<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OJMM</journal-id><journal-title-group><journal-title>Open Journal of Medical Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3372</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ojmm.2019.93013</article-id><article-id pub-id-type="publisher-id">OJMM-95420</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Medicine&amp;Healthcare</subject></subj-group></article-categories><title-group><article-title>
 
 
  Staphylococcal Cassette Chromosome &lt;i&gt;mec&lt;/i&gt; (SCC&lt;i&gt;mec&lt;/i&gt;) Gene Typing in Detection of Methicillin-Resistant &lt;i&gt;Staphylococcus aureus&lt;/i&gt;: Toward Precise Detection in Health Care Facility
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Rania</surname><given-names>M. Kishk</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mohamed</surname><given-names>F. Mandour</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Rania</surname><given-names>M. Saleh</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Clinical Pathology Department, Faculty of Medicine, Suez Canal University, Ismailia, Egypt</addr-line></aff><aff id="aff1"><addr-line>Microbiology and Immunology Department, Faculty of Medicine, Suez Canal University, Ismailia, Egypt</addr-line></aff><pub-date pub-type="epub"><day>29</day><month>08</month><year>2019</year></pub-date><volume>09</volume><issue>03</issue><fpage>127</fpage><lpage>137</lpage><history><date date-type="received"><day>1,</day>	<month>August</month>	<year>2019</year></date><date date-type="rev-recd"><day>24,</day>	<month>September</month>	<year>2019</year>	</date><date date-type="accepted"><day>27,</day>	<month>September</month>	<year>2019</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Background: Blood stream infections (BSI) are considered key issues in critical care units. Methicillin resistant 
  Staphylococcus aureus, MRSA-related infections, are considered a major health problem. This is attributed to the emerging new society dangerous strains with continuous antibiotics pressure and fluctuations in resistance patterns. 
  Aim: We aimed to study epidemiology of methicillin resistance 
  S. aureus (MRSA) infections by using conventional phenotypic methods [cefoxitin disk diffusion (CDD) and oxacillin screening agar] and molecular typing of the mec-gene (SCCmec) using multiplex PCR in Suez Canal University Hospital. 
  Methods: 100 non-repetitive 
  staphylococcus aureus were collected and identified morphologically and biochemically by standard laboratory procedures. The strains were considered MRSA if the MIC of oxacillin ≥ 4 μg/ml, and the inhibition zone of cefoxitin was ≤21 mm (CDD). Characterization of SCC
  mec elements in isolated MRSA strains was done via multiplex-PCR. 
  Results: From total of 100 isolates, eighty were detected as MRSA by using CDD (sensitivity and specificity were 83.6% and 24.4% respectively) and only 65 by using oxacillin screening agar (sensitivity and specificity were 85.5% and 60% respectively). 
  MecA gene was identified in 55 samples; the majority of isolates were SCC
  mec type IVa (63.7%). Both type I and III of SCC
  mec couldn’t be detected. Antimicrobial sensitivity rates among SCC
  mec-V isolates were expectedly higher than those among Type-II isolates. SCC
  mec type II was characterized by 100% resistant to ciprofloxacin, erythromycin, oxacillin and cefepime as well as greater resistance to clindamycin (70%) with the same pattern between all typing strains (7 strains). 
  Conclusion: SCC
  mec types IVa and V are generally dominant in our community with no detection of SCC
  mec types I or III. PCR is the optimum method for MRSA detection.
