<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OJMM</journal-id><journal-title-group><journal-title>Open Journal of Medical Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3372</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ojmm.2019.94018</article-id><article-id pub-id-type="publisher-id">OJMM-96856</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Medicine&amp;Healthcare</subject></subj-group></article-categories><title-group><article-title>
 
 
  &lt;i&gt;cagA&lt;/i&gt; and &lt;i&gt;vacA&lt;/i&gt; &lt;i&gt;Helicobacter pylori&lt;/i&gt; Pathogenicity Factors in Brazzaville, Congo
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>E.</surname><given-names>N. Ontsira Ngoyi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>C.</surname><given-names>Guilloteau</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>L.</surname><given-names>Benejat</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>A.</surname><given-names>Mongo Onkouo</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>A.</surname><given-names>Buissonnière</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>E.</surname><given-names>Sifre</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>A.</surname><given-names>Aloumba</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Tanguy</surname><given-names>Mieret</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>F.</surname><given-names>Bossali</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>F.</surname><given-names>Yala</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>A.</surname><given-names>A. Abena</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>J.</surname><given-names>Vadivelu</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>K.</surname><given-names>L. Goh</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>J.</surname><given-names>R. Ibara</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>B.</surname><given-names>I. AtipoIbara</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>A.</surname><given-names>Menard</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>P.</surname><given-names>Lehours</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>F.</surname><given-names>Megraud</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>French National Reference Center for Helicobacters and Campylobacters, Bordeaux, France</addr-line></aff><aff id="aff1"><addr-line>Equipe 2 Helicobacter pylori infection inflammation and cancer, Inserm U1053, Bordeaux university, Bordeaux, France</addr-line></aff><aff id="aff5"><addr-line>Bacteriology laboratory, Pellegrin University Hospital, Bordeaux, France</addr-line></aff><aff id="aff4"><addr-line>University of Malaya, Kuala Lumpur, Malaysia</addr-line></aff><aff id="aff3"><addr-line>Health Sciences Faculty, Marien Ngouabi University, Brazzaville, Congo</addr-line></aff><pub-date pub-type="epub"><day>10</day><month>10</month><year>2019</year></pub-date><volume>09</volume><issue>04</issue><fpage>186</fpage><lpage>200</lpage><history><date date-type="received"><day>5,</day>	<month>September</month>	<year>2019</year></date><date date-type="rev-recd"><day>30,</day>	<month>November</month>	<year>2019</year>	</date><date date-type="accepted"><day>3,</day>	<month>December</month>	<year>2019</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  <b>Introduction:</b> 
  CagA and 
  VacA are the most important and well-studied virulence factors found in 
  Helicobacter pylori. The aim of this work was to identify genes corresponding to 
  H. pylori pathogenicity factors in Brazzaville, Congo. 
  <b>Material &amp; Methods:</b> A cross-sectional study was carried out from October 2013 to December 2016. Biopsy specimens were obtained from patients scheduled for upper gastrointestinal endoscopy in Brazzaville, Congo and were sent to the French National Reference Center for Campylobacters and Helicobacters in Bordeaux, France. 
  H. pylori detection was conducted by real-time PCR using a fuorescence resonance energy transfer-melting curve analysis protocol. The identification of the genes encoding pathogenicity factors was carried out by conventional PCR using the appropriate primers for determination of 
  CagA phosphorylation motifs 1, 2, 3; and 
  vacAs, I and m regions: 
  vacAi1, 
  vacAi2, 
  vacAs1a, 
  vacAs1b. 
  <b>Results:</b> A high prevalence of 
  H. pylori infection was reported (108/143; 75.5%). In 92.2% (n = 71/77), the presence of P1, P2 and P3 
  CagA phosphorylation motifs was noted. Concerning 
  vacA, 
  vacAs1m1 was observed in 82% of the strains (n = 59/72). 
  vacAi1 was present in all strains (n = 76). With regard to the distribution according to the 
  vacAs1 subtype, the majority of the strains (59/71; 83%) were 
  vacAs1b positive, as compared to 
  vacAs1c (17/34, 33%). The 
  vacAs1a gene was absent in all of these patients. 
  <b>Conclusion:</b> The presence of genes associated with severe gastric diseases indicates the importance of 
  H. pylori eradication in the prevention of these diseases in Congo.
 
</p></abstract><kwd-group><kwd>Pathogenicity Factors</kwd><kwd> &lt;i&gt;Cag&lt;/i&gt;A</kwd><kwd> &lt;i&gt;Vac&lt;/i&gt;A</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>More than 50% of the world population is infected with Helicobacter pylori. The bacterium is highly linked to peptic ulcer diseases (PUD). At least 10% of infected individuals develop PUD, and 1% - 3% develop gastric cancer [<xref ref-type="bibr" rid="scirp.96856-ref1">1</xref>]. The gastric cancer risk in H. pylori infected people is 2 to 7 times that of the uninfected. Ninety percent of distal gastric cancers are now considered to be the consequence of H. pylori infection. The WHO classified H. pylori as a group I carcinogen in 1994 (ref IARC) which they reconfirmed later [<xref ref-type="bibr" rid="scirp.96856-ref2">2</xref>].</p><p>H. pylori exerts its pathogenicity through/via several virulence factors, some of which influence colonization and the severity of the disease. One of the best characterized virulence factors is the CagA protein encoded by the cagA gene present in the cag pathogenicity island (cagPAI). The cagPAI also encodes a type IV secretion system (T4SS), representing a needle-like pilus, which is induced upon contact with host cells [<xref ref-type="bibr" rid="scirp.96856-ref3">3</xref>]. CagA is translocated by this T4SS across both the bacterial and host cell membranes into the cytoplasm of target cells. CagA represents a prime example of a tyrosine-phosphorylatable bacterial virulence factor [<xref ref-type="bibr" rid="scirp.96856-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref5">5</xref>]. Upon delivery, members of the c-Src [<xref ref-type="bibr" rid="scirp.96856-ref3">3</xref>] and c-Abl host tyrosine kinase families were identified as having phosphorylated CagA. Mass spectrometry and site-directed mutagenesis of CagA identified a set of Glu-Pro-Ile-Tyr-Ala (EPIYA) repeat motifs as phosphorylation sites [<xref ref-type="bibr" rid="scirp.96856-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref6">6</xref>].