Rosa rugosa
is an important garden ornamental plant which belongs to the genus
Rosa of the family
Rosaceae. The current wild and cultivated R. rugosa are mostly purple, pink, a small amount of white, but lack of yellow, orange and so on. Flavonoids 3’-hydroxylase belongs to CYP75B subfamily of cytochrome P450, and is an essential enzyme in anthocyanins synthesis. In this experiment,
RrF3’
H gene was cloned from the petal of
Rosa rugosa ‘Hunchun’ using RT-PCR, and bioinformatics analysis was performed. The
RrF3’
H gene’s full length of opening reading frame was 1687 bp, encoding 510 amino acids. The formulas of proteins encoded by
RrF3’
H were C
2666
H
4149
N
699
O
734
S
24
. The derived protein had a molecular weight of 58,506.95 Da. The aliphatic index was 90.94. It belongs to unstable hydrophilic protein. The protein consists of 46.76% α-helix, 31.04% random coil, 7.66%
β-corner and 14.54% extended strand. The protein contains 21 Ser phosphorylation sites, 12 Thr phosphorylation sites, and 2 Tyr phosphorylation sites. The protein contained two O-glycosylation sites, located at positions 98 and 263 of the amino acid sequence respectively. The protein has a signal peptide site and a transmembrane structure. In addition, by comparing the expression levels of
RrF3’
H, we found
RrF3’
H was positively correlated with the depth of flower color.
Rosa rugosa originated in China, and it belongs to the genus Rosa in the family Rosaceae. As an important ornamental garden plant, it has graceful shape, sweet-smelling flowers and many varieties. However, the petal colors of R. rugosa are mostly pink, purple and white, but lack of other colors [1] [2] [3]. This monotone coloration seriously limits the use of Rosa rugosa in gardens.
Flavonoid 3’-hydroxylase belongs to the CYP75B subfamily of the P450 family and is essential for the synthesis of anthocyanins. It can catalyze the formation of dihydroquercetin from dihydrokaempferol [4] [5]. Brugliera et al. (1999) [6] cloned the first F3’H gene from Petunia hybrida, and it has been cloned from various plants so far, such as Dendranthema morifolium, Ginkgo biloba, Vitis amurensis, Chimonanthus praecox and Phalaenopsis aphrodite [7] [8] [9] [10]. Yang yuxia et al. (2013) [10] found that the expression level of F3’H in Phalaenopsis aphrodite with red flowers was about 19 times that of Phalaenopsis aphrodite with yellow flower, indicating that F3’H had an important influence on the synthesis of anthocyanin. Petunias with red flowers [11] were obtained by reducing the expression of F3’H gene and over expression of DFR. By inhibiting the expression level of F3’H gene in corydalis viola, it was also found that the content of anthocyanin was significantly reduced and the flower color became lighter [12]. All these studies indicate that the study of F3’H gene is of great significance to the improvement of plant color.
In this study, F3’H gene was cloned from petals of R. rugosa, and analysed its bioinformatics and gene expression in different flowering stages, in order to lay a foundation for future research on pigment formation and color improvement in R. rugosa.
2 Materials and Methods2.1. Plant Materials
Petals were collected from R. rugosa ‘Hunchun’, R. ‘Jiaomeisanbian’, R. ‘Miaoyu’ (Figure 1). From mid-April to the beginning of May 2016, we collected the petals at the soft bud stage, initial opening stage, full opening stage and wilting stage at Shandong Agricultural University Rose Planting Garden, Tai’an City (36˚18'N, 117˚13'E), Shandong Province, China. After picking the petals, we placed them in liquid nitrogen and then stored them at −80˚C for further use.
2.2. Methods2.2.1. Total RNA Extraction and cDNA Synthesis
Total RNA was extracted from petals of different stages using an EASY Spin
Plant RNA Extraction Kit (Aidlab Biotechnologies Co., Ltd.); then, the RNA concentration, purity and integrity were determined using a NanoDrop 2000c Spectrophotometer (Thermo Scientific, USA) and 1.0% nonvariable agarose gel electrophoresis. First-strand cDNA was synthesized directly from the tested RNA samples, and the reaction was performed according to the method of the 5X All-in-One RT MasterMix reverse transcription kit (abm Inc., USA).
2.2.2. Cloning of F3’H
‘Hunchun’ cDNA was used as the template. The specific primers were designed using Primer 5 software and based on the gene fragment in the R. rugosa transcriptome sequencing results (Table 1). Specific amplification of the F3’H open reading frame (ORF) was carried out with reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using cDNA as the template. PCR reaction system was as follows: ddH2O 9.5 µl, 2 × EasyTaqSuperMix 12.5 µl, target gene upstream primer 1 µl and downstream primer 1 µl, template cDNA 1 µl, 25 µl in total. Reaction conditions as follows:: 94˚C for 5 min; 94˚C for 30 s, 53˚C for 30 s, and 72˚C for 1 min, 35 cycles; and then extension at 72˚C for 10 min. PCR products were detected by 1% agarose gel electrophoresis. According to the instructions of Hipure Gel Pure DNA Mini Kit (Magen), the target strip was recovered, then connected with the pmd18-t vector of TaKaRa, transformed into E. coli DH5a, identified by PCR, then the positive clone was selected for sequencing.
