<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2019.911058</article-id><article-id pub-id-type="publisher-id">AiM-96363</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Giving More Benefits to Biosurfactants Secreted by Lactic Acid Bacteria Isolated from Plantain Wine by Using Multiplex PCR Identification
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Michaelle</surname><given-names>Bokamba Moukala</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Christian</surname><given-names>Aimé Kayath</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Gabriel</surname><given-names>Ahombo</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Nicole</surname><given-names>Prisca Makaya Dangui</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Duchel</surname><given-names>Jeanedvi Kinouani Kinavouidi</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Effort</surname><given-names>Concentré Nguimbi Mouélé</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Martin</surname><given-names>Diatewa</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Ecole Normale Supérieure, Université Marien Ngouabi, Brazzaville, Congo</addr-line></aff><aff id="aff3"><addr-line>Institut National de Recherche en Sciences Exactes et Naturelles (IRSEN), Brazzaville, Congo</addr-line></aff><aff id="aff1"><addr-line>Laboratoire de Biologie Cellulaire et Moléculaire (BCM), Faculté des Sciences et Techniques, Université Marien Ngouabi, Brazzaville, Congo</addr-line></aff><pub-date pub-type="epub"><day>04</day><month>11</month><year>2019</year></pub-date><volume>09</volume><issue>11</issue><fpage>917</fpage><lpage>930</lpage><history><date date-type="received"><day>3,</day>	<month>October</month>	<year>2019</year></date><date date-type="rev-recd"><day>11,</day>	<month>November</month>	<year>2019</year>	</date><date date-type="accepted"><day>14,</day>	<month>November</month>	<year>2019</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Fermented beverages have continued to give more surprises in terms of the presence of biomolecules and the diversity of microorganisms that may be contained. Republic of Congo is home to a panoply of fermented foods and beverages that are still not yet studied. This is the case of plantain wine fluently called banana wine. Within this framework, this work aims to study the role of Biosurfactant-like Biomolecules secreted during fermentation of plantain wine. Using MRS medium, 15 isolates bacteria have been found. 100% are able to secrete biosurfactant and 66.66% are extractible biosurfactants. 33% of isolates have been associated to 
  Lactobacillus plantarum (Is2, Is9, Is12 and Is13) by using a one-step multi-plex PCR that targets genes encoding for bacteriocins. Biosurfactants secreted by 
  L. plantarum play an important role in the preservation of banana wine. The biosurfactants extracted with chloroform and ammonium sulphate are able to inhibit the growth of pathogenic bacteria including 
  Shigella flexneri, 
  Salmonella spp., 
  Pseudomonas aeruginosa and 
  Staphy-lococcus aureus.
 
</p></abstract><kwd-group><kwd>Plantain Wine</kwd><kwd> Fermented Beverage</kwd><kwd> &lt;i&gt;Lactobacillus spp.&lt;/i&gt;</kwd><kwd> Multiplexe PCR</kwd><kwd> Biosurfactants</kwd><kwd> Pathogenic Inhibition</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>In the Republic of the Congo, there is a wide variety of traditional fermented drinks, including sugar cane wine (“loungouila”), palm wine (“nsamba”), honey wine (“duma”). Other local wines basing on banana, orange, pineapple and grapefruit are not yet documented. The plantain wine commonly known as “banana wine” is known as “Mbamvu” in some Republic of Congo areas [<xref ref-type="bibr" rid="scirp.96363-ref1">1</xref>]. This fermented local beverage is produced according to traditional methods generally in areas where raw materials are grown. The rather crude fermentation technique consists in letting the juice extracted from the fruit turn to produce alcohol. Spontaneous fermentation is achieved by the presence of microorganisms from the plant material Physicochemical parameters are generally poorly controlled [<xref ref-type="bibr" rid="scirp.96363-ref1">1</xref>].</p><p>Also known as “Urwagwa” in Rwanda, banana wine is one of the oldest and most important beverages found in most East African countries. It is mainly consumed in three quarters of the Rwandan territory, where banana cultivation is a major agricultural activity [<xref ref-type="bibr" rid="scirp.96363-ref2">2</xref>].</p><p>Traditional practices show that Mbamvu is prepared from mature plantain slices suspended in water for one (1) to three (3) weeks. The microorganisms responsible for alcoholic fermentation are usually present on the surface of the raw materials that serve as their substrate [<xref ref-type="bibr" rid="scirp.96363-ref3">3</xref>]. In addition, the hygienic quality is based on the transformation conditions and the material used [<xref ref-type="bibr" rid="scirp.96363-ref4">4</xref>].</p><p>The choice of the fruit is justified by the fact that the plantain is the most consumed fresh fruit in the world [<xref ref-type="bibr" rid="scirp.96363-ref5">5</xref>] but beverage produced from plantains is little known.</p><p>So far, the techniques of making our local beverages such as nsamba “loungouila”, orange wine and “Mbamvu” are poorly controlled and pose many difficulties from the hygienic point of view, in terms of preservation, rate of fermentation, alcohol, taste variation, which can lead to different health problems.