<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2019.910052</article-id><article-id pub-id-type="publisher-id">AiM-95799</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Prevalence of CTXM, SHV, TEM AND OXA Genes among Extended-Spectrum Beta-Lactamase Producing &lt;i&gt;Klebsiella pneumoniae&lt;/i&gt; from Mukuru Slum, Kenya
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hellen</surname><given-names>Saisi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Celestine</surname><given-names>Makobe</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Maureen</surname><given-names>Kangongo</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Samwuel</surname><given-names>Kariuki</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Centre for Microbiology Research, Kenya Medical Research Institute, Nairobi, Kenya</addr-line></aff><aff id="aff1"><addr-line>Department of Medical Microbiology, College of health Science, Jomo Kenyatta University of Agriculture and Technology, 
Nairobi, Kenya</addr-line></aff><pub-date pub-type="epub"><day>17</day><month>10</month><year>2019</year></pub-date><volume>09</volume><issue>10</issue><fpage>853</fpage><lpage>862</lpage><history><date date-type="received"><day>28,</day>	<month>August</month>	<year>2019</year></date><date date-type="rev-recd"><day>15,</day>	<month>October</month>	<year>2019</year>	</date><date date-type="accepted"><day>18,</day>	<month>October</month>	<year>2019</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Background: Extended spectrum beta lactamases (ESBLs) producing Enterobacteriaceae cause infections that are often reported in both hospital and community setting. These infections are on the increase and jeopardize the achievement of modern medicine because of their clinical implications. There is need for surveillance measures to be taken, both by the health care personnel and the community at large. 
  Methodology: We examined 330 diarrhea stool samples from children below the age of 5 years and processed them. A total of 96 (29%) samples were identified as 
  Klebsiella pneumoniae out of the bacteria isolated. Identification of ESBL was done and 42 
  K. pneumoniae isolates were tested for the occurrence of 
  <sup>bla</sup>CTX-M, 
  <sup>bla</sup>OXA, 
  <sup>bl</sup>aTEM and 
  <sup>bla</sup>SHV resistant genes by PCR, gel electrophoresis and visualized by UV illumination. 
  Results: Our results revealed that 
  <sup>bla</sup>CTXM was the most frequent ESBL type 42 (100%), followed by 
  <sup>bla</sup>TEM in 41 (97.6%) isolates and 
  <sup>bla</sup>SHVin38 (90.4%) of the isolates. None of the tested isolates were found to be encoding 
  <sup>bla</sup>OXA. There was occurrence of more than one gene in most of the isolates. The double combination was detected in 
  <sup>bla</sup>CTX-M/
  <sup>bla</sup>TEM (9.5%) and 
  <sup>bla</sup>CTXM/SHV (2.4%). A triple combination was noted 
  <sup>bla</sup>TEM/
  <sup>bla</sup>SHV/
  <sup>bla</sup> CTX-M (88%). 
  Conclusion: Our results indicate that there is Presence of Beta lactam genes associated with antimicrobial resistance among the 
  K. pneumoniae isolates from Mukuru Slum, Kenya. The predominant ESBL genotype in Mukuru slums, Kenya was 
  <sup>bla</sup>CTX-M followed by 
  <sup>bla</sup>TEM and 
  <sup>bla</sup>SHV respectively. There is need for surveillance measures to be taken so as to control the spread among the community.