</p><p>CagA positive H. pylori strains are associated with increased inflammation and increased risk of PUD and gastric carcinoma in humans and experimental animals [<xref ref-type="bibr" rid="scirp.96856-ref7">7</xref>]. The presence of the protein CagA generally coincides with the presence of other virulence factors, including VacA, BabA and OipA [<xref ref-type="bibr" rid="scirp.96856-ref8">8</xref>]. Thus, the pathogenesis of H. pylori is multifactorial and cannot be reduced to a gene. The CagA protein is responsible for alterations of many cell signaling systems which profoundly influence the physiology of the host cell. When H. pylori is in contact with the host cells, the CagA protein is directly injected into the cytoplasm of the host cell where it is phosphorylated and binds to the host’s SHP2 domain [<xref ref-type="bibr" rid="scirp.96856-ref9">9</xref>]. SHP-2 is a phosphatase involved in signal transduction for the tyrosine kinase receptor [<xref ref-type="bibr" rid="scirp.96856-ref10">10</xref>]. CagA also causes the passage/transformation/evolution of an epithelial cell to a mesenchymal cell phenotype [<xref ref-type="bibr" rid="scirp.96856-ref11">11</xref>]. All of these phenotypes are associated with gastric carcinogenesis [<xref ref-type="bibr" rid="scirp.96856-ref12">12</xref>]. The vacuolating toxin VacA has been named for its ability to induce many large vacuoles in cultured cells. Unlike CagA, the VacA protein forms an autotransporter structure and secretes itself without the need for contact with the host cell. VacA proteins then oligomerize to form pore-like structures. VacA is transported to the receptor tyrosine phosphatase (RPTPα and RPTPβ) and other transmembrane glycosylated proteins on the surface of the host cell [<xref ref-type="bibr" rid="scirp.96856-ref13">13</xref>]. VacA then enters by endocytosis and forms selective anion channels in the vacuole membrane. The channels allow the accumulation of chloride anions and weak bases, resulting in osmotic swelling [<xref ref-type="bibr" rid="scirp.96856-ref14">14</xref>]. VacA also inserts into mitochondrial membranes, causing mitochondrial dysfunction and apoptotic cell death [<xref ref-type="bibr" rid="scirp.96856-ref15">15</xref>]. Vacuolization is not the only effect of VacA intoxication. VacA disrupts the barrier function of epithelial cells, allowing leakage of essential nutrients such as iron, nickel, and amino acids. All H. pylori strains contain vacA genes, but not all strains produce a functional VacA protein. This is due to polymorphisms in the vacA gene, particularly at the amino-terminal (s region), in the middle of the gene (m region), and in the intermediate region (region i). The s2 polymorphism gives/results in an inactive toxin [<xref ref-type="bibr" rid="scirp.96856-ref16">16</xref>]. Thus, strains with the s2 allele are often called “VacA negative”. Polymorphisms have been discovered more recently and influence vacuolating activity; vacA containing the allele i1 produces the most active toxin. Strains harboring the s1m1 allele have been most commonly associated with PUD and gastric carcinomas, but it now appears that the i1 allele is more strongly associated with these diseases than the presence of the s1m1 genotype [<xref ref-type="bibr" rid="scirp.96856-ref16">16</xref>].</p><p>The aim of this work was to identify cagA and vacA polymorphism genotypes corresponding to H. pylori pathogenicity factors in Brazzaville, Congo.</p></sec><sec id="s2"><title>2. Material and Methods</title><sec id="s2_1"><title>2.1. Obtention of Gastric Biopsies</title><p>A cross-sectional study was carried out between 2013 to December 2016.</p><p>Inclusion criteria: Biopsy specimens were obtained in the Schnell Clinic (a private medical clinic in Brazzaville, Congo), from patients who were never treated for H. pylori eradication, scheduled for an upper gastrointestinal endoscopy. Patients were aged 17 years and over and of any sex and consent to the study protocol. It was patients in routine consultation who consent to the study protocol.</p><p>The exclusion criteria were: the impossibility to perform a biopsy, incomplete endoscopy, a technical defect, a contra indication to perform a biopsy (the taking in the previous month of a treatment with anti-secretory gastric, antibiotic or anti-inflammatory no steroids).</p></sec><sec id="s2_2"><title>2.2. H. Pylori DNA Extraction</title><p>Gastric biopsies were obtained and sent to the National Reference Center for Campylobacters and Helicobacters in Bordeaux, France where they were ground in 1 mL of brucella broth for molecular study. A small fragment was digested in 20 &#181;l of proteinase K (Qiagen SA, Courtaboeuf, France) with 180 &#181;l of lysis buffer (Qiagen) in 1.5 &#181;l tube. This last tube was then placed on a block heating at 56˚C at 1000 tours/minute and incubated overnight. DNA extraction was performed by using a MagNA Pure LC DNA isolation kit I (Qiagen), and then used to detect H. pylori and in the determination of the pathogenicity factors.</p></sec><sec id="s2_3"><title>2.3. Detection of H. Pylori</title><p>Detection of H. pylori was performed by real-time PCR, which also determined point mutations in the 23S rRNA gene associated with clarithromycin resistance, as previously described [<xref ref-type="bibr" rid="scirp.96856-ref17">17</xref>]. The method included ampliﬁcation of a fragment of the H. pylori 23S rRNA gene coupled with a simultaneous detection of the amplicon by probe hybridization, followed by a melting curve analysis [<xref ref-type="bibr" rid="scirp.96856-ref18">18</xref>].</p></sec><sec id="s2_4"><title>2.4. CagPAI Empty Site PCR</title><p>cagPAI status was evaluated by amplification of cagAlocus using conventional PCR, with previously described primers [<xref ref-type="bibr" rid="scirp.96856-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref20">20</xref>].