</p><p>Some fermented foods and beverages have been studied in Republic of Congo and molecular identification of lactic acid bacteria, Bacillus spp., Sacharomyces spp. have been done as well [<xref ref-type="bibr" rid="scirp.96363-ref6">6</xref>] - [<xref ref-type="bibr" rid="scirp.96363-ref11">11</xref>]. Multiplex PCR techniques have been used to identify lactic acid bacteria [<xref ref-type="bibr" rid="scirp.96363-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref13">13</xref>]. The concept “multiplex PCR” refers to a development of the PCR technique allowing the amplification, in a single reaction, of several distinct DNA segments. The pairs of primers corresponding to the different loci to be analyzed are introduced into the same reaction tube [<xref ref-type="bibr" rid="scirp.96363-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref13">13</xref>]. PCR multiplexe amplicon using 16S RNA and 23S RNA genes were estimated on Lactobacillus mali, Pediococcus pentosaceus, Leuconostoc mesenteroides and Oenococcus oeni [<xref ref-type="bibr" rid="scirp.96363-ref14">14</xref>]. Virulence genes including fsr, efm, esp, cylA, cad1, ace, gelE, and asa1 have been used to identify Enterococcus spp. in multiplex technique [<xref ref-type="bibr" rid="scirp.96363-ref15">15</xref>]. Several lactic acid bacteria have been shown to be secreted biosurfactants which are amphiphilic compounds produced by either on the cell surface or secreted extracellularly [<xref ref-type="bibr" rid="scirp.96363-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref18">18</xref>]. Biosurfactant plays an important role in antimicrobial activities [<xref ref-type="bibr" rid="scirp.96363-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref19">19</xref>].</p><p>To our knowledge, few studies from the microbiological and biomolecular point of view have been carried out to be secreted directly biosurfactant in banana wine during fermentation. In the context of this work, this beverage seems to be interesting for the identification of biomolecules secreted during fermentation. To this end, in order to valorize that banana wine, some questions could be issued: What diversity of microorganisms can we encounter in banana wine? What are the secreted biomolecules in plantain wine? What is the role in preservation?</p></sec><sec id="s2"><title>2. Methods</title><sec id="s2_1"><title>2.1. Manufacture of Plantain Wine and Isolation of Bacteria</title><p>The biological material used in this work is the plantain wine (Mbamvu) made in the laboratory by improving the traditional process. Dilutions were done, and bacterial suspension was streaked on PCA, MRS, LB, Chapman, SS Mossel, and TSN media as described by the manufacturers. Petri dishes were incubated at 37˚C for 24 h to 48 h. After the first isolation on Petri dishes, different colonies were obtained. Each colony from MRS of different appearance was separately isolated. Purification of the isolates was rigorously done by successive and alternating subcultures. Purity was estimated by using a microscope for morphological characterization. Gram status was determined by using 3% KOH.</p></sec><sec id="s2_2"><title>2.2. Evaluation of Emulsion Index (E24/E48)</title><p>The emulsion index (E24 or E48) was calculated as an indicator for biosurfactants production. The medium was adjusted to pH 7.2 and supplemented with gasoline or diesel fuel (1 mL for 300 mL of medium). This experiment was done in triplicate. The E24 or E48 was investigated by adding crude oil with LB medium in 1:1 ratio (v/v). The solution was vortexed for 5 min and incubated for 24 h. The emulsion rate was calculated through the height of the emulsion layer. In addition, E24 was determined for gasoline and diesel fuel hydrocarbons. All the experiments were performed in triplicates, E24 or E48 = height of emulsion layer/total height of solution &#215; 100.</p></sec><sec id="s2_3"><title>2.3. Extraction of the Emulsifying Activity by Chloroform and Ammonium Sulfate</title><p>One volume of supernatant was added with an equal volume of chloroform (v/v). The mixture is strongly agitated by a vortex. After centrifugation at 6000 rpm for 10 min, the non-aqueous phase is recovered. The solvent was allowed to evaporate completely only without heating above 40˚C. The residue is dissolved in a PBS buffer. In terms of ammonium sulfate an overnight culture has been fuged at 13,000 rpm for 15 minutes to separate supernatant and pellet. Then 15 mL of supernatant were mixed with ammonium sulfate (80%) for 15 minutes. And finally this has been incubated in overnight. Mix has been fuged at 6000 rpm for 30 minutes. Pelet has been hommogenized by using PBS buffer. For both extractions (chloroform and ammonium sulfate) the emulsifying activity is tested in comparison with the supernatant at the start.</p></sec><sec id="s2_4"><title>2.4. Inhibition Tests from Biosurfactant Extracts</title><p>The LB medium was prepared and poured on Petri dishes. After solidification of the medium, a volume of 0.1 ml of the bacterial suspension is seeded throughout the entire box. After drying, 20 μL of biosurfactant extract were deposited in three (3) different locations on a box. The dishes were incubated at 37˚C for 24 h and the diameters of the inhibition halos were measured.</p></sec><sec id="s2_5"><title>2.5. Multiplex for Lactic Acid Bacteria Identification</title><p>In order to directly identify the isolates by using DNA technology, nine genes including curA, sakP, sakQ, plnA, plnEF, entA, entB, entP and pedA encoding for bactericins like molecules have been used. These have been selected in previous work [<xref ref-type="bibr" rid="scirp.96363-ref20">20</xref>] and this was checked in the NCBI (National Center for Biotechnology Information, https://blast.ncbi.nlm.nih.gov/Blast.cgi) genomic database of targeted strains. Microbesonline (http://www.microbesonline.org) have been also used for more checking list. Five lactic acid bacteria including Lactobacillus curvatus, L. sakei, L. plantarum, Enterococcus faecium, Pediococcus acidilactici have been discriminated. The pDRAW32 software has been used for bioinformatic analysis. The primers were rigorously designed and selected (<xref ref-type="table" rid="table1">Table 1</xref>).