Characterization of Two Rice Varieties from Japan: Orysa sativa l. and Four NERICAS Varieties in an Agro-Ecological Zone of the Town of Yaounde (Cameroon); Comparative Study of Their Performances. International Journal of Current Research, 6, 9941-9946.</mixed-citation></ref><ref id="scirp.98095-ref33"><label>33</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Gagné</surname><given-names> R.J. </given-names></name>,<etal>et al</etal>. (<year>2004</year>)<article-title>A Catalog of the Cecidomyiidae (Diptera) of the World</article-title><source> Memoires of the Entomological Society of Washington</source><volume> 25</volume>,<fpage> 1</fpage>-<lpage>408</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref></ref-list></back></article>