</p><p>Thus, specific primers for the cag empty site were also used to confirm the presence or absence of the cagPAI locus [<xref ref-type="bibr" rid="scirp.96856-ref21">21</xref>] ( [<xref ref-type="bibr" rid="scirp.96856-ref22">22</xref>] Kersulyte et al., 1999).</p><p>The primers used are presented in <xref ref-type="table" rid="table1">Table 1</xref>.</p><p>The PCR were carried out in a 25 &#181;l volume containing: 15 &#181;l of water; 5 &#181;l of PCR buffer 5X (Promega); 0.25 &#181;l of a 10mMmixture of deoxynucleoside triphosphates (dNTPs) (Eurobio); 0.25 &#181;l of Taq DNA polymerase (5 U/ml) (Eurobio); 1 &#181;l of each primer (10 &#181;M)and 2.5 &#181;l of H. pylori DNA. After 2 minutes of denaturation at 95˚C, each reaction mixture was amplified for 40 cycles as follows: 30 sec at 95&#176;C; 30 sec of annealing at 58˚C (for cagA); and 30 sec at 72˚C. After the last cycle, extension was continued for another 5 min at 72˚C. All PCR products were analyzed on a 2% agarose gel stained with ethidium bromide. When the cagPAI gene was absent, a324 bp band was observed. H. pylori DNA extracts from strains GC 34 and 3829 were used as controls.</p></sec><sec id="s2_5"><title>2.5. CagA Phosphorylation Motifs Detected by PCR</title><p>CagA phosphorylation motifs were determined by conventional PCR. The primers used are presented in <xref ref-type="table" rid="table1">Table 1</xref>.</p><p>The PCR was carried out in a 25 &#181;l volume containing: 15.875 &#181;l of water; 5 &#181;l of PCR buffer 5&#215; (Promega); 0.5 &#181;l of 10 mM of a mixture of deoxynucleoside</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers for genotyping of CagA</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primers</th><th align="center" valign="middle" >Sequence (5’-3’)</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle"  colspan="3"  >CagPAI empty site</td></tr><tr><td align="center" valign="middle" >468 HP519 496 HP549</td><td align="center" valign="middle" >GCT TGC TTG TAT TGG CCT TG GCA TGC ACA TTC CCT AAA GTG</td><td align="center" valign="middle" >Achtman et al., 1999; Kersulyte et al., 1999</td></tr><tr><td align="center" valign="middle"  colspan="3"  >CagA phosphorylation motifs</td></tr><tr><td align="center" valign="middle" >cagA28F</td><td align="center" valign="middle" >TTCTCAAAGGAGCAATTGGC</td><td align="center" valign="middle"  rowspan="5"  >Argent et al., 2005</td></tr><tr><td align="center" valign="middle" >cagA-P1C</td><td align="center" valign="middle" >GTCCTGCTTTCTTTTTATTAACTTK AGC</td></tr><tr><td align="center" valign="middle" >cagA-P2CG</td><td align="center" valign="middle" >TTTAGCAACTTGAGCGTAAATGGG</td></tr><tr><td align="center" valign="middle" >cagA-P2TA</td><td align="center" valign="middle" >TTTAGCAACTTGAGTATAAATGGG</td></tr><tr><td align="center" valign="middle" >cagA-P3E</td><td align="center" valign="middle" >ATCAATTGTAGCGTAAATGGG</td></tr><tr><td align="center" valign="middle" >cagA-pD</td><td align="center" valign="middle" >TTGATTTGCCTCATCAAAATC</td><td align="center" valign="middle" >Jones et al., 2009</td></tr></tbody></table></table-wrap><p>triphosphates (dNTPs) (Eurobio); 0.125 &#181;l of Taq DNA polymerase (5 U/ml) (Eurobio); 0.5 &#181;l of each primer (25 &#181;M) and 2.5 &#181;l of H. pylori DNA. After 2 min of denaturation at 95˚C, each reaction mixture was amplified for 35 cycles (for cagA phosphorylation motifs genes P1 and P2) and 45 cycles (for cagA phosphorylation motifP3) as follows: 30 sec at 95˚C; 30 sec of annealing at 57˚C (for cagA); and 20 sec at 72˚C (CagA P1) or 25 sec at 72˚C (cagA P2) or 50 sec at 72˚C (cagA P3). After the last cycle, extension was continued for another 5 minutes at 72˚C. All PCR products were analyzed on a 2% agarose gel stained with ethidium bromide. A264 bp band was observed for cagAP1, 309 pb for cagAP2, and 485 pb for cagA P3. Reference DNA extracts from H. pylori strains J99 and 7.13 were used as controls.</p></sec><sec id="s2_6"><title>2.6. VacA Genotyping PCR</title><p>The vacA signal (s) and middle (m) regions were typed by conventional PCR, using the primers as previously described (<xref ref-type="table" rid="table2">Table 2</xref>) [<xref ref-type="bibr" rid="scirp.96856-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref24">24</xref>]. The patients were identified at first as type s1 or s2 and type m1 or m2. All extract DNA with signal region type s1 were further characterized into s1a, s1b or s1c variants by performing three separate PCR assays. Thermal cycling conditions for each set of primers (0.5 μM) were 95˚C for 1 min, and 52˚C for 1 min, for a total of 35 cycles. After 2 min of denaturation at 94˚C, each reaction mixture was amplified for 35 cycles as follows: 30 sec at 94˚C; 30 sec of annealing at 58˚C (for vacAi1 and vacAi2) or 30 sec of annealing at 60˚C (vacA s, m, s1a, s1b and s1c); 30 sec at 72˚C (vacA s, m, s1a, s1b and s1c) or 40 sec at 72˚C (for vacAi1 and vacAi2). After the last cycle, extension was continued for another 5 min at 72˚C. All PCR products were analyzed on a 2% agarose gel stained with ethidium bromide. A 567 bp band was observed for vacAm1, a642 bp band for vacAm2, a259 bp band for vacAs1 and a286 bp bandforvacAs2. DNA extracts from H. pylori strains J99 ss1, 7.13, B38, 26695 were used as controls.</p></sec><sec id="s2_7"><title>2.7. Statistical Analysis</title><p>The data were analyzed using the GraphPad Prism 7 software. The chi-square test (Ki<sup>2</sup>) was used to compare the genotype frequencies of cagA and vacA and the frequencies of upper gastrointestinal endoscopy results. The confidence</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Primers for genotyping of vacA s and m</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primers</th><th align="center" valign="middle" >Sequence (5’-3’)</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle" >VA1-F</td><td align="center" valign="middle" >ATGGAAATACAACAAACACAC</td><td align="center" valign="middle"  rowspan="4"  >Atherton et al., 1995</td></tr><tr><td align="center" valign="middle" >VA1-R</td><td align="center" valign="middle" >CTGCTTGAATGCGCCAAAC</td></tr><tr><td align="center" valign="middle" >VAG-F</td><td align="center" valign="middle" >CAATCTGTCCAATCAAGCGAG</td></tr><tr><td align="center" valign="middle" >VAG-R</td><td align="center" valign="middle" >GCGTCAAAATAATTCCAAGG</td></tr><tr><td align="center" valign="middle" >C1R</td><td align="center" valign="middle" >TTAATTTAACGCTGTTTGAAG</td><td align="center" valign="middle"  rowspan="2"  >Rhead et al., 2007</td></tr><tr><td align="center" valign="middle" >C2R</td><td align="center" valign="middle" >GATCAACGCTCTGATTTGA</td></tr></tbody></table></table-wrap><p>interval was 95%. The difference between the frequencies was considered significant when the p-value was less than 0.05.