</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used in this work [<xref ref-type="bibr" rid="scirp.96363-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref25">25</xref>]</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Multiplex groups</th><th align="center" valign="middle" >Targeted genes</th><th align="center" valign="middle" >Primers (5’-3’)</th><th align="center" valign="middle" >Size (pb)</th><th align="center" valign="middle" >Targeted species</th></tr></thead><tr><td align="center" valign="middle"  rowspan="10"  >Group 1</td><td align="center" valign="middle" >curA-F</td><td align="center" valign="middle" >GTAAAAGAATTAAGTATGACA</td><td align="center" valign="middle"  rowspan="2"  >180</td><td align="center" valign="middle"  rowspan="2"  >L. curvatus</td></tr><tr><td align="center" valign="middle" >curA-R</td><td align="center" valign="middle" >TTACATTCCAGCTAAACCACT</td></tr><tr><td align="center" valign="middle" >sakP-F</td><td align="center" valign="middle" >ATGGAAAAGTTTATTGAATTA</td><td align="center" valign="middle"  rowspan="2"  >200</td><td align="center" valign="middle"  rowspan="2"  >L. sakei</td></tr><tr><td align="center" valign="middle" >sakP-R</td><td align="center" valign="middle" >TTATTTATTCCAGCCAGCGTTTC</td></tr><tr><td align="center" valign="middle" >entB-F</td><td align="center" valign="middle" >GAAAATGATCACAGAATGCCTA</td><td align="center" valign="middle"  rowspan="2"  >162</td><td align="center" valign="middle"  rowspan="2"  >Enterococcus faecium</td></tr><tr><td align="center" valign="middle" >entB-R</td><td align="center" valign="middle" >GTTGCATTTAGAGTATACATTTG</td></tr><tr><td align="center" valign="middle" >entA-F</td><td align="center" valign="middle" >AAATATTATGGAAATGGAGTGTAT</td><td align="center" valign="middle"  rowspan="2"  >126</td><td align="center" valign="middle"  rowspan="2"  >E. faecium</td></tr><tr><td align="center" valign="middle" >entA-R</td><td align="center" valign="middle" >GCACTTCCCTGGAATTGCTC</td></tr><tr><td align="center" valign="middle" >plnEF-F</td><td align="center" valign="middle" >GGCATAGTTAAAATTCCCCCC</td><td align="center" valign="middle"  rowspan="2"  >428</td><td align="center" valign="middle"  rowspan="2"  >L. plantarum</td></tr><tr><td align="center" valign="middle" >plnEF-R</td><td align="center" valign="middle" >CAGGTTGCCGCAAAAAAAG</td></tr><tr><td align="center" valign="middle"  rowspan="10"  >Group 2</td><td align="center" valign="middle" >entA-F</td><td align="center" valign="middle" >AAATATTATGGAAATGGAGTGTAT</td><td align="center" valign="middle"  rowspan="2"  >126</td><td align="center" valign="middle"  rowspan="2"  >E. faecium</td></tr><tr><td align="center" valign="middle" >entA-R</td><td align="center" valign="middle" >GCACTTCCCTGGAATTGCTC</td></tr><tr><td align="center" valign="middle" >entP-F</td><td align="center" valign="middle" >TATGGTAATGGTGTTTATTGTAAT</td><td align="center" valign="middle"  rowspan="2"  >112</td><td align="center" valign="middle"  rowspan="2"  >E. faecium</td></tr><tr><td align="center" valign="middle" >entP-R</td><td align="center" valign="middle" >ATGTCCCATACCTGCCAAAC</td></tr><tr><td align="center" valign="middle" >pedA-F</td><td align="center" valign="middle" >AAAATATCTAACTAATACTTG</td><td align="center" valign="middle"  rowspan="2"  >600</td><td align="center" valign="middle"  rowspan="2"  >Pediococcus acidilactici</td></tr><tr><td align="center" valign="middle" >pedA-R</td><td align="center" valign="middle" >TAAAAAGATATTTGACCAAAA</td></tr><tr><td align="center" valign="middle" >sakQ-F</td><td align="center" valign="middle" >ATGCAAAATACAAAAGAACTAA</td><td align="center" valign="middle"  rowspan="2"  >200</td><td align="center" valign="middle"  rowspan="2"  >L. sakei</td></tr><tr><td align="center" valign="middle" >sakQ-R</td><td align="center" valign="middle" >CGCTTGTTTAGAGACACCCGTT</td></tr><tr><td align="center" valign="middle" >plnA-F</td><td align="center" valign="middle" >GTACAGTACTAATGGGAG</td><td align="center" valign="middle"  rowspan="2"  >450</td><td align="center" valign="middle"  rowspan="2"  >L. plantarum</td></tr><tr><td align="center" valign="middle" >plnA-R</td><td align="center" valign="middle" >CTTACGCCAATCTATACG</td></tr></tbody></table></table-wrap><p>Extraction and purification of isolate genomic DNA were performed according to the NucleoSpin Microbial DNA (Macherey-NAGEL) kit. Briefly, isolates were grown in 5 mL LB broth for 24 h at 37˚C with stirring. The DNA purity was assessed by electrophoresis on agarose gel and by the ratio of optical densities 260/280nm. By using universal primers of 16S rRNA fD1 (5’-AGAGTTTGATCCTGGCTCAG-3’) and rP2 (5’-ACGGCTACCTTGTTACGACTT-3’), bacterial confirmation has been done oriented.</p><p>Two groups of multiplex have been done (<xref ref-type="table" rid="table1">Table 1</xref>). 5 μL of each amplification product was mixed with 2 μL of loading buffer (BIOKE). Mixtures were subjected to electrophoresis on 1% agarose gel (w/v).</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Secretion of Biomolecules in Plantain Wine and the Role of Biosurfactants</title><sec id="s3_1_1"><title>3.1.1. Production of Biosurfactants</title><p>In order to carry out our research, we first sought to know if the biosurfactants are directly secreted in the plantain wine. The results of <xref ref-type="fig" rid="fig1">Figure 1</xref> show emulsification percentages ranging between 15% to 30% of plantain wine emulsification index of randomly choosen samples after five (5) days fermentation (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><p>The presence of biosurfactants secreted directly in the plantain wine led us to keep working by isolating and characterizing Lactic acid bacteria that can be able to do so. The isolation on MRS medium has been used to highlight the presence of bacteria of the genus Lactobacillus. Thus, 15 isolates were obtained, screened and purified from banana wine. These isolates have been the subject of various microbiological issues, biochemistry and molecular biology.</p><p>The purified isolates were macroscopically and microscopically characterized (data not shown). Fifteen (15) isolates were characterized. Among 15 isolates, 11 isolates are round, 4 oval. All isolates retained are Gram-positive bacteria. 13 isolates are sticks against 2 cocci. Of the 100% isolates, 20% are mobile and 80% are not. Only 7% of the isolates are catalase positive, 93% are catalase negative. 67% have a dry texture against 20% glutinous and 13% pasty. The fifteen isolates were used for various tests and molecular identification.</p><p>To highlight the production of biosurfactant, we performed the emulsification test from isolates. This study shows that isolates produced biosurfactants with an emulsification index (E24) ranged from 20% to 73% after 24 hours and from 20% to 90% corresponding to the emulsification index (E48) after 48 h (<xref ref-type="fig" rid="fig2">Figure 2</xref>). The emulsification index is concomitant to the bacterial growth.