 
</p></abstract><kwd-group><kwd>Klebsiella Pneumoniae</kwd><kwd> Resistant Genes</kwd><kwd> ESBL</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Klebsiella pneumonia commonly causes both hospital and community-acquired infections worldwide. It is a normal flora of the gastrointestinal tract and causes infections when immunity is compromised, children, neonates and the elderly being vulnerable individuals. It causes diarrhea, urinary tract infections, bacteremia, liver abscess and wound or soft tissue infections. It is one of the top three bacteria of international concern associated with nosocomial infections in WHO report on global status of antibacterial resistance [<xref ref-type="bibr" rid="scirp.95799-ref1">1</xref>]. Klebsiella has the ability to acquire gradually, build up and transfer multitude antimicrobial resistant determinants. It may consequentially serve as a reservoir for resistance within the gut [<xref ref-type="bibr" rid="scirp.95799-ref2">2</xref>]. It is well documented that in vivo transfer of antimicrobial resistant genes from intestinal Klebsiella to other bacterial species occur [<xref ref-type="bibr" rid="scirp.95799-ref3">3</xref>].</p><p>The Clinical and Laboratory Standards Institute recommends routine testing and reporting of Klebsiella pneumoniae because it is one of the major ESBL-producing organisms isolated worldwide. ESBL is a major concern worldwide as it alleviates treatment failure since it’s responsible for antibiotic resistance. Beta-lactamases are enzymes that confer resistance to the beta-lactam antibiotics such as penicillin, cephalosporins and Carbapenem which have been used widely for the treatment of infections caused by Gram negative bacteria. Beta lactam enzymes catalyze the hydrolysis of the amide bond of beta-lactam ring rendering the antibiotic inactive against the cell wall trans peptidase which is its cellular target. This has led to bacteria resistance. Beta-lactamases are grouped into four classes on the basis of their primary structure A, B, C, and D enzymes. Enzymes of classes A, C, and D have serine at the active site, whereas the class B enzymes are zinc-metalloenzymes [<xref ref-type="bibr" rid="scirp.95799-ref4">4</xref>].</p><p>ESBL are often produced by Enterobacteriaceae members especially Klebsiella, and E. coli. These enzymes can be exchanged readily between bacteria species since they are encoded by plasmids. According to Bajpai et al., 2017 [<xref ref-type="bibr" rid="scirp.95799-ref4">4</xref>], more than 350 different ESBL variants are known and are classified into nine evolutionary and structural families based upon their amino acid sequence such as CTXM, TEM, SHV, OXA, PER, TLA, VEB, GES and BES. In Kenya, there are limited pediatric data on the prevalence of these ESBL variants. ESBLs were first identified in Germany in 1982 and have since spread globally, becoming a significant problem in sub-Saharan Africa including Kenya [<xref ref-type="bibr" rid="scirp.95799-ref5">5</xref>].</p><p>Here, we examine the presence of resistant gene conferred by ESBLs in Klebsiella pneumoniae isolates.</p></sec><sec id="s2"><title>2. Methodology</title><sec id="s2_1"><title>2.1. Study Area</title><p>The study was carried out within Mukuru Kwa Njenga slums. Mukuru slum is located on the East of Nairobi in Embakasi constituency in the period of August 2017 to August 2018 (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p></sec><sec id="s2_2"><title>2.2. Patient Recruitment</title><p>Children having diarrhoea who are 5 years of age and below. Diarrhea was taken to be three or more episodes of passing loose stool that is watery and Mucoid or bloody in a day. These children were seeking treatment at outpatient clinics in Mukuru slum. Consent was given by the parent or guardian to participate in the study by signing consent to participate having been briefed about the study. Every third patient who had not taken antibiotics before going to the hospital was recruited into the study.