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Characteristics of the Patients</title><p>A total of 143 patients were included in the study. Seventy-one patients (49.7%) were male and 72 (50.3%) female (sex ratio F/M = 1); 120 patients (83.9%) were outpatients and 23 (16.1%) were hospitalized. The age of the patients was between 17 and 76 years, with an average mean age of 43.9 +/− 15.3 years.</p></sec><sec id="s3_2"><title>3.2. H. pylori Prevalence</title><p>A high prevalence of H. pylori infection was reported (108/143; 75.5%). The prevalence in the 17 - 37 year age group was 95.8% (46+/48), in the 38 - 58 year age group 85.1% (46+/54), and in the 59 - 76 year age group 83.3% (35+/41) (p &gt; 0.05).</p></sec><sec id="s3_3"><title>3.3. Distribution of vacA and cagA Alleles</title><p>The cagPAI was present in 93.9% (77/82) and absent in 6.1% (5/82). Then, the prevalence of cagA genotype was noted in 93.9% (77/82). In 92.2%, the presence of P1, P2 and P3 phosphorylation motifs of the cagA were noted and vacA s1m1 was present in 82%. The prevalence of the different pathogenicity factors and their relationship with the upper gastrointestinal endoscopy results are presented in <xref ref-type="table" rid="table3">Table 3</xref> and <xref ref-type="table" rid="table4">Table 4</xref>. Figures 1-3 present the 2% Agarose gel</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Prevalence of cagA and vacA genotypes</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Pathogenicity factors (genes)</th><th align="center" valign="middle"  colspan="2"  >Frequency</th></tr></thead><tr><td align="center" valign="middle" >n</td><td align="center" valign="middle" >%</td></tr><tr><td align="center" valign="middle" >cagA allele (N = 77)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >cagAP1, P2, P3</td><td align="center" valign="middle" >71</td><td align="center" valign="middle" >92.2</td></tr><tr><td align="center" valign="middle" >cagAP2, P3</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >3.9</td></tr><tr><td align="center" valign="middle" >cagAP3</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >3.9</td></tr><tr><td align="center" valign="middle" >vacA alleles s and m (N = 72)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >vacAs1m1</td><td align="center" valign="middle" >59</td><td align="center" valign="middle" >81.9</td></tr><tr><td align="center" valign="middle" >vacAs2m1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1.4</td></tr><tr><td align="center" valign="middle" >vacAs2m2</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1.4</td></tr><tr><td align="center" valign="middle" >vacAs1</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >12.5</td></tr><tr><td align="center" valign="middle" >vacAs2</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1.4</td></tr><tr><td align="center" valign="middle" >vacAm1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1.4</td></tr><tr><td align="center" valign="middle" >vacAallele i1 (N = 76)</td><td align="center" valign="middle" >76</td><td align="center" valign="middle" >100</td></tr><tr><td align="center" valign="middle" >vacAallele s1a (N = 71)</td><td align="center" valign="middle" >00</td><td align="center" valign="middle" >00</td></tr><tr><td align="center" valign="middle" >vacAallele s1b (N = 71)</td><td align="center" valign="middle" >59</td><td align="center" valign="middle" >83</td></tr><tr><td align="center" valign="middle" >vacAallele s1c (N = 51)</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >33.3</td></tr></tbody></table></table-wrap><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> cagA and vacA genotypes andupper gastrointestinal endoscopy results</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="3"  >Gene characteristic</th><th align="center" valign="middle"  colspan="5"  >cagA and vacA genotypes and upper gastrointestinal endoscopy results</th></tr></thead><tr><td align="center" valign="middle"  colspan="2"  >Gastritis</td><td align="center" valign="middle"  colspan="2"  >No gastritis</td><td align="center" valign="middle"  rowspan="2"  >P value</td></tr><tr><td align="center" valign="middle" >n</td><td align="center" valign="middle" >%</td><td align="center" valign="middle" >n</td><td align="center" valign="middle" >%</td></tr><tr><td align="center" valign="middle" >cagA (N = 82)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Present (N = 77)</td><td align="center" valign="middle" >47</td><td align="center" valign="middle" >61.04</td><td align="center" valign="middle" >30</td><td align="center" valign="middle" >38.96</td><td align="center" valign="middle"  rowspan="2"  >0.9999</td></tr><tr><td align="center" valign="middle" >Absent (N = 5)</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >60</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >40</td></tr><tr><td align="center" valign="middle" >vacAs1m1 (N = 59)</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >33.9</td><td align="center" valign="middle" >39</td><td align="center" valign="middle" >66.1</td><td align="center" valign="middle"  rowspan="2"  >0.0642</td></tr><tr><td align="center" valign="middle" >vacA s et m nons1m1 (N = 13)</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >61.54</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >38.46</td></tr><tr><td align="center" valign="middle" >vacAs1b (N = 59)</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >52.54</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >47.46</td><td align="center" valign="middle"  rowspan="2"  >0.3666</td></tr><tr><td align="center" valign="middle" >vacA s nons1b (N = 12)</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >58.33</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >41.67</td></tr><tr><td align="center" valign="middle" >vacA s1c (N = 17)</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >52.95</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >47.05</td><td align="center" valign="middle"  rowspan="2"  >0.5461</td></tr><tr><td align="center" valign="middle" >vacA non s1c (N = 34)</td><td align="center" valign="middle" >21</td><td align="center" valign="middle" >61.76</td><td align="center" valign="middle" >13</td><td align="center" valign="middle" >38.24</td></tr></tbody></table></table-wrap><p>Not statistically significant (p &gt; 0.05).