</p><p>Biosurfactants are extratables</p><p>We also investigated if biosurfactants were extractable after centrifugation of isolates cultures. Within acellular supernatant, 66% of isolates were biosurfactant extractable and these have E24 100% of ability to emulsify gasoline or diesel. This is included Is1, Is2, Is3, Is4, Is6, Is7, Is9, Is10, Is12 and Is15. Is5, Is8, Is11, Is12 and Is13 can produce biosurfactants in supernatant but these cannot be extracted using either chloroform or ammonium sulfate (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p></sec><sec id="s3_1_2"><title>3.1.2. Inhibition of Pathogenic Bacteria by Biosurfactant Extracts</title><p>By using SS, Chapman, EMB, Cetrimide, TSN and Mossel no targeted pathgenic Bacteria can be isolated from 50 mL of plantain wine including Shigella flexneri, Salmonella spp., Pseudomonas aeruginosa, Staphyloccoccus aureus, Clostridium spp and Bacillus cereus. To assess the absence of these bacteria, inhibition of pathogenic bacteria by using biosurfactant extracts from Is1, Is2, Is3, Is4, Is6, Is7, Is9, Is10, Is12 and Is15, have been done.</p><p>The biosurfactants extracts from the 10 isolates made it possible to carry out the inhibition tests on the pathogenic strains mentioned above. <xref ref-type="fig" rid="fig4">Figure 4</xref> shows</p><p>some exemples of the behavior of biosurfactant extracts (BioIs5, BioIs7, BioIs9 and BioIs12) against pathogenic bacteria.</p><p>In addition diameters of inhibition of all isolates have been measured. We find that BioIs3, Biosurfactant corresponding to isolate 3 (Is3), had developed a larger inhibition diameter on all selected strains, i.e. 3.3 cm &#177; 0.2 for E. coli, 4.2 cm &#177; 0.2 for S. flexneri, 3.3 cm &#177; 0.4 for Salmonella sp., 3.5 cm &#177; 0.4 for P. aeruginosa and 4.0 cm &#177; 0.2 for S. aureus. It should be noted that BioIs1 strongly inhibits the growth of E. coli. The diameters of inhibitions obtained made it possible to mount the graph below (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p></sec></sec><sec id="s3_2"><title>3.2. One Step PCR Multiplex Identification among Lactoctocillus enterrococcus and Pediococcus Strains</title><p>The purified isolates were the subject of genomic DNA extraction. Amplification using the 16S rRNA gene was performed on the genomic DNAs of the isolates in order to confirm the bacteria orientation. Nine (9) pairs of primers, targeting genes encoding for bacteriocins, have amplified and discriminated three (3) genera of lactic acid bacteria including Lactobacillus, Enterococcus and Pediococcus.</p><p>Direct identification have been done by targeting the 9 genes such as the sakP and sakQ genes corresponding to Lactobacillus sakei, plnA/plnEF to Lactobacillus plantarum, curA to Lactobacillus curvatus, entA/entB/entP to Enterococcus faecalis,</p><p>pedA to Pediococcus acidilactici. 18 PCR of two multiplex groups have been done and 135 single PCRs were performed with nine (9) primers pairs encoding bacteriocin genes. As results, amplifications allow to identify predominantly 33% of Lactic acid bacteria including Is2, Is9, Is12 and Is13 isolates as L. plantarum. Using the same multiplexe group L. sakei, L. curvatus, E. faecalis and P. acidilactici could not be identified (<xref ref-type="table" rid="table2">Table 2</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>In this work the main goal was to appreciate banana wine by its richness Biomolecules secreted during fermentation. Banana has been shown to widely contain bioactive molecules like polyphenol, flavonoids and carotenoids playing important roles in the well-being of humans [<xref ref-type="bibr" rid="scirp.96363-ref5">5</xref>]. The role of bacteriocins and biosurfactants should be considered again. Indeed, in many departments of the Republic of Congo, Congolese are consumers of fermented beverages and sometimes seek for new tastes, novel sensations and good protective beverage. Some molecule contained in banana including vitamin B, protein, amino acids and calories are also important. Plantain is mainly characterized by its sugar content and its density, a factor that conditions subsequent fermentation and ethanol production [<xref ref-type="bibr" rid="scirp.96363-ref5">5</xref>].</p><p>We have clearly shown that biosurfactants are highly secreted during fermentation in the extracellular medium. 15 isolates were found as part of this job. They are all capable of producing biosurfactants. 66.66% produce extractible biosurfactants. Until the writing of this paper, no study on fermented foods and</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Identification of microorganisms by amplification of the genes that encode bacteriocins. Is 2, 9, 12, 13: Isolates 2, 9, 12, 13. NI: unidentified</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Multiplex groups</th><th align="center" valign="middle" >Targeted genes</th><th align="center" valign="middle" >Size (pb)</th><th align="center" valign="middle" >Targeted species</th><th align="center" valign="middle" >Isolates identified</th></tr></thead><tr><td align="center" valign="middle"  rowspan="10"  >Group 1</td><td align="center" valign="middle" >curA-F</td><td align="center" valign="middle"  rowspan="2"  >180</td><td align="center" valign="middle"  rowspan="2"  >Lactobacillus curvatus</td><td align="center" valign="middle"  rowspan="2"  >NI</td></tr><tr><td align="center" valign="middle" >curA-R</td></tr><tr><td align="center" valign="middle" >sakP-F</td><td align="center" valign="middle"  rowspan="2"  >200</td><td align="center" valign="middle"  rowspan="2"  >Lactobacillus sakei</td><td align="center" valign="middle"  rowspan="2"  >NI</td></tr><tr><td align="center" valign="middle" >sakP-R</td></tr><tr><td align="center" valign="middle" >entB-F</td><td align="center" valign="middle"  rowspan="2"  >162</td><td align="center" valign="middle"  rowspan="2"  >Enterococcus faecium</td><td align="center" valign="middle"  rowspan="2"  >NI</td></tr><tr><td align="center" valign="middle" >entB-R</td></tr><tr><td align="center" valign="middle" >entA-F</td><td align="center" valign="middle"  rowspan="2"  >126</td><td align="center" valign="middle"  rowspan="2"  >Enterococcus faecium</td><td align="center" valign="middle"  rowspan="2"  >NI</td></tr><tr><td align="center" valign="middle" >entA-R</td></tr><tr><td align="center" valign="middle" >plnEF-F</td><td align="center" valign="middle"  rowspan="2"  >428</td><td align="center" valign="middle"  rowspan="2"  >Lactobacillus plantarum</td><td