</p></sec><sec id="s2_3"><title>2.3. Sample Collection</title><p>The patient was given a sterile stool cup to collect a single stool sample taking care not to contaminate the sample with urine, soil or water. Part of the collected stool was transported in Carry Blair transport medium to Kenya Medical Research Institute Microbiology laboratory for processing.</p></sec><sec id="s2_4"><title>2.4. Bacteria Identification</title><p>On arrival at the laboratory the stool samples were examined macroscopically, recorded and immediately platted on MacConkey and incubated at 37˚C for 18 to 24 hours. Colonial morphology was done and Lactose fermenting Mucoid colonies were sub cultured on nutrient agar for purity and then biotyping was done. The criteria for K. pneumoniae confirmation was Tipple sugar iron: A/A, Gas+ and H<sub>2</sub>S−. MIO: +motility, +indole, +ornithine, citrate positive and urease positive.</p></sec><sec id="s2_5"><title>2.5. Antibiotic Susceptibility Testing</title><p>The Kirb-Bauer disc diffusion technique was done in antibiotic susceptibility testing on the isolates using different antibiotics such as: Beta lactams, quinolones amino glycosides and penicillins.</p><p>Zones of inhibitions were measured and the results interpreted in accordance to Clinical Laboratory Standard Institute 2015 guidelines [<xref ref-type="bibr" rid="scirp.95799-ref6">6</xref>]. Isolates that were resistant to third generation cephalosporins were subjected to phenotypic detection.</p></sec><sec id="s2_6"><title>2.6. Phenotypic Detection of ESBL</title><p>Characterization was done on K. pneumoniae isolates that were resistant to cephalosporins and tested for ESBLs production using the double disk synergy test in accordance to CLSI 2015 guidelines. ESBL-producers were identified as isolates showing synergy zones between Amoxicillin/clavulanic and one or more third generation cephalosporin [<xref ref-type="bibr" rid="scirp.95799-ref7">7</xref>].</p><p>An inhibition zone that is distorted or enlarged forming a keyhole appearance between the cephalosporins discs and the Amoxicillin/Clavulanate disc was interpreted as an ESBL enzyme production phenotype. K. pneumoniae K6 ATCC 700,603 (ESBL producer) and Escherichia coli ATCC 25,922 (non-ESBL producer) served as the positive and negative controls respectively.</p></sec><sec id="s2_7"><title>2.7. Genotypic Detection of ESBL</title><p>The boiling method was used to extract DNA of Purified colonies of ESBLs producing K. pneumonia suspended in TE buffer. SHV, CTXM, OXA and TEM genes were detected as described previously [<xref ref-type="bibr" rid="scirp.95799-ref7">7</xref>]. Specific primers for the genes, amplicon size and annealing temperatures used are shown in <xref ref-type="table" rid="table1">Table 1</xref>. PCR amplification for selected ESBL genes was done in 20 μl volumes containing 4 μl of 5&#215; master mix of 0.4 μl concentrations of each primer, 12.2 μl of PCR water, BSA 1 μl and 2 μl of DNA template. A programmable thermo cycler was used with initial denaturation at 94˚C for 5 min; followed by 35 cycles at 94˚C for30 s, annealing was done between 30 second and 1 min depending on the primer temperature, then a short extension step at 72˚C for 1 min and a final extension at temperature of 72˚C for 10 min for short fragments and 20 min for longer fragments. Electrophoresis was done to the amplified PCR products, with a 1 kb DNA ladder as a standard in 1.0% agarose gel in 1&#215; TBE buffer and stained with ethidium bromide. This was visualized under the UV trans illumination. Positive control strains were used for the different test genes and distilled water used as a negative control.</p></sec></sec><sec id="s3"><title>3. Results</title><p>A total of 96 (29%) Klebsiella pneumoniae were isolated from the 330 samples obtained from children recruited into the study. 