2.2.3. Bioinformatics Analysis of F3’H
Online Blast provided by NCBI was used for alignment of homologous sequences. DNAMAN was used to compare the protein with other plant proteins. The basic physicochemical properties of RrF3’H were predicted by ProtParam in ExPasy server. The NCBI CD-search function was used to predict the conserved domain of target genes. ORF Finder was used to search the open reading frame of RrF3’H gene cDNA. ProtScale was used to predict the hydrophobicity of proteins. Online software NetPhos 3.1 server, NetOGlyc 4.0 server and SignalP 4.1 were used to predict the phosphorylation site, glycosylation site and signal peptide of the target gene coding protein. The transmembrane domain of RrF3’H protein was predicted by TMHMM. SOPMA was used to predict the secondary structure of the protein encoded by RrF3’H. MEGA 5.0 was used to construct the RrF3’H phylogenetic tree.
Primers used to clone and expression analysis of RrF3’H
Primer name
Nucleotide sequence (5’-3’)
Purpose
RrF3’H-F
ATGGAGGCTTCAGTTTCTTGG
Intermediate fragment amplification
RrF3’H-R
AGATGGATTGGAAGCCGAG
RrF3’H-1
GGATGGAGGAAGCTTGTGG
3’ RACE amplification
RrF3’H-2
CTCGGCTTCCAATCCATCT
B26
GACTCTAGACGACATCGATTTTTTTTTTTTTTTTT
2.2.4. Gene Expression Analysis
Total RNA extraction and cDNA synthesis were referenced to Section 2.2.1. The expression levels of RrF3’H gene in 4 different flowering stages (soft bud stage, initial opening stage, full opening stage and wilting stage) from R. rugosa ‘Hunchun’, R. ‘Jiaomeisanbian’, R. ‘Miaoyu’ were analyzed via qRT-PCR on a Bio-Rad CFX96TM Real-Time PCR instrument (Bio-Rad, Inc., USA). The qRT-PCR mixture (20 μL total volume) contained 10 μL of SYBR® Premix Ex Taq™ (TaKaRa, Inc., Japan), 7.2 μL of ddH2O, 0.4 μL of each primer and 2 μL of cDNA. The PCR program was carried out with an initial step of 95˚C for 30 s; 40 cycles of 95˚C for 5 s and 60˚C for 30 s; and then 95˚C for 10 s, 65˚C for 5 s and 95˚C for 5 s for the dissociation stage. Each gene was assessed with three biological replicates. The relative expression levels of the genes were calculated via the 2−ΔΔCt method [13].
3. Results and Analysis3.1. Cloning and Sequence Analysis of RrF3’H Gene
The RrF3’H intermediate fragment of 1523 bp was obtained by amplification and sequencing (Figure 2), and the 3’-terminal sequence of 183 bp was obtained after 3’ RACE amplification (Figure 2). The full length of the cDNA sequence of 1687 bp was obtained by splicing the two fragments using DNAstar. DNAMAN was used to analyze the base sequence of RrF3’H, and it was found that RrF3’H included a complete open reading frame (ORF) containing the starting codon ATG and the ending codon TAA, a complete reading frame (ORF) with a length of 1530 bp, encoding 510 amino acids (Figure 3).
DNAMAN software was used to compare the multiple sequences of F3’H protein amino acids in 7 plants, including Rosa rugosa. According to the comparison results (Figure 4), F3’H was highly conserved in different plants, indicating that F3’H homology of different species was very high.
Using MEGA5 to build system phylogenetic tree of the amino acid sequence of 16 kinds of plants (Figure 5), including R. rugosa, it can be seen that R. rugosa was closely related to the members belonging to Rosaceae family. The R. rugosa and Prunus persica converged first means R. rugosa has the most close relationship
with Prunus persica. Then converged with Prunus mume and Narcissus tazetta means that R. rugosa also has a very close relationship with P. mume and N. tazetta. In addition, they converged to a large group with Prunus cerasifera and Paeonia lactiflora, but it was relatively distant from other plants.