align="center" valign="middle"  rowspan="2"  >Is2, Is9, Is12 and Is13</td></tr><tr><td align="center" valign="middle" >plnEF-R</td></tr><tr><td align="center" valign="middle"  rowspan="10"  >Group 2</td><td align="center" valign="middle" >entA-F</td><td align="center" valign="middle"  rowspan="2"  >126</td><td align="center" valign="middle"  rowspan="2"  >Enterococcus faecium</td><td align="center" valign="middle"  rowspan="2"  >NI</td></tr><tr><td align="center" valign="middle" >entA-R</td></tr><tr><td align="center" valign="middle" >entP-F</td><td align="center" valign="middle"  rowspan="2"  >112</td><td align="center" valign="middle"  rowspan="2"  >Enterococcus Faecium</td><td align="center" valign="middle"  rowspan="2"  >NI</td></tr><tr><td align="center" valign="middle" >entP-R</td></tr><tr><td align="center" valign="middle" >pedA-F</td><td align="center" valign="middle"  rowspan="2"  >600</td><td align="center" valign="middle"  rowspan="2"  >Pediococcus acidilactici</td><td align="center" valign="middle"  rowspan="2"  >NI</td></tr><tr><td align="center" valign="middle" >pedA-R</td></tr><tr><td align="center" valign="middle" >sakQ-F</td><td align="center" valign="middle"  rowspan="2"  >200</td><td align="center" valign="middle"  rowspan="2"  >Lactobacillus sakei</td><td align="center" valign="middle"  rowspan="2"  >NI</td></tr><tr><td align="center" valign="middle" >sakQ-R</td></tr><tr><td align="center" valign="middle" >plnA-F</td><td align="center" valign="middle"  rowspan="2"  >450</td><td align="center" valign="middle"  rowspan="2"  >Lactobacillus plantarum</td><td align="center" valign="middle"  rowspan="2"  >Is2, Is9, Is12 and Is13</td></tr><tr><td align="center" valign="middle" >plnA-R</td></tr></tbody></table></table-wrap><p>drinks has shown the secretion of biosurfactants directly in the ferment. The biosurfactants extracted with chloroform and ammonium sulphate are able to inhibit the growth of pathogenic bacteria including E. coli, S. flexneri M90T, Salmonella spp, P. aeruginosa and S. aureus.</p><p>The tendency of lactic acid bactreria is to acidify the medium [<xref ref-type="bibr" rid="scirp.96363-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref26">26</xref>]. The capacity of microorganisms to secrete and biosurfactants in the extracellular medium could explain the absence of the pathogenic bacteria of the genus Shigella, Salmonella, Staphylococcus and although Shigella is able to live 2 hours inside of the stomach and cause bacillary dissentery [<xref ref-type="bibr" rid="scirp.96363-ref27">27</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref28">28</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref29">29</xref>]. Since the fermentation of the plantain wine lasts 96 hours, and the pH goes down very quickly, it is almost difficult for Shigella spp. and Salmonella spp. to resist in this condition. Lactobacillus spp. are also able to secrete other biomolecules such as bacteriocins [<xref ref-type="bibr" rid="scirp.96363-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref30">30</xref>] which can also inhibit the growth of the bacterial pathogens mentioned above [<xref ref-type="bibr" rid="scirp.96363-ref31">31</xref>]. Biosurfactants have already been proposed as a preservative in the food industry [<xref ref-type="bibr" rid="scirp.96363-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref32">32</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref33">33</xref>]. The evaluation and the functional characterization of a biosurfactant produced by L. plantarum CFR 2194 have been done. Fourier transform infrared spectroscopy (FTIR) spectra demonstrated that biosurfactants were constituted by protein and polysaccharide fractions by possessing a glycoprotein like structure [<xref ref-type="bibr" rid="scirp.96363-ref34">34</xref>]. We can postulate that our Biosurfactant could be a glycoprotein because this can be easily extracted from supernatent by using ammonium sulfate ((NH<sub>4</sub>)<sub>2</sub>SO<sub>4</sub>) favourizing by the salting out mecanisms [<xref ref-type="bibr" rid="scirp.96363-ref35">35</xref>]. The probiotic effect and ability of bacteria of the Lactobacillus spp. to inhibit the growth of pathogenic bacteria has already been demonstrated [<xref ref-type="bibr" rid="scirp.96363-ref31">31</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref36">36</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref37">37</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref38">38</xref>]. Many studies have focused on the inhibition of pathogens by targeting bacteriocins. A previous study on banana wine in Rwanda also showed the absence of these pathogenic bacteria [<xref ref-type="bibr" rid="scirp.96363-ref39">39</xref>].</p><p>By using specific culture media we have shown that the bacteria like Shigella flexneri, Salmonella spp., E. coli, Pseudomonas aeruginosa, Staphylococcus, Clostridium spp. are totally absent on the tested samples. MRS allow us to isolate 15 isolates from plantain wine. One step PCR multiplex have been used to identify isolates among five lactic acid bacteria species including Enterococcus faecium, Pediococcus acidilactici, Lactobacillus sakei, Lactobacillus plantarum, Lactobacillus curvatus.</p><p>The most representative being L. plantarum (33%) associated to Is2, Is9, Is12 and Is13. It should be interesting notified that no study has been focused on genes encoding for bacteriocins to discriminate bacilli and cocci from lactic acid bacteria in a one step multiplex-PCR. By the way several methods of screening, purification and antimicrobial potentialities of bacteriocin in Health Care for human being have been mentioned [<xref ref-type="bibr" rid="scirp.96363-ref40">40</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref41">41</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref42">42</xref>]. The development and validation of a one step Multiplex-PCR assay for the detection of ten Lactobacillus species, has been recently documented [<xref ref-type="bibr" rid="scirp.96363-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref43">43</xref>]. In addition random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis was used to identify strains of L. plantarum [<xref ref-type="bibr" rid="scirp.96363-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref44">44</xref>] [<xref ref-type="bibr" rid="scirp.96363-ref45">45</xref>].