42 ESBL Klebsiella pneumonia bacterial isolates were studied genotypically. PCR amplification was done to detect</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used for detection of <sup>bla</sup>SHV, <sup>bla</sup>CTX-M &amp; <sup>bla</sup>TEM genes</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene</th><th align="center" valign="middle" >Primer sequence</th><th align="center" valign="middle" >Amplicon size</th><th align="center" valign="middle" >Annealing temperature</th></tr></thead><tr><td align="center" valign="middle" >SHV</td><td align="center" valign="middle" >F:5'-TCAGCGAAAAACACCTTG -3' R:5'-CCCGCAGATAAATCACCA -3'</td><td align="center" valign="middle" >747 bp</td><td align="center" valign="middle" >50</td></tr><tr><td align="center" valign="middle" >TEM</td><td align="center" valign="middle" >F:5'GAGTATTCAACATTTCCGTGTC-3' R:5'TAATCAGTGAGGCACCTATCTC-3'</td><td align="center" valign="middle" >865 bp</td><td align="center" valign="middle" >55</td></tr><tr><td align="center" valign="middle" >CTX-M</td><td align="center" valign="middle" >F:5'TTTGCGATGTGCAGTACCAGT AA-3' R:5'CGATATCGTTGGTGGTGCCAT A-3'</td><td align="center" valign="middle" >593 bp</td><td align="center" valign="middle" >60</td></tr><tr><td align="center" valign="middle" >OXA</td><td align="center" valign="middle" >F:5'ATGAAAAACACAATACATATCAACT-3' R:5'GTGTGTTTAGAATGGTGATCGCATT-3'</td><td align="center" valign="middle" >820</td><td align="center" valign="middle" >62</td></tr></tbody></table></table-wrap><p>the presence of <sup>bla</sup>CTX-M, <sup>bla</sup>OXA, <sup>bla</sup>TEM and <sup>bla</sup>SHV genes by PCR, gel electrophoresis and visualized by UV illumination. <sup>bla</sup>CTX-M was identified in all 42 (100%) isolates, <sup>bla</sup>TEM in 41 (97.6%) isolates, <sup>bl</sup>aSHV in 38 (90.4%) of the isolates. None of the isolates tested were identified to be encoding <sup>bla</sup>OXA. There was occurrence of more than one gene in most of the isolates, double and triple combination was noted.</p><p>The double combination was detected in <sup>bla</sup>CTX-M/<sup>bla</sup>TEM (9.5%) and <sup>bla</sup>CTXM/SHV (2.4%) while a triple combination was noted <sup>bla</sup>CTX-M/<sup>bla</sup>TEM/<sup>bla</sup> (88%) as shown in <xref ref-type="table" rid="table2">Table 2</xref> (Figures 2-4).</p></sec><sec id="s4"><title>4. Discussion</title><p>In our study, CTXM, TEM and SHV genes were detected in ESBL producing K. pneumoniae. This may be due to the fact that in Mukuru slum, factors such as poor hygiene due limited resources such as water supply, poor housing, poor drainage, overcrowding, frequent outbreaks of diseases and even malnutrition, put the inhabitants at risk of acquiring ESBL Klebsiella. Furthermore, the low social economic status and even illiteracy may contribute to the misuse of antibiotics.</p><p>CTXM (100%) was the most predominant gene, TEM (97%) and SHV (90.4%) genes responsible for ESBL production. Our results are in accordance with a study done by Maina et al., (2013) [<xref ref-type="bibr" rid="scirp.95799-ref8">8</xref>] at Agha khan University, Kenya where <sup>bla</sup>CTX-M was the predominant genotype found in 46 (88.5%) of the 52 isolates analyzed. In other african countries, 17/17 Klebsiella spp. isolated in a pediatric hospital, Charles De Gaulle, Burkina Faso had CTXM [<xref ref-type="bibr" rid="scirp.95799-ref9">9</xref>]. In other parts of the world, like Turkey reported CTX-M (92%), followed by TEM (39%), SHV (5%). In the Philippines reported 35 (95%) <sup>bla</sup>CTX-M. In Asia, Taiwan, Japan and China, earlier reports indicated a dominance of SHV but CTXM now emerges dominance Reuland, et al., 2013 [<xref ref-type="bibr" rid="scirp.95799-ref10">10</xref>]. Further reports from South America, Israel, Spain, New York, the United Kingdom, and several parts of Indian subcontinent revealed CTX-M a the predominant gene. These results reflect a trend not only in Africa but also in other parts of the world where <sup>bla</sup>CTXM has been reported to be the most prevalent ESBL-encoding gene and is replacing <sup>bla</sup>TEM</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Frequency