</p><p>electrophoresis of PCR amplicon of the phosphorylation motif Cag A 3 (P3), VacA m1 and m2 and VacA s1 and s2. There was no significant difference between the male and female patients with regard to the pathogenicity factors (p &gt; 0.05).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>This study reports a high prevalence of H. pylori infected individuals in the Congo (75.5%). These results are similar to those in the study by Ankouane Andoulo et al. in Cameroun, who reported a prevalence of 72.5% [<xref ref-type="bibr" rid="scirp.96856-ref25">25</xref>].</p><p>Indeed, most patients harbour strains with the cagA gene (93.9%) and all cagA gene have phosphorylatable motifs with 92.2% of cagAP1, P2, P3. Some studies reported that cagA is present in approximately 70% of strains worldwide, but this rate varies geographically, from between 90% - 95% in East Asian countries (South Korea, China, Japan) to only about 40% in Western countries [<xref ref-type="bibr" rid="scirp.96856-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref27">27</xref>]. In Africa, Kidd, Lastovica, Atherton, et al. found the presence of cagA in all South African strains [<xref ref-type="bibr" rid="scirp.96856-ref28">28</xref>]. Our results indicate that our patients, are at risk for severe gastroduodenal diseases due to the CagA proteins. Indeed, H pylori could directly deliver the CagA protein into the host epithelial cell cytoplasm via the cagPAI-coded type IV export system [<xref ref-type="bibr" rid="scirp.96856-ref29">29</xref>]. Inside the epithelial cells, the CagA protein undergoes tyrosine phosphorylation by the host Src family protein tyrosine kinases, and the CagA protein binds an Src homology 2 (SH-2) domain-containing tyrosine phosphatase SHP-2, and stimulates the division and proliferation of gastric epithelial cells [<xref ref-type="bibr" rid="scirp.96856-ref9">9</xref>]. The CagA-Csk interaction activates Csk and inactivates the Src family kinases, thereby bringing about a decrease in CagA tyrosine-phosphorylation as well as in CagA-SHP2 interactions as a feedback mechanism [<xref ref-type="bibr" rid="scirp.96856-ref30">30</xref>]. Through/Via this mechanism, chronic infection with CagA-positive strains persists, thus causing the host damage. A typical characteristic of AGS gastric epithelial cells infected with cagPAI-positive H. pylori is their “hummingbird” phenotype [<xref ref-type="bibr" rid="scirp.96856-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref6">6</xref>]. This in vitro phenotype likely mirrors numerous in vivo signaling activities that control host cell motility, invasive growth and metastasis of cancer cells [<xref ref-type="bibr" rid="scirp.96856-ref31">31</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref32">32</xref>]. Otherwise the oncogenic role of CagA is further supported by in vivo experiments in mice, where transgenic cagA expression in the stomach leads to gastric epithelial hyperplasia, adenocarcinoma, myeloid leukemia and B-cell lymphoma [<xref ref-type="bibr" rid="scirp.96856-ref33">33</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref34">34</xref>].</p><p>In addition, patients with chronic H. pylori infection in Brazzaville also have the risk of developing gastritis and ulcer pathologies. Indeed, this demonstrates that the CagA protein is a multiple effector via phosphorylation independ/via T4SS to activate the NF-κB-inducing kinase (NIK) and IκB kinase α/β (IKKα/β) resulting in subunit IκBα of NF-κB (trimer IκBα/p50/p60) phosphorylation and then degradation [<xref ref-type="bibr" rid="scirp.96856-ref35">35</xref>]. Active NF-κB (dimer p50/p60) translocates into the nucleus to transcribe the inflammatory factor genes [cyclooxygenase-2 (COX-2), intercellular adhesion molecule-1 (ICAM-1), and inducible nitric oxide synthase (iNOS)], proinflammatory cytokine genes [interleukin-6 (IL-6), interferon-γ (INF-γ), and tumor necrosis factor-α (TNF-α)], and the chemokine IL-8 gene [<xref ref-type="bibr" rid="scirp.96856-ref35">35</xref>]. This is called the NF-κB pathway. All of these related proteins can result in severe inflammation of the gastric mucosa for infected cells [<xref ref-type="bibr" rid="scirp.96856-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref35">35</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref36">36</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref37">37</xref>] (<xref ref-type="fig" rid="fig4">Figure 4</xref>).</p><p>The vacA gene represents another locus involved in the disease. Concerning the vacA gene polymorphisms in this study, variations of the vacA alleles (s1a, s1b, s1c, or s2), (m1 or m2), or (i1 or i2) also exist. This study noted that 81.9% of patients have the allelic combination s1m1 and all of those tested (100%) have the i1 allele. H. pylori strains with vacA alleles s1/m1/i1 are associated with an increased risk of developing severe disease, compared to positive s2/m2/i2 vacA strains [<xref ref-type="bibr" rid="scirp.96856-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref38">38</xref>]. In fact, among the possible allelic combinations, the vacAs1/m1 alleles are the most virulent combination, while the s1/m2 and s2/m2 genotypes display virtually no cytotoxicity [<xref ref-type="bibr" rid="scirp.96856-ref39">39</xref>].</p><p>Together, while each of the vacA polymorphisms has been used as a predictor for VacA-induced disease severity, it is clear that other factors, including the presence of CagA (discussed below), contribute to disease. For this reason, individually typing vacA alone may not provide sufficient information to understand the virulence potential of a strain and multiple virulence factor typing appears to be required to understand strain dependent disease contributions [<xref ref-type="bibr" rid="scirp.96856-ref39">39</xref>].</p><p>As shown in <xref ref-type="fig" rid="fig5">Figure 5</xref>, VacA oligomer p88 forms anionselective channels in the cytoplasmic membrane, which can further react with early and late endosomal compartments (EE/LE) to form anion-selective channels in the vacuole membrane. Such channels increase permeability to small organic molecules and cations Fe<sup>3+</sup>/Ni<sup>2+</sup> which can further interact with <inline-formula><inline-graphic xlink:href="/html.scirp.org/file/5-2260357x5.png" xlink:type="simple"/></inline-formula> from H. pylori generating an osmotic force for the driving water influx and vesicle swelling, finally leading to vacuolation [<xref ref-type="bibr" rid="scirp.96856-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref35">35</xref>]. On the other hand, the p88/EE/LE complex could be activated by Bax and Bak, resulting in mitochondrial transmembrane</p><p>potential (ΔΨm) disruption, followed by the release of cytochrome c from mitochondria to cytoplasm, activation of caspase-9 and caspase-3, and finally proceeding to apoptosis. However, apoptosis is inhibited by CagA [<xref ref-type="bibr" rid="scirp.96856-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref35">35</xref>].