</p></sec><sec id="s5"><title>5. Conclusion</title><p>This work allowed showing that biosurfactant can be secreted directly in the extracellular medium. Lactobacillus isolated from plantain wine is a part of this job. A novel one step multiplex PCR that targets genes encoding for bacterioscins allowed to identify L. plantarum (Is2, Is9, Is12 and Is13) that are able to secrete biosurfactants playing an important role in the preservation of banana wine. The biosurfactant extracts with chloroform and ammonium sulphate are able to inhibit the growth of pathogenic bacteria such as Shigella flexneri, Salmonella spp., Pseudomonas aeruginosa and Staphilococcusn aureus. This work also constitutes a scientific support, a reference tool and a source of information that may be of interest to future scientists and researchers who would like to deepen the analysis. The processes and methods we used, could serve as a basis and example for the manufacture of all other local wines under better conditions and standards for the health of the population. The control of local beverages production could be the very important input of nutritious beverages for the benefit of the people because contains very important bioactive compounds including polyphenol and flavono&#239;ds and carotenoids.</p></sec><sec id="s6"><title>Acknowledgements</title><p>We are grateful Prof. Clobite Bouka Biona (Universit&#233; Marien Ngouabi), and Dr. Bienvenu Dinga (Universit&#233; Marien Ngouabi) for their continuous encouragements and material support. This work was supported in part by Institut National de Recherche en Sciences Exactes et Naturelles (IRSEN).</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare that the research was conducted in the absence of any intellectual commercial or financial relationships that could be construed as potential conflicts of interest.</p></sec><sec id="s8"><title>Cite this paper</title><p>Moukala, M.B., Kayath, C.A., Ahombo, G., Dangui, N.P.M., Kinavouidi, D.J.K., Mou&#233;l&#233;, E.C.N. and Diatewa, M. (2019) Giving More Benefits to Biosurfactants Secreted by Lactic Acid Bacteria Isolated from Plantain Wine by Using Multiplex PCR Identification. Advances in Microbiology, 9, 917-930. https://doi.org/10.4236/aim.2019.911058</p></sec></body><back><ref-list><title>References</title><ref id="scirp.96363-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Kayath, C.A., Nguimbi, E., Goma-Tchimbakala, J., Mamonékéné, V., Lebonguy, A.A. and Ahombo, G. (2016) Towards the Understanding of Fermented Food Biotechnology in Congo Brazzaville Advance. Journal of Food Science and Technology, 12, 593-602. https://doi.org/10.19026/ajfst.12.3317</mixed-citation></ref><ref id="scirp.96363-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Kanyana, I., Ouma, E. and Piet Van, A. (2013) Quality Assessment of Banana Juice and Beer in Rwanda. Journal of Food Technology, 11, 38-43.</mixed-citation></ref><ref id="scirp.96363-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Juturu, V. and Wu, J.C. (2016) Microbial Production of Lactic Acid: The Latest Development. Critical Reviews in Biotechnology, 36, 967-77.https://doi.org/10.3109/07388551.2015.1066305</mixed-citation></ref><ref id="scirp.96363-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Abriouel, H., Ben Omar, N., Lucas Lopez, R., Martinez Canamero, M., Ortega, E. and Galvez, A. (2007) Differentiation and Characterization by Molecular Techniques of Bacillus Cereus Group Isolates from Poto Poto and Degue, Two Traditional Cereal-Based Fermented Foods of Burkina Faso and Republic of Congo. Journal of Food Protection, 70, 1165-1173. https://doi.org/10.4315/0362-028X-70.5.1165</mixed-citation></ref><ref id="scirp.96363-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Singh, B., Singh, J.P., Kaur, A. and Singh, N. (2016) Bioactive Compounds in Banana and Their Associated Health Benefits—A Review. Food Chemistry, 206, 1-11.https://doi.org/10.1016/j.foodchem.2016.03.033</mixed-citation></ref><ref id="scirp.96363-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Kaya-Ongoto, M.D., Kayath, C.A., Nguimbi, E., Lebonguy, A.A., Nzaou, S.A.E., Elenga Wilson, P.S., et al. (2019) Genetic Clearness Novel Strategy of Group I Bacillus Species Isolated from Fermented Food and Beverages by Using Fibrinolytic Enzyme Gene Encoding a Serine-Like Enzyme. Journal of Nucleic Acids, 2019, Article ID: 5484896. https://doi.org/10.1155/2019/5484896</mixed-citation></ref><ref id="scirp.96363-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Ouoba, L., Vouidibio Mbozo, A.B., Thorsen, L., Anyogu, A., Nielsen, D.S., Kobawila, S.C., et al. (2015) Lysinibacillus louembei sp. nov., a Spore-Forming Bacterium Isolated from Ntoba Mbodi, Alkaline Fermented Leaves of Cassava from the Republic of the Congo. International Journal of Systematic and Evolutionary Microbiology, 65, 4256-4262. https://doi.org/10.1099/ijsem.0.000570</mixed-citation></ref><ref id="scirp.96363-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Ouoba, L.I., Nyanga-Koumou, C.A., Parkouda, C., Sawadogo, H., Kobawila, S.C., Keleke, S., et al. (2010) Genotypic Diversity of Lactic Acid Bacteria Isolated from African Traditional Alkaline-Fermented Foods. Journal of Applied Microbiology, 108, 2019-2029. https://doi.org/10.1111/j.1365-2672.2009.04603.x</mixed-citation></ref><ref id="scirp.96363-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Vouidibio Mbozo, A.B., Kobawila, S.C., Anyogu, A., Awamaria, B., Louembe, D., Sutherland, J.P., et al. (2017) Investigation of the Diversity and Safety of the Predominant Bacillus Pumilus Sensu Lato and other Bacillus Species Involved in the Alkaline Fermentation of Cassava Leaves for the Production of Ntoba Mbodi. Food Control, 82, 154-162. https://doi.org/10.1016/j.foodcont.2017.06.018</mixed-citation></ref><ref id="scirp.96363-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Miambi, E., Guyot, J.P. and Ampe, F. (2003) Identification, Isolation and Quantification of Representative Bacteria from Fermented Cassava Dough Using an Integrated Approach of Culture-Dependent and Culture-Independent Methods. International Journal of Food Microbiology, 82, 111-120. https://doi.org/10.1016/S0168-1605(02)00256-8</mixed-citation></ref><ref