3.2. Bioinformatics Analysis
RrF3’H belongs to the P450 superfamily, with corresponding conservative structure domains. The formulas of proteins encoded by RrF3’H were C2666H4149N699O734S24. The derived protein had a molecular weight of 58506.95 Da, a calculated pI of
7.65. Instability index of the protein is 45.18 (>40), so it can be speculated that RrF3’H encoded protein is unstable protein. The aliphatic index was 90.94. The grand average of hydropathicity is −0.207, which means it’s hydrophilic protein. The secondary structure prediction result demonstrated that the protein consists of 46.76% α-helix, 31.04% random coil, 7.66% β-corner and 14.54% extended strand. The protein contains 21 Ser phosphorylation sites, 12 Thr phosphorylation sites, and 2 Tyr phosphorylation sites. The protein contained two O-glycosylation sites, located at positions 98 and 263 of the amino acid sequence respectively. In addition, the protein has a signal peptide site and a transmembrane structure.
3.3. Expression Patterns of RrF3’H in Different Flowering Stages
The expression levels of RrF3’H were compared among the petals of R. ‘Hunchun’, R. ‘Jiaomeisanbian’, R. ‘Miaoyu’ at different stages (soft bud stage, initial opening stage, full opening stage and wilting stage). The expression patterns of the gene are shown in Figure 6. The results showed the expression level of this gene was the highest in the full openning stage, and the lowest in the soft bud stage. It shows a trend of rising first and then falling. In addition, in each opening stage, the expression level of RrF3’H was the highest in ‘Hunchun’, followed by ‘Jiaomeisanbian’, and the expression level was the lowest in ‘Miaoyu’.
4. Discussion
Previous research has clearly shown that flower color intensity is largely determined by the amount of accumulated anthocyanins, and the anthocyanin biosynthetic pathway is well known [14] [15] [16]. Flavonoid 3’-hydroxylase (F3’H) is one of the key enzymes in the synthesis of anthocyanins in plants. It can catalyze the formation of dihydroquercetin from dihydrokaempferol, therefore, it plays an important role in the formation of plant color [5] [17]. In addition, in R. rugosa, F3’H competes with DFR and FLS for the common substrate dihydrokaempferol, so F3’H is of great significance for changing the color of R. rugosa. In this study, the RrF3’H gene was successfully cloned from R. rugosa, and analysed
its bioinformatics. RrF3’H gene contains 1687bp open reading frame, encodes 510 amino acids, its molecular formula is C2666H4149N699O734S24, its molecular weight is 58,506.95 Da, and these features are similar to those found in most plants [18]. By comparing the amino acid sequences of RrF3’H and the corresponding proteins in other plants, we found that the amino acid sequences of RrF3’H have higher homology with those of other plants, indicating that F3’H is relatively conservative among different species. The secondary structures were composed of α-helix, random coil, β-corner and extended strand. The α-helix domain can cause the bilayer of phospholipids to bend inward, which can resist the cell membrane damage caused by low temperature and protect the cell structure [19]. RrF3’H has multiple phosphorylation sites, indicating that reversible phosphorylation regulation plays an important role in achieving its functions.
By comparing the expression levels of RrF3’H among the petals at different stages, we found the expression level of this gene was the highest in the full openning stage, and the lowest in the soft bud stage. It shows a trend of rising first and then falling. Therefore, the full opening stage may be the time when anthocyanins are synthesized in large quantities in R. rugosa. By comparing the expression level of RrF3’H gene in the petals of the three varieties, we found that the expression level of RrF3’H was positively correlated with the depth of flower color; the gene expression level will be higher in redder flowers. It showed the highest expression level in ‘Hunchun’ and the lowest expression level in ‘Miaoyu’. Therefore, RrF3’H is indeed related to the formation of flower color in R. rugosa, and the higher the expression of RrF3’H gene, the more the anthocyanin synthesis. In this study, F3’H gene in R. rugosa petals was isolated and analyzed to find out the information of this gene, which provided a theoretical basis for the improvement of R. Rugosa’s color in the future.
5. Conclusion
We successfully cloned the RrF3’H from the R. rugosa, and the protein encoded by this gene is highly similar to that in other plants. In addition, this gene plays an important role in the formation of the color of R. rugosa and is positively correlated with the amount of anthocyanin synthesis.
Acknowledgements
This project was supported by the Agricultural Seed Project of Shandong Province ([2014] No. 96).
Conflicts of Interest
The authors declare no conflicts of interest regarding the publication of this paper.