</p><p>In our study, there was nostatistically significant difference regarding the cagA gene or vacA alleles and age group, gastritis and another pathology in the study population. These results are on the contrary of those obtained in some studies. El Khadir noted a difference in the vacA and cagA combination of H. pylori in PUD and gastric cancer cases [<xref ref-type="bibr" rid="scirp.96856-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref40">40</xref>]. Lehours did not find a difference between gastritis and gastric MALT lymphoma patients regarding H. pylori</p><p>pathogenicity factors [<xref ref-type="bibr" rid="scirp.96856-ref20">20</xref>]. Our results can be explained by the fact that H. pylori is acquired early in childhood, as there is no statistically significant difference between the age groups and the strains exist in many parts of the population, even if the results of the endoscopy are normal [<xref ref-type="bibr" rid="scirp.96856-ref41">41</xref>].</p><p>The results of this study can explain the frequency of gastritis, PUD and gastric cancers in Brazzaville, Congo. Indeed, Ibara et al. reported 62.02% gastritis (first cause of gastric pathologies), 11.29% PUD and 3.60% gastric adenocarcinomas, despite the fact that a causal relationship with H. pylori has not been established [<xref ref-type="bibr" rid="scirp.96856-ref42">42</xref>]. H. pylori infection and gastric carcinogenesis processes in Congo must be fought using strategies based on the recommendation for H. pylori diagnosis and antimicrobial susceptibility testing in order to eradicate H. pylori and prevent gastritis, PUD and carcinoma.</p><p>Despite the evidence that cagA positivity, CagA and VacA seropositivity, and/or vacA polymorphism contribute to disease severity, numerous studies have not found this association [<xref ref-type="bibr" rid="scirp.96856-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref43">43</xref>].</p><p>For example, in Tunisia, the vacA type is significantly different between patients with peptic ulceration and gastritis, while CagA status is not [<xref ref-type="bibr" rid="scirp.96856-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.96856-ref44">44</xref>].</p><p>In China, no association between cagA status and peptic ulceration orchronic gastritis was established, due likely to the high presence of CagA in both patient populations. The differences observed between disease severity and toxin type/presence in these epidemiological studies may be due to differences that exist in H. pylori strains well beyond the described cagA and vacA polymorphisms. As noted at the outset of this review, environmental, geographic, and host influences could contribute to the differences observed in disease severity between these studies. As such, while individual evaluation of cagA and vacA genotypes show that both contribute to disease, the lack of evaluation of both genotypes in combination with other factors is problematic in determining how both toxins contribute to disease [<xref ref-type="bibr" rid="scirp.96856-ref26">26</xref>].</p></sec><sec id="s5"><title>5. Conclusion</title><p>The presence of genes associated with severe gastric diseases indicates the importance of H. pylori eradication in the prevention of these diseases in Congo.</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s7"><title>Cite this paper</title><p>Ontsira Ngoyi, E.N., Guilloteau, C., Benejat, L., Mongo Onkouo, A., Buissonni&#232;re, A., Sifre, E., Aloumba, A., Mieret, T., Bossali, F., Yala, F., Abena, A.A., Vadivelu, J., Goh, K.L., Ibara, J.R., AtipoIbara, B.I., Menard, A., Lehours, P. and Megraud, F. (2019) cagA and vacA Helicobacter pylori Pathogenicity Factors in Brazzaville, Congo. Open Journal of Medical Microbiology, 9, 186-200. https://doi.org/10.4236/ojmm.2019.94018</p></sec></body><back><ref-list><title>References</title><ref id="scirp.96856-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Taylor, D. and Parsonnet, J. (1995) Infections of the Gastrointestinal Tract. In: Infection of the Gastrointestinal Tract, Ravan Press, New York, 551-563.</mixed-citation></ref><ref id="scirp.96856-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization (1994) IARC Monographs on the Evaluation of Carcinogenic Risks to Humans. Vol. 61. World Health Organization, Geneva, 177-240.</mixed-citation></ref><ref id="scirp.96856-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Lind, J., Backert, S., Hoffmann, R., Eichler, J., Yamaoka, Y., Perez-Perez, G.I., Torres, J., Heinrich Sticht, H. and Tegtmeyer, N. (2016) Systematic Analysis of Phosphotyrosine Antibodies Recognizing Single Phosphorylated EPIYA-Motifs in CagA of East Asian-Type Helicobacter pylori Strains. BMC Microbiology, 16, 201. https://doi.org/10.1186/s12866-016-0820-6</mixed-citation></ref><ref id="scirp.96856-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Segal, E.D., Cha, J., Lo, J., Falkow, S. and Tompkins, L.S. (1999) Altered States: Involvement of Phosphorylated CagA in the Induction of Host Cellular Growth Changes by Helicobacter pylori. Proceedings of the National Academy of Sciences of the United States of America, 96, 14559-14564. https://doi.org/10.1073/pnas.96.25.14559</mixed-citation></ref><ref id="scirp.96856-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Backert, S., Feller, S.M. and Wessler, S. (2008) Emergingroles of Ablfamily Tyrosine Kinases in Microbial Pathogenesis. Trends in Biochemical Sciences, 33, 80-90. https://doi.org/10.1016/j.tibs.2007.10.006</mixed-citation></ref><ref id="scirp.96856-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Backert, S., Moese, S., Selbach, M., Brinkmann, V. and Meyer, T.F. (2001) Phosphorylation of Tyrosine 972 of the Helicobacter pylori CagA Protein Is Essential for Induction of a Scattering Phenotype in Gastric Epithelial Cells. Molecular Microbiology, 42, 631-644. https://doi.org/10.1046/j.1365-2958.2001.02649.x</mixed-citation></ref><ref id="scirp.96856-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Kim, S.S., Ruiz, V.E., Carroll, J.D. and