id="scirp.96363-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Abriouel, H., Ben Omar, N., López, R.L., Martínez-Canamero, M., Keleke, S. and Gálvez, A. (2006) Culture-Independent Analysis of the Microbial Composition of the African Traditional Fermented Foods Poto Poto and dégué by Using Three Different DNA Extraction Methods. International Journal of Food Microbiology, 111, 228-233. https://doi.org/10.1016/j.ijfoodmicro.2006.06.006</mixed-citation></ref><ref id="scirp.96363-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Gaspar, C., Palmeira-de-Oliveira, R., Martinez-de-Oliveira, J., Neves, J.D., Pestana, P.G., Rolo, J., et al. (2019) Development and Validation of a New One Step Multiplex-PCR Assay for the Detection of ten Lactobacillus Species. Anaerobe, 59, 192-200. https://doi.org/10.1016/j.anaerobe.2019.06.004</mixed-citation></ref><ref id="scirp.96363-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Galanis, A., Kourkoutas, Y., Tassou, C.C. and Chorianopoulos, N. (2015) Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers. International Journal of Molecular Sciences, 16, 25141-25153. https://doi.org/10.3390/ijms161025141</mixed-citation></ref><ref id="scirp.96363-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Cousin, F.J., Le Guellec, R., Chuat, V., Dalmasso, M., Laplace, J.M. and Cretenet, M. (2019) Multiplex PCR for Rapid Identification of Major Lactic Acid Bacteria Genera in Cider and Other Fermented Foods. International Journal of Food Microbiology, 291, 17-24. https://doi.org/10.1016/j.ijfoodmicro.2018.11.004</mixed-citation></ref><ref id="scirp.96363-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Song, H., Bae, Y., Jeon, E., Kwon, Y. and Joh, S. (2019) Multiplex PCR Analysis of Virulence Genes and Their Influence on Antibiotic Resistance in Enterococcus spp. Isolated from Broiler Chicken. Journal of Veterinary Science, 20, e26. https://doi.org/10.4142/jvs.2019.20.e26</mixed-citation></ref><ref id="scirp.96363-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Ghasemi, A., Moosavi-Nasab, M., Setoodeh, P., Mesbahi, G. and Yousefi, G. (2019) Biosurfactant Production by Lactic Acid Bacterium Pediococcus dextrinicus SHU1593 Grown on Different Carbon Sources: Strain Screening Followed by Product Characterization. Scientific Reports, 9, 5287. https://doi.org/10.1038/s41598-019-41589-0</mixed-citation></ref><ref id="scirp.96363-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Behzadnia, A., Moosavi-Nasab, M. and Tiwari, B.K. (2019) Stimulation of Biosurfactant Production by Lactobacillus Plantarum Using Ultrasound. Ultrasonics Sonochemistry, 59, Article ID: 104724. https://doi.org/10.1016/j.ultsonch.2019.104724</mixed-citation></ref><ref id="scirp.96363-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Yan, X., Gu, S., Cui, X., Shi, Y., Wen, S., Chen, H., et al. (2019) Antimicrobial, Anti-Adhesive and Anti-Biofilm Potential of Biosurfactants Isolated from Pediococcus acidilactici and Lactobacillus plantarum against Staphylococcus aureus CMCC26003. Microbial Pathogenesis, 127, 12-20.https://doi.org/10.1016/j.micpath.2018.11.039</mixed-citation></ref><ref id="scirp.96363-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Satpute, S.K., Kulkarni, G., Banpurkar, A.G., Banat, I.M., Mone, N.S., Patil, R.H., et al. (2016) Biosurfactant/s from Lactobacilli Species: Properties, Challenges and Potential Biomedical Applications. Journal of Basic Microbiology, 56, 1140-1158.https://doi.org/10.1002/jobm.201600143</mixed-citation></ref><ref id="scirp.96363-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Cecilia Fontana, C., Cocconcelli, P.S., Vignolo, G. and Saavedra, S. (2015) Occurrence of Antilisterial Structural Bacteriocins Genes in Meat Borne Lactic Acid Bacteria. Food Control, 47, 53-59. https://doi.org/10.1016/j.foodcont.2014.06.021</mixed-citation></ref><ref id="scirp.96363-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Remiger, A.A., Ehrmann, M.A. and Vogel, R.F. (1996) Identification of Bacteriocin-Encoding Genes in Lactobacilli by Polymerase Chain Reaction (PCR). Systematic and Applied Microbiology, 19, 28-34.https://doi.org/10.1016/S0723-2020(96)80005-1</mixed-citation></ref><ref id="scirp.96363-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Cocolin, L. and Rantsiou, K. (2007) Sequencing and Expression Analysis of Sakacin Genes in Lactobacillus curvatus Strains. Applied Microbiology and Biotechnology, 76, 1403-1411. https://doi.org/10.1007/s00253-007-1120-8</mixed-citation></ref><ref id="scirp.96363-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">du Toit, M., Franz, C.M., Dicks, L.M. and Holzapfel, W.H. (2000) Preliminary Characterization of Bacteriocins Produced by Enterococcus faecium and Enterococcus faecalis Isolated from Pig Faeces. Journal of Applied Microbiology, 88, 482-494.https://doi.org/10.1046/j.1365-2672.2000.00986.x</mixed-citation></ref><ref id="scirp.96363-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Wieckowicz, M., Schmidt, M., Sip, A. and Grajek, W. (2001) Development of a PCR Based Assay for Rapid Detection of Class IIa Bacteriocin Genes. Letters in Applied Microbiology, 52, 281-289. https://doi.org/10.1111/j.1472-765X.2010.02999.x</mixed-citation></ref><ref id="scirp.96363-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Rodriguez, J.M., Cintas, L.M., Casaus, P., Martinez, M.I., Suarez, A. and Hernandez, P.E. (1997) Detection of Pediocin PA-1-Producing Pediococci by Rapid Molecular Biology Techniques. Food Microbiology, 14, 363-371.https://doi.org/10.1006/fmic.1996.0084</mixed-citation></ref><ref id="scirp.96363-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Ben Omar, N., Abriouel, H., Keleke, S., Sanchez Valenzuela, A., Martinez-Canamero, M., Lucas Lopez, R., et al. (2008) Bacteriocin-Producing Lactobacillus Strains Isolated from Poto Poto, a Congolese Fermented Maize Product, and Genetic Fingerprinting of Their Plantaricin Operons. International Journal of Food Microbiology, 127, 18-25. https://doi.org/10.1016/j.ijfoodmicro.2008.05.037</mixed-citation></ref><ref id="scirp.96363-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Jennison, A.V. and Verma, N.K. (2007) The Acid-Resistance Pathways of Shigella flexneri 2457T. Microbiology, 153, 2593-602. https://doi.org/10.1099/mic.0.2007/006718-0</mixed-citation></ref><ref id="scirp.96363-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Niu, C., Yang, J., Liu, H., Cui, Y., Xu, H., Wang, R., et al. (2017) Role of the Virulence Plasmid in Acid Resistance of Shigella flexneri. Scientific Reports, 7, 46465.https://doi.org/10.1038/srep46465</mixed-citation></ref><ref id="scirp.96363-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Gorden, J. and Small, P.L. (1993) Acid Resistance in Enteric Bacteria. Infection and Immunity, 61, 364-367.