of the ESBL genes detected from K. pneumoniae</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene</th><th align="center" valign="middle" >No</th><th align="center" valign="middle" >%</th></tr></thead><tr><td align="center" valign="middle" >SHV</td><td align="center" valign="middle" >38</td><td align="center" valign="middle" >90.4%</td></tr><tr><td align="center" valign="middle" >TEM</td><td align="center" valign="middle" >41</td><td align="center" valign="middle" >97.6%</td></tr><tr><td align="center" valign="middle" >CTXM</td><td align="center" valign="middle" >42</td><td align="center" valign="middle" >100%</td></tr><tr><td align="center" valign="middle" >OXA</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0.00%</td></tr><tr><td align="center" valign="middle" >CTXM/SHV/TEM</td><td align="center" valign="middle" >37</td><td align="center" valign="middle" >88%</td></tr><tr><td align="center" valign="middle" >CTXM/TEM</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >9.5%</td></tr><tr><td align="center" valign="middle" >TEM/SHV</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0%</td></tr><tr><td align="center" valign="middle" >CTXM/SHV</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >2.4%</td></tr></tbody></table></table-wrap><p>and <sup>bla</sup>SHV types as the predominant ESBL in many countries [<xref ref-type="bibr" rid="scirp.95799-ref11">11</xref>]. CTXM was the most dominant probably because it is located in different plasmids that belong to different incompatible groups and can be found in isolates that are not related epidemiologically. This enzyme therefore has the ability to spread widely [<xref ref-type="bibr" rid="scirp.95799-ref12">12</xref>].</p><p>However, some studies performed throughout the world showed variable results. In Machakos hospital, Juma et al., (2016) [<xref ref-type="bibr" rid="scirp.95799-ref13">13</xref>] found that TEM was the most predominant. A report from Canada showed SHV 22 (43.14%) as the main group of ESBLs, followed by <sup>bla</sup>TEM 18 (35.29%) and blaCTXM 16 (31.37%) [<xref ref-type="bibr" rid="scirp.95799-ref14">14</xref>]. The differences between our study results and those of other authors indicated that the prevalence and type of ESBL genes may vary from one geographical region to another Bajpai et al., 2017 [<xref ref-type="bibr" rid="scirp.95799-ref4">4</xref>].</p><p>In our study, none of the 42 isolates tested was found to be encoding <sup>bla</sup>OXA. This is in accordance to a similar study conducted in Gazi University, Turkey where there were no strains harboring OXA type among the beta lactamase isolates [<xref ref-type="bibr" rid="scirp.95799-ref15">15</xref>]. A study done in France identified the first large outbreak of OXA among 48-positive Carbapenem-resistant K. pneumoniae isolates expressed both SHV and CTXM [<xref ref-type="bibr" rid="scirp.95799-ref16">16</xref>]. The OXA family of ESBLs has mainly been reported in Pseudomonas aeruginosa unlike <sup>bla</sup>TEM and <sup>bla</sup>SHV which are prevalent in Enterobacteriaceae. They belong to molecular class D and functional group 2d and have ability to hydrolyze Oxacillin. However, they are resistant to Ampicillin and Cephalothin but inhibited by clavulanic acid and they cannot breakdown the recently developed cephalosporins exceptOXA-10 that weakly destroys aztreonam, ceftriaxone and Cefotaxime. Other OXA ESBLS include OXA-11, -14, -16, -17, -19, -15, -18, -28, -31, -32, -35, and -45 [<xref ref-type="bibr" rid="scirp.95799-ref17">17</xref>].</p><p>Occurrence of more than one beta-lactamase within the same isolate was detected in our study. It is notable that most isolates had a double and a triple combination. Double combination was observed in CTXM/TEM, CTXM/SHV.A triple combination was noted in CTXM/TEM/SHV.