Moss, S.F. (2011) Helicobacter pylori in the Pathogenesis of Gastric Cancer and Gastric Lymphoma. Cancer Letters, 305, 228-238. https://doi.org/10.1016/j.canlet.2010.07.014</mixed-citation></ref><ref id="scirp.96856-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Yamaoka, Y. (2010) Mechanisms of Disease: Helicobacter pylori Virulence Factors. Nature Reviews Gastroenterology &amp; Hepatology, 7, 629-641. https://doi.org/10.1038/nrgastro.2010.154</mixed-citation></ref><ref id="scirp.96856-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Higashi, H., Tsutsumi, R., Muto, S., Sugiyama, T., Azuma, T., Asaka, M. and Masanori Hatakeyama, M. (2002) SHP-2 Tyrosine Phosphatase as an Intracellular Target of Helicobacter pylori CagA Protein. Science, 295, 683-686. https://doi.org/10.1126/science.1067147</mixed-citation></ref><ref id="scirp.96856-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Bourzac, K.M. and Guillemin, K. (2005) Helicobacter pylori-Host Cell Interactions Mediated by Type IV Secretion. Cellular Microbiology, 7, 911-919. https://doi.org/10.1111/j.1462-5822.2005.00541.x</mixed-citation></ref><ref id="scirp.96856-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Backert, S. and Clyne, M. (2011) Pathogenesis of Helicobacter pylori Infection. Helicobacter, 1, 19-25. https://doi.org/10.1111/j.1523-5378.2011.00876.x</mixed-citation></ref><ref id="scirp.96856-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Amieva, M.R. and El-Omar, E.M. (2008) Host-Bacterial Interactions in Helicobacter pylori Infection. Gastroenterology, 134, 306-323. https://doi.org/10.1053/j.gastro.2007.11.009</mixed-citation></ref><ref id="scirp.96856-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Sewald, X., Fischer, W. and Haas, R. (2008) Helicobacter pylori VacA Takes Shape. Trends in Microbiology, 16, 89-92. https://doi.org/10.1016/j.tim.2008.01.001</mixed-citation></ref><ref id="scirp.96856-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Cover, T.L. and Blanke, S.R. (2005) Helicobacter pylori VacA, a Paradigm for Toxin Multifunctionality. Nature Reviews Microbiology, 3, 320-332. https://doi.org/10.1038/nrmicro1095</mixed-citation></ref><ref id="scirp.96856-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Palframan, S.L., Kwok, T. and Gabriel, K. (2012) Vacuolating Cytotoxin A (VacA), a Key Toxin for Helicobacter pylori Pathogenesis. Frontiers in Cellular and Infection Microbiology, 2, 92. https://doi.org/10.3389/fcimb.2012.00092</mixed-citation></ref><ref id="scirp.96856-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Kim, I.J. and Blanke, S.R. (2012) Remodeling the Host Environment: Modulation of the Gastric Epithelium by the Helicobacter pylori Vacuolating Toxin (VacA). Frontiers in Cellular and Infection Microbiology, 2, 37. https://doi.org/10.3389/fcimb.2012.00037</mixed-citation></ref><ref id="scirp.96856-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Oleastro, M., Menard, A., Santos, A., Lamouliatte, H., Monteiro, L., Barthelemy, P. and Mégraud, F. (2003) Real-Time PCR Assay for Rapid and Accurate Detection of Point Mutations Conferring Resistance to Clarithromycin in Helicobacter pylori. Journal of Clinical Microbiology, 41, 397-402. https://doi.org/10.1128/JCM.41.1.397-402.2003</mixed-citation></ref><ref id="scirp.96856-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Wittwer, C.T., Ririe, K.M., Andrew, R.V., David, D.A., Gundry, R.A. and Balis, U.J. (1997) The Light Cycler: A Microvolume Fluorimeters with Rapid Temperature Control. Biotechniques, 22, 176-181. https://doi.org/10.2144/97221pf02</mixed-citation></ref><ref id="scirp.96856-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Tummuru, M.K.R., Cover, T.L. and Blaser, M.J. (1993) Cloning and Expression of a High-Molecular-Mass Major Antigen of Helicobacter pylori: Evidence of Linkage to Cytotoxin Production. Infection and Immunity, 61, 1799-1809.</mixed-citation></ref><ref id="scirp.96856-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Lehours, P., Ménard, A., Dupouy, S., Bergey, B., Richy, F., Zerbib, F., Ruskoné-Fourmestraux, A., Delchier, J.C. and Mégraud, F. (2004) Evaluation of the Association of Nine Helicobacter pylori Virulence Factors with Strains Involved in Low-Grade Gastric Mucosa-Associated Lymphoid Tissue Lymphoma. Infection and Immunity, 72, 880-888. https://doi.org/10.1128/IAI.72.2.880-888.2004</mixed-citation></ref><ref id="scirp.96856-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Achtman, M., Azuma, T., Berg, D.E., Ito, Y., Morelli, G., Pan, Z.J., Suerbaum, S., Thompson, S.A., van der Ende, A. and van Doorn, L.J. (1999) Recombination and Clonal Groupings within Helicobacter pylori from Different Geographical Regions. Molecular Microbiology, 32, 459-470. https://doi.org/10.1046/j.1365-2958.1999.01382.x</mixed-citation></ref><ref id="scirp.96856-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Kersulyte, D., Chalkauskas, H. and Berg, D.E. (1999) Emergence of Recombinant Strains of Helicobacter pylori during Human Infection. Molecular Microbiology, 31, 31-43. https://doi.org/10.1046/j.1365-2958.1999.01140.x</mixed-citation></ref><ref id="scirp.96856-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Atherton, J.C., Peek, R.M., Tummuru, M.K., Blaser, M.J. and Cover, T.L. (1995) Mosaicism in Vacuolating Cytotoxin Alleles of Helicobacter pylori. Association of Specific vacA Types with Cytotoxin Production and Peptic Ulceration. Journal of Biological Chemistry, 270, 17771-17777. https://doi.org/10.1074/jbc.270.30.17771</mixed-citation></ref><ref id="scirp.96856-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Rhead, J.L., Letley, D.P., Mohammadi, M., Hussein, N., Mohagheghi, M.A. and EshaghHosseini, M. (2007) A New Helicobacter pylori Vacuolating Cytotoxin Determinant, the Intermediate Region, Is Associated with Gastric Cancer. Gastroenterology, 133, 926-936. https://doi.org/10.1053/j.gastro.2007.06.056</mixed-citation></ref><ref id="scirp.96856-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">AnkouaneAndoulo, F., Tagni-Sartre, M., Ndjitoyap Ndam, E.C. and Ngu Blackett, K. (2013) Epidemiology of Infection Helicobacter pylori in Yaoundé: Specificity of the African Enigma. The Pan African Medical Journal, 16, 115. https://doi.org/10.11604/pamj.2013.16.115.3007</mixed-citation></ref><ref id="scirp.96856-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Jones, K.R., Jeannette, M., Whitmire, J.M. and Merrell, D.S. (2010) A Tale of Two Toxins: Helicobacter pylori CagA and