</mixed-citation></ref><ref id="scirp.96363-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Mukherjee, S. and Ramesh, A. (2015) Bacteriocin-Producing Strains of Lactobacillus plantarum Inhibit Adhesion of Staphylococcus aureus to Extracellular Matrix: Quantitative Insight and Implications in Antibacterial Therapy. Journal of Medical Microbiology, 64, 1514-1526. https://doi.org/10.1099/jmm.0.000181</mixed-citation></ref><ref id="scirp.96363-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Bah, A., Albano, H., Barbosa, J.B., Fhoula, I., Gharbi, Y., Najjari, A., et al. (2019) Inhibitory Effect of Lactobacillus plantarum FL75 and Leuco-nostoc mesenteroides FL14 against Foodborne Pathogens in Artificially Contaminated Fermented Tomato Juices. BioMed Research International, 2019, Article ID: 6937837.https://doi.org/10.1155/2019/6937837</mixed-citation></ref><ref id="scirp.96363-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Pradhan, A.K., Pradhan, N., Sukla, L.B., Panda, P.K. and Mishra, B.K. (2014) Inhibition of Pathogenic Bacterial Biofilm by Biosurfactant Produced by Lysinibacillus fusiformis S9. Bioprocess and Biosystems Engineering, 37, 139-149.https://doi.org/10.1007/s00449-013-0976-5</mixed-citation></ref><ref id="scirp.96363-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Satpute, S.K., Mone, N.S., Das, P., Banat, I.M. and Banpurkar, A.G. (2019) Inhibition of Pathogenic Bacterial Biofilms on PDMS Based Implants by L. acidophilus Derived Biosurfactant. BMC Microbiology, 19, 39.https://doi.org/10.1186/s12866-019-1412-z</mixed-citation></ref><ref id="scirp.96363-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Madhu, A.N. and Prapulla, S.G. (2014) Evaluation and Functional Characterization of a Biosurfactant Produced by Lactobacillus plantarum CFR 2194. Applied Biochemistry and Biotechnology, 172, 1777-1789. https://doi.org/10.1007/s12010-013-0649-5</mixed-citation></ref><ref id="scirp.96363-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Li, F., Li, Q., Wu, S. and Tan, Z. (2017) Salting-Out Extraction of Allicin from Garlic (Allium sativum L.) Based on Ethanol/Ammonium Sulfate in Laboratory and Pilot Scale. Food Chemistry, 217, 91-97. https://doi.org/10.1016/j.foodchem.2016.08.092</mixed-citation></ref><ref id="scirp.96363-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Wu, C., Huang, J. and Zhou, R. (2017) Genomics of Lactic Acid Bacteria: Current Status and Potential Applications. Critical Reviews in Microbiology, 43, 393-404.https://doi.org/10.1080/1040841X.2016.1179623</mixed-citation></ref><ref id="scirp.96363-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Wang, C., Cui, Y. and Qu, X. (2018) Mechanisms and Improvement of Acid Resistance in Lactic Acid Bacteria. Archives of Microbiology, 200, 195-201.https://doi.org/10.1007/s00203-017-1446-2</mixed-citation></ref><ref id="scirp.96363-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Fonseca, F., Penicaud, C., Tymczyszyn, E.E., Gomez-Zavaglia, A. and Passot, S. (2019) Factors Influencing the Membrane Fluidity and the Impact on Production of Lactic Acid Bacteria Starters. Applied Microbiology and Biotechnology, 103, 6867-6883. https://doi.org/10.1007/s00253-019-10002-1</mixed-citation></ref><ref id="scirp.96363-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Habimana, J.D., Ituze Kubana, M.C., Ineza, C. and Karangwa, E. (2017) Comparative Study of Physicochemical and Bacteriological Characteristics of Banana Wines Produced by Conventional and Modern Techniques in Southern Province of Rwanda. American Journal of Food Science and Technology, 5, 192-198.</mixed-citation></ref><ref id="scirp.96363-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Ahmad, V., Jamal, Q.M.S., Siddiqui, M.U., Shukla, A.K., Alzohairy, M.A., Al Karaawi, M.A., et al. (2017) Methods of Screening-Purification and Antimicrobial Potentialities of Bacteriocin in Health Care. Current Drug Metabolism, 18, 814-830.https://doi.org/10.2174/1389200218666170116111309</mixed-citation></ref><ref id="scirp.96363-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Xi, Q., Wang, J., Du, R., Zhao, F., Han, Y. and Zhou, Z. (2018) Purification and Characterization of Bacteriocin Produced by a Strain of Enterococcus faecalis TG2. Applied Biochemistry and Biotechnology, 184, 1106-1119.https://doi.org/10.1007/s12010-017-2614-1</mixed-citation></ref><ref id="scirp.96363-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Indira, M., Venkateswarulu, T.C., Abraham Peele, K., Nazneen Bobby, M. and Krupanidhi, S. (2019) Bioactive Molecules of Probiotic Bacteria and Their Mechanism of Action: A Review. 3 Biotech, 9, 306. https://doi.org/10.1007/s13205-019-1841-2</mixed-citation></ref><ref id="scirp.96363-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Devi, S.M., Aishwarya, S. and Halami, P.M. (2016) Discrimination and Divergence among Lactobacillus plantarum-Group (LPG) Isolates with Reference to Their Probiotic Functionalities from Vegetable Origin. Systematic and Applied Microbiology, 39, 562-570. https://doi.org/10.1016/j.syapm.2016.09.005</mixed-citation></ref><ref id="scirp.96363-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Elegado, F.B., Guerra, M.A., Macayan, R.A., Mendoza, H.A. and Lirazan, M.B. (2004) Spectrum of Bacteriocin Activity of Lactobacillus plantarum BS and Fingerprinting by RAPD-PCR. International Journal of Food Microbiology, 95, 11-18.https://doi.org/10.1016/j.ijfoodmicro.2004.01.014</mixed-citation></ref><ref id="scirp.96363-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">Yang, H., Liu, T., Zhang, G., Chen, J., Gu, J., Yuan, L., et al. (2017) Genotyping of Lactobacillus Sanfranciscensis Isolates from Chinese Traditional Sourdoughs by Multilocus Sequence Typing and Multiplex RAPD-PCR. International Journal of Food Microbiology, 258, 50-57. https://doi.org/10.1016/j.ijfoodmicro.2017.07.013</mixed-citation></ref></ref-list></back></article>