</p><p>Coexistence the ESBL gene has been reported in various studies. In Africa, Tunisia has reported a Triple combination TEM/SHV/CTX-M [<xref ref-type="bibr" rid="scirp.95799-ref18">18</xref>]. In Tanzania, Mshana et al., (2013 [<xref ref-type="bibr" rid="scirp.95799-ref19">19</xref>] found a combination of TEM/CTX-M, 11.96% (11/92) SHV/CTX-M and 10.87% (10/92) CTX-M alone. In Togo, combination of TEM/SHV/CTXM predominating at 61.90%, TEM/SHV 20.63%, SHV/CTXM 11.11%, TEM/SHV 4.76% and TEM 1.59 has been reported. In Bukinafaso, triple combination of TEM, SHV and CTX-M was noted. In Tunisia a triple combination TEM/SHV/CTX-M represented 44.91% (53/118), and the double combinations were SHV/CTX-M represented 28.81% (34/118) of cases, TEM/CTX-M represented 4.23% (5/118) and TEM/SHV represented 3.39% (4/118) of cases according to Diagbouga et al., 2016 [<xref ref-type="bibr" rid="scirp.95799-ref20">20</xref>]. Similarly, in Brazil, Jaskulski et al., (2013) [<xref ref-type="bibr" rid="scirp.95799-ref21">21</xref>] found that 16.67% (2/12) of ESBL producing Klebsiella pneumoniae carried TEM, CTX-M, TEM/SHV genes, while 8.33% (8/12) carried SHV alone. The double TEM/CTX-M and triple TEM/SHV/CTX-M combinations were 25% (3/12) and 16.67% (2/12) respectively.</p><p>Antibiotic policy in Kenya is not enforced. Beta lactam antibiotics are misused just like other antibiotics. Culture and sensitivity is not always done prio to the issuance of prescription, we speculate that the misuse of antibiotics to treat infections, has selected for isolates carrying multiple bla genes such as those encountered in this study. The occurrence of double and triple bla genes carriage and combination should be further investigated.</p></sec><sec id="s5"><title>5. Conclusion</title><p>From our report on molecular characteristics of Klebsiella pneumoniae isolates in Mukuru slums, Kenya, we reveal a high rate of ESBL in this area. We also identified ESBL-producing three genes of <sup>bla</sup><sub>TEM</sub>, <sup>bla</sup><sub>SHV</sub>, and <sup>bla</sup><sub>CTX</sub><sub>-M</sub> by PCR. Combination of the three resistant genes was also noted. The most common genotype was <sup>bla</sup><sub>CTX</sub><sub>-M</sub> followed by <sup>bla</sup><sub>TEM</sub><sub> </sub>and <sup>bla</sup><sub>SHV</sub> as last. We did not detect <sup>bla</sup><sub>OXA</sub> in Mukuru slum. The high prevalence of these resistant genes may influence appropriate treatment of infections caused by Klebsiella pneumoniae among children. The data underline the need for establishment of laboratory infrastructure and protocols for continuous surveillance of resistance so as to monitor antimicrobial therapy and drug resistant isolates in order to better control the emergence and spread of ESBL producing K. pneumoniae strains. A high degree of awareness should be created not only among the community but also among physicians and microbiologists. Consequently, there is need for improvement of hygiene conditions in the slums.</p></sec><sec id="s6"><title>Authors’ Contribution</title><p>HS developed the concept and study design. She collected and analyzed the samples, interpreted data and drafted the manuscript. SM supervised the lab work and offered guidance. SM assisted in manuscript preparation MK corrected the proposal.</p></sec><sec id="s7"><title>Authors’ Information</title><p>HS is a master’s student studying Medical Microbiology. Dr. CM and MK are lectures in Jomo Kenyatta University and Technology with great experience in proposal development. SK is an academician and Chief research scientist of international acclaim, with an extensive experience He is the head of Research and development.</p></sec><sec id="s8"><title>Ethical Considerations</title><p>Ethical approval for the study was granted by the Kenyatta University Ethical Committee (020 8710901/12).</p></sec><sec id="s9"><title>Acknowledgements</title><p>The authors would like to acknowledge KEMRI-CMR Laboratory staff for their cooperation during the study and for allowing us to conduct this study in your institution. We thank the study participants for their participation in the study.