VacA Modulate Host Pathways That Impact Disease. Frontiers in Microbiology, 1, 1-17. https://doi.org/10.3389/fmicb.2010.00115</mixed-citation></ref><ref id="scirp.96856-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Hatakeyama, M. and Thatakeyama, B. (2006) Pathogenesis of Helicobacter pylori Infection. Helicobacter, 1, 14-20. https://doi.org/10.1111/j.1478-405X.2006.00424.x</mixed-citation></ref><ref id="scirp.96856-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Kidd, M., Louw, J.A. and Marks, I.N. (2001) Helicobacter pylori in Africa: Observations on an Enigma within an Enigma. Journal of Gastroenterology and Hepatology, 14, 851-858. https://doi.org/10.1046/j.1440-1746.1999.01975.x</mixed-citation></ref><ref id="scirp.96856-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Asahi, M., Azuma, T., Ito, S., Ito, Y., Suto, H., Nagai, Y., Tsubokawa, M., Tohyama, Y., Maeda, S., Omata, M., Suzuki, T. and Sasakawa, C. (2000) Helicobacter pylori CagA Protein Can Be Tyrosine Phosphorylated in Gastric Epithelial Cells. Journal of Experimental Medicine, 191, 593-602. https://doi.org/10.1084/jem.191.4.593</mixed-citation></ref><ref id="scirp.96856-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Tsutsumi, R., Higashi, H., Higuchi, M., Okada, M. and Hatakeyama, M. (2003) Attenuation of Helicobacter pylori CagA x SHP-2 Signaling by Interaction between CagA and C-Terminal Src Kinase. Journal of Biological Chemistry, 278, 3664-3670. https://doi.org/10.1074/jbc.M208155200</mixed-citation></ref><ref id="scirp.96856-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Ridley, A.J., Schwartz, M.A., Burridge, K., Firtel, R.A., Ginsberg, M.H. and Borisy (2003) Cell Migration: Integrating Signals from Front to Back. Science, 302, 1704-1709. https://doi.org/10.1126/science.1092053</mixed-citation></ref><ref id="scirp.96856-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Schneider, S., Weydig, C. and Wessler, S. (2008) Targeting Focal Adhesions: Helicobacter pylori-Host Communication in Cell Migration. Cell Communication and Signaling, 6, 2. https://doi.org/10.1186/1478-811X-6-2</mixed-citation></ref><ref id="scirp.96856-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Ohnishi, N., Yuasa, H., Tanaka, S., Sawa, H., Miura, M., Matsui, A., Higashi, H., Musashi, M., Iwabuchi, K., Suzuki, M., Yamada, G., Azuma, T. and Hatakeyama, M. (2008) Transgenic Expression of Helicobacter pylori CagA Induces Gastrointestinal and Hematopoietic Neoplasms in Mouse. Proceedings of the National Academy of Sciences of the United States of America, 105, 1003-1008. https://doi.org/10.1073/pnas.0711183105</mixed-citation></ref><ref id="scirp.96856-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Horvat, A. and Alexander, I.Z. (2017) How Does Bacterial Pathogen Helicobacter pylori Control Responses to Cellular Stress? Future Microbiology, 12, 105-108. https://doi.org/10.2217/fmb-2016-0220</mixed-citation></ref><ref id="scirp.96856-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Wang, Y.C. (2014) Medicinal Plant Activity on Helicobacter pylori Related Diseases. World Journal of Gastroenterology, 20, 10368-10382. https://doi.org/10.3748/wjg.v20.i30.10368</mixed-citation></ref><ref id="scirp.96856-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Brandt, S., Kwok, T., Hartig, R., K&amp;ouml;nig, W. and Backert, S. (2005) NF-κB Activation and Potentiation of Proinflammatory Responses by the Helicobacter pylori CagA Protein. Proceedings of the National Academy of Sciences of the United States of America, 102, 9300-9305. https://doi.org/10.1073/pnas.0409873102</mixed-citation></ref><ref id="scirp.96856-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Rieder, G., Fischer, W. and Haas, R. (2005) Interaction of Helicobacter pylori with Host Cells: Function of Secreted and Translocated Molecules. Current Opinion in Microbiology, 8, 67-73. https://doi.org/10.1016/j.mib.2004.12.004</mixed-citation></ref><ref id="scirp.96856-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Polk, D.B. and Peek, R.M.J. (2010) Helicobacter pylori: Gastric Cancer and Beyond. Nature Reviews Cancer, 10, 403-414. https://doi.org/10.1038/nrc2857</mixed-citation></ref><ref id="scirp.96856-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Bridge, R.D. and Scott, M.D. (2013) Polymorphism in the Helicobacter pylori CagA and VacA Toxins and Disease. Gut Microbes, 4, 101-117. https://doi.org/10.4161/gmic.23797</mixed-citation></ref><ref id="scirp.96856-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">El Khadir, M., Alaoui Boukhris, S., Benajah, D.A., Ibrahimi, S.A., Chbani, L., Bouguenouch, L., El Rhazi, K., El Abkari, M., Nejjari, C., Mahmoud, M. and Bennani, B. (2017) Helicobacter pylori CagA EPIYA-C Motifs and Gastric Diseases in Moroccan Patients. Infection, Genetics and Evolution, 66, 120-129. https://doi.org/10.1016/j.meegid.2018.09.015</mixed-citation></ref><ref id="scirp.96856-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">OntsiraNgoyi, E.N., AtipoIbara, B.I., Moyen, R., AhouiApendi, P.C., Ibara, J.R., Obengui, O., OssibiIbara, R.B., Nguimbi, E., Niama, R.F., Ouamba, J.M., Yala, F., Abena, A.A., Vadivelu, J., Goh, K.L., Menard, A., Benejat, L., Sifre, E., Lehours, P. and Megraud, F. (2015) Molecular Detection of Helicobacter pylori and Its Antimicrobial Resistance in Brazzaville, Congo. Helicobacter, 20, 316-320. https://doi.org/10.1111/hel.12204</mixed-citation></ref><ref id="scirp.96856-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Ibara, J.R., Mbou, V.A., Gatsele-Yala, C., Ngoma-Mambouana, P., Ngounga, B. and Yala, F. (2005) Infection à Helicobacter pylori chez l’enfant de 6 mois a 16 ans à Brazzaville (Congo). Gastroentérologie Clinique et Biologie, 29, 752-753. https://doi.org/10.1016/S0399-8320(05)82170-0</mixed-citation></ref><ref id="scirp.96856-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Suriani, R., Colozza, M., Cardesi, E., Mazzucco, D., Marino, M. and Grosso, S. (2008) CagA and VacA Helicobacter pylori Antibodies in Gastric Cancer. Canadian Journal of Gastroenterology, 22, 255-258. https://doi.org/10.1155/2008/521724</mixed-citation></ref><ref id="scirp.96856-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Ben Mansour, K., Fendri, C., Zribi, M., Masmoudi, A., Labbene, M. and Fillali, A. (2010) Prevalence of Helicobacter pylori vacA, cagA, iceA and oipA Genotypes in Tunisian Patients. Annals of Clinical Microbiology and Antimicrobial, 9, 10. https://doi.org/10.1186/1476-0711-9-10</mixed-citation></ref></ref-list></back></article>