Cite this paper
Jin, J.F., Li, Z.J., Zhao, L.Y. and Li, Z.J. (2020) Cloning and Analysis of RrF3’H in Rosa rugosa. American Journal of Molecular Biology, 10, 51-60. https://doi.org/10.4236/ajmb.2020.101005
NOTESReferencesLi, M. (2006) Survey and Quality Evaluation of Shandong Rose Varieties. Shandong University of Traditional Chinese Medicine, Jinan.Zhang, L., Xu, Z.D., Tang, T.F., Zhang, H. and Zhao, L.Y. (2015) Analysis of Anthocyanins Related Compounds and Their Biosynthesis Pathways in Rosa rugosa “Zi zhi” at Blooming Stages. Scientia Agricultura Sinica, 48, 2600-2611.Li, Z.J., Zhao, M.Y., Jin, J.F., et al. (2018) Anthocyanins and Their Biosynthetic Genes in Three Novel-Colored, Rosa rugosa, Cultivars and Their Parents. Plant Physiology and Biochemistry, 129, 421-428.
https://doi.org/10.1016/j.plaphy.2018.06.028Graham, S.E. and Peterson, J.A. (1999) How Similar Are P450s and What Can Their Differences Teach Us? Archives of Biochemistry & Biophysics, 369, 24.
https://doi.org/10.1006/abbi.1999.1350Schuler, M.A. and Werck-Reichhart, D. (2003) Functional Genomics of P450s. Annual Review of Plant Biology, 54, 629-667.
https://doi.org/10.1146/annurev.arplant.54.031902.134840Brugliera, F., Barri-Rewell, G., Holton, T.A., et al. (1999) Isolation and Characterization of a Flavonoid 3’-Hydroxylase cDNA Clone Corresponding to the Ht1 Locus of Petunia hybrida. Plant Journal, 19, 441-451.
https://doi.org/10.1046/j.1365-313X.1999.00539.xChen, S.M., Lv, G.S., Zhu, X.R., et al. (2011) Cloning and Expression Profiles of CgF3’H in Chrysanthemum. Molecular Plant Breeding, 9, 623-628.Li, L.L., Cheng, H., Chen, X.L., et al. (2015) Molecular Cloning, Characterization and Expression of Flavonoid 3’Hydroxylase-Like Protein Gene from Ginkgo biloba. Acta Horticulturae Sinica, 42, 643-654.Liu, H.F., Yang, C.J., Yu, M. and Wang, J. (2009) cDNA Cloning and Analysis of UDP-Glucose: Flavonoid 3-O-Glucosyltransferase (3GT) in Vitis amurensis. Plant Physiology Communications, 45, 748-752.Yang, Y.X., Sun, F.F. and Zhang, C.W. (2013) Construction of Full-Length cDNA Library and the cDNA Cloning of F3’H in Phalaenopsis. Acta Botanica Boreali-Occidentalia Sinica, 33, 1731-1738.Tsuda, S., Fukui, Y., Nakamura, N., et al. (2004) Flower Color Modification of Petunia hybrida Commercial Varieties by Metabolic Engineering. Plant Biotechnology, 21, 377-386. https://doi.org/10.5511/plantbiotechnology.21.377Nakamura, N., Masako, F.M., Fukui, Y., et al. (2010) Generation of Red Flower Varieties from Blue Torenia hybrida by Redirection of the Flavonoid Pathway from Delphinidin to Pelargonidin. Plant Biotechnology, 27, 375-383.
https://doi.org/10.5511/plantbiotechnology.10.0610aSchmittgen, T.D. and Livak, K.J. (2008) Analyzing Real-Time PCR Data by the Comparative C(T) Method. Nature Protocols, 3, 1101.
https://doi.org/10.1038/nprot.2008.73Zeng, S., Liu, Y., Wu, M., et al. (2014) Identification and Validation of Reference Genes for Quantitative Real-Time PCR Normalization and Its Applications in Lycium. PLoS ONE, 9, e97039. https://doi.org/10.1371/journal.pone.0097039Miyagawa, N., Miyahara, T., Okamoto, M., et al. (2015) Dihydroflavonol 4-Reductase Activity Is Associated with the Intensity of Flower Colors in Delphinium. Plant Biotechnology, 32, 4445-4452. https://doi.org/10.5511/plantbiotechnology.15.0702bZou, L.Q., Wang, C.X., Kuang, X.J., et al. (2016) Advance in Flavonoids Biosynthetic Pathway and Synthetic Biology. China Journal of Chinese Materia Medica, 41, 4124-4128.Chapple, C. (1998) Molecular-Genetic Analysis of Plant Cytochrome P450-Dependent Monooxygenases. Annual Review of Plant Physiology and Plant Molecular Biology, 49, 311-343. https://doi.org/10.1146/annurev.arplant.49.1.311Ding, L., Li, C.H., Huang, S.H., et al. (2015) Research Progress on Flavonoid 3’Hydroxylase Gene Which Regulates Flower Color in Ornamental Plants. Northern Horticulture, No. 17, 188-193.Zhang, L.L., Li, J.F. and Wang, A.X. (2008) The Role of the Transcription Factor CBF Genes in Cold-Responsive Molecular Mechanism. Acta Horticulturae Sinica, 35, 765-771.