</p></sec><sec id="s10"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s11"><title>Cite this paper</title><p>Saisi, H., Makobe, C., Kangongo, M. and Kariuki, S. (2019) Prevalence of CTXM, SHV, TEM AND OXA Genes among Extended-Spectrum Beta-Lactamase Producing Klebsiella pneumoniae from Mukuru Slum, Kenya. Advances in Microbiology, 9, 853-862. https://doi.org/10.4236/aim.2019.910052</p></sec></body><back><ref-list><title>References</title><ref id="scirp.95799-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Diagbouga, S., Salah, F.D., Sadji, A.Y., Dabire, A.M. and Nadembega, C. (2016) Detection of High Prevalence of TEM/SHV/CTX-M Genes in ESBL Producing and Multidrug Resistant Klebsiella pneumoniae and Klebsiella Oxytoca. Journal of Clinical Diagnosis and Research, 4, 130. https://doi.org/10.4172/2376-0311.1000130</mixed-citation></ref><ref id="scirp.95799-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Jaskulski, M.R., Medeiros, B.C., Borges, J.V., Zalewsky, R., Fonseca, M.E.C., Marinowic, D.R. and Machado, D.C. (2013) Assessment of Extended-Spectrum β-Lactamase, KPC Carbapenemase and Porin Resistance Mechanisms in Clinical Samples of Klebsiella pneumoniae and Enterobacter spp. International Journal of Antimicrobial Agents, 42, 76-79. https://doi.org/10.1016/j.ijantimicag.2013.03.009</mixed-citation></ref><ref id="scirp.95799-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Mshana, S.E., Hain, T., Domann, E., Lyamuya, E.F., Chakraborty, T. and Imirzalioglu, C. (2013) Predominance of Klebsiella pneumoniaeST14 Carrying CTX-M-15 Causing Neonatal Sepsis in Tanzania. BMC Infectious Diseases, 13, 466.https://doi.org/10.1186/1471-2334-13-466</mixed-citation></ref><ref id="scirp.95799-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Alibi, S., Ferjani, A. and Boukadida, J. (2015) Molecular Characterization of Extended Spectrum Beta-Lactamases Produced by Klebsiella pneumoniae Clinical Strains from a Tunisian Hospital. Medecine et Maladies Infectieuses, 45, 139-143.https://doi.org/10.1016/j.medmal.2015.01.010</mixed-citation></ref><ref id="scirp.95799-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Ali, T., Ali, I., Khan, N.A., Han, B. and Gao, J. (2018) The Growing Genetic and Functional Diversity of Extended Spectrum Beta-Lactamases. BioMed Research International, 2018, Article ID: 9519718. https://doi.org/10.1155/2018/9519718</mixed-citation></ref><ref id="scirp.95799-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Cuzon, G., Ouanich, J., Gondret, R., Naas, T. and Nordmann, P. (2011) Outbreak of OXA-48-Positive Carbapenem-Resistant Klebsiella pneumoniae Isolates in France. Antimicrobial Agents and Chemotherapy, 55, 2420-2423.https://doi.org/10.1128/AAC.01452-10</mixed-citation></ref><ref id="scirp.95799-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Bali, E.B., Acik, L. and Sultan, N. (2010) Phenotypic and Molecular Characterization of SHV, TEM and CTX-M and Extended-Spectrum Beta-Lactamase Produced by Escherichia coli, Acinobacter baumannii and Klebsiella Isolates in a Turkish Hospital. African Journal of Microbiology Research, 4, 650-654.</mixed-citation></ref><ref id="scirp.95799-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Eftekhar, F., Rastegar, M., Golalipoor, M. and Mansoursamaei, N. (2012) Detection of Extended Spectrum B-Lactamases in Urinary Isolates of Klebsiella pneumoniae in Relation to blaSHV, blaTEM and blaCTX-M Gene Carriage. Iranian Journal of Public Health, 41, 127-132.</mixed-citation></ref><ref id="scirp.95799-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Juma, B.W., Kariuki, S., Waiyaki, P.G., Mutugi, M.M. and Bulimo, W.D. (2016) The Prevalence of TEM and SHV Genes among Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae and Escherichia coli. African Journal of Pharmacology and Therapeutics, 5, 1-7.</mixed-citation></ref><ref id="scirp.95799-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Mathers, A.J., Peirano, G. and Pitout, J.D. (2015) The Role of Epidemic Resistance Plasmids and International High-Risk Clones in the Spread of Multidrug-Resistant Enterobacteriaceae. Clinical Microbiology Reviews, 28, 565-591.https://doi.org/10.1128/CMR.00116-14</mixed-citation></ref><ref id="scirp.95799-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Sharma, M., Pathak, S. and Srivastava, P. (2013) Prevalence and Antibiogram of Extended Spectrum Beta-Lactamase (ESBL) Producing Gram Negative Bacilli and Further Molecular Characterization of ESBL Producing Escherichia coli and Klebsiella spp. Journal of Clinical and Diagnostic Research, 7, 2173-2177.</mixed-citation></ref><ref id="scirp.95799-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Reuland, E.A., Overdevest, I.T.M.A., Al Naiemi, N., Kalpoe, J.S., Rijnsburger, M.C., Raadsen, S.A. and Kluytmans, J.A.J.W. (2013) High Prevalence of ESBL-Producing Enterobacteriaceae Carriage in Dutch Community Patients with Gastrointestinal Complaints. Clinical Microbiology and Infection, 19, 542-549.https://doi.org/10.1111/j.1469-0691.2012.03947.x</mixed-citation></ref><ref id="scirp.95799-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Jihad, J.Z.B.M. and Mondher, B.M.E.J. (2013) Resistances to the Oxyimino-Cepha- losporins by Ctx-M-15 Producing Klebsiella Isolated From the Urines Samples of Patients in the University Hospital Complex Paediatric Charles De Gaulle (Chup-Cdg) Of Ouagadougou in Burkina Faso. Journal of Asian Scientific Research, 3, 882-890.</mixed-citation></ref><ref id="scirp.95799-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Maina, D., Makau, P., Nyerere, A. and Revathi, G. (2013) Antimicrobial Resistance Patterns in Extended-Spectrum β-Lactamase Producing Escherichia coli and Klebsiella pneumoniae Isolates in a Private Tertiary Hospital, Kenya. Microbiology Discovery, 1, 5. https://doi.org/10.7243/2052-6180-1-5</mixed-citation></ref><ref id="scirp.95799-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Juma, A.O. (2017) Antimicrobial Susceptibility Profiles and Genotypic Characterization of Selected Enterobacteriaceae Strains Isolated from Food Handlers in Nairobi, Kenya.</mixed-citation></ref><ref id="scirp.95799-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Clinical Laboratory Standards Institute (CLSI) (2015) Performance Standards for Antimicrobial Susceptibility Testing. 19th Informational Supplement. CLSI/NCCLS M100-S19. Wayne, Pennsylvania, PA.</mixed-citation></ref><ref id="scirp.95799-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Henson, S.P., Boinett, C.J., Ellington, M.J., Kagia, N., Mwarumba, S., Nyongesa, S., Morpeth, S.C., et al. (2017) Molecular Epidemiology of Klebsiella pneumoniae Invasive Infections over a Decade at Kilifi County Hospital in Kenya. International Journal of Medical Microbiology, 307, 422-429. https://doi.org/10.1016/j.ijmm.2017.07.006</mixed-citation></ref><ref id="scirp.95799-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Bajpai, T., Pandey, M., Varma, M. and Bhatambare, G.S. (2017) Prevalence of TEM, SHV and CTX-M Beta-Lactamase Genes in the Urinary Isolates of a Tertiary Care Hospital. Avicenna Journal of Medicine, 7, 12-16. https://doi.org/10.4103/2231-0770.197508</mixed-citation></ref><ref id="scirp.95799-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Schj&amp;oslash;rring, S., Struve, C. and Krogfelt, K.A. (2008) Transfer of Antimicrobial Resistance Plasmids from Klebsiella pneumoniae to Escherichia coli in the Mouse Intestine. Journal of Antimicrobial Chemotherapy, 62, 1086-1093.https://doi.org/10.1093/jac/dkn323</mixed-citation></ref><ref id="scirp.95799-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Bennett, P.M. (2008) Plasmid Encoded Antibiotic Resistance: Acquisition and Transfer of Antibiotic Resistance Genes in Bacteria. British Journal of Pharmacology, 153, S347-S357. https://doi.org/10.1038/sj.bjp.0707607</mixed-citation></ref><ref id="scirp.95799-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization (2014) Antimicrobial Resistance: Global Report on Surveillance.</mixed-citation></ref></ref-list></back></article>