 
</p></abstract><kwd-group><kwd>MRSA</kwd><kwd> Blood Stream Infections</kwd><kwd> MecA</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The use of venous catheters would cause infections with significant morbidity and mortality with a tremendously high economic burden [<xref ref-type="bibr" rid="scirp.95420-ref1">1</xref>]. About 80,000 catheter-related bloodstream infections (CRBSIs) were reported annually among patients in critical care units, counting for up to 24,000 deaths with annual cost of 414 million dollars [<xref ref-type="bibr" rid="scirp.95420-ref2">2</xref>]. Central line-associated blood stream infections (CLABSI) are laboratory-confirmed bloodstream infections (LCBI) where a medical catheter was in place for more than two days on the day of event. The calendar date of catheter insertion is counted day one supported by the fact that the line secured in place at the time of the event or the day before [<xref ref-type="bibr" rid="scirp.95420-ref3">3</xref>].</p><p>According to (CDC 2016) recommendations, LCBI was identified if a pathogen was detected in one or more blood specimens and the detected organism is not linked to infections at other places (LCBI-1), or if the patient had one at least of these clinical features; fever (&gt;38.0˚C), hypotension, or chills, with the same commensal identified from at least two blood specimens collected on separate times (LCBI-2) [<xref ref-type="bibr" rid="scirp.95420-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.95420-ref3">3</xref>].</p><p>Still Staphylococcus aureus, coagulase-negative staphylococci, enterococci, and Candida spp. are the most frequently described causative pathogens [<xref ref-type="bibr" rid="scirp.95420-ref4">4</xref>]. Whereas (19% - 21%) of CLABSIs are attributed to Gram-negative bacilli [<xref ref-type="bibr" rid="scirp.95420-ref5">5</xref>]. Antimicrobial resistance is the common problem for all CLABSIs causing microorganisms [<xref ref-type="bibr" rid="scirp.95420-ref6">6</xref>].</p><p>Worldwide, the doubled prevalence rate of MRSA-related infections from 1996-2004 had raised a major public health problem. These strains have a common mobile genetic component (21-to-67 kb) included in their genome, known as the staphylococcal cassette chromosome mec (SCCmec), carrying the methicillin resistance (mecA) gene and other antibiotic resistance determinants [<xref ref-type="bibr" rid="scirp.95420-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.95420-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.95420-ref9">9</xref>]. In addition to the two vital genetic elements (the mec gene complex and the ccr gene complex), a terminal inverted and direct repeats and the junkyard (J) regions are included within SCCmec gene [<xref ref-type="bibr" rid="scirp.95420-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.95420-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.95420-ref12">12</xref>]. mec and ccr complexes have been classified into three classes (A, B, and C) and four allotypes (1, 2, 3, and 5) respectively. SCCmec types are usually composed of diverse grouping of these complex allotypes and classes.</p><p>In 1990s, adult and pediatric patients with no risk factors for acquiring Healthcare-Associated MRSA strains (HA-MRSA) were diagnosed with MRSA infections for the first time. This was defined as Community-Associated MRSA (CA-MRSA) [<xref ref-type="bibr" rid="scirp.95420-ref13">13</xref>]. It included mobile, little SCCmec type IV or V (containing the mecA gene) which can be simply relocated to other S. aureus strains than bigger SCCmec elements (types I, II, and III), converting them to a major cause of significant threat to the public health [<xref ref-type="bibr" rid="scirp.95420-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.95420-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.95420-ref16">16</xref>].</p><p>To identify the molecular epidemiology of MRSA, SCCmec typing protocols using single multiplex PCR reaction have been established to detect types I, II, III, IV, and V based on the nature of the mec and ccr gene complexes, and are additionally classified into IVa and IVd subtypes according to differences in their J region DNA [<xref ref-type="bibr" rid="scirp.95420-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.95420-ref18">18</xref>]. In 2007, Milheiric and his colleagues divided the SCCmec typing system into three stages: ccrB sequencing, SCCmec multiplex PCR and SCCmec IV multiplex PCR for subtyping of SCCmec type IV strains [<xref ref-type="bibr" rid="scirp.95420-ref19">19</xref>]. In 2007, Kondo and his team published another protocol based on five multiplex PCR reactions that couldn’t be realistic for regular practice [<xref ref-type="bibr" rid="scirp.95420-ref20">20</xref>].</p><p>The study aimed to evaluate different detection methods for identifying MRSA. Additionally, we aimed to highlight the molecular epidemiology of MRSA infections in Suez Canal University Hospital.</p></sec><sec id="s2"><title>2. Subjects and Methods</title><sec id="s2_1"><title>2.1. Samples Collection</title><p>A cross-sectional descriptive study was carried out during the period from May 2018 to May 2019 on patients with clinical presentations suggestive of CLABSI in Intensive Care Units (ICUs), Suez Canal University Hospital, Ismailia, Egypt. All age groups were included. Informed consent was taken from each patient to use their data in the current research work. A total of 100 non repetitive staphylococcus aureus were isolated from routine blood cultures, requested for patients admitted to ICUs, in Microbiology Laboratory in Suez Canal University Hospital, Ismailia, Egypt, for different laboratory work.</p></sec><sec id="s2_2"><title>2.2. Isolation and Classification of Staphylococcal Isolates</title><p>Standard laboratory procedures according to morphologic and biochemical reactions were used to identify staphylococci from different isolates. The S. aureus ATCC 25923 was our reference strain. The isolates were preserved in glycerol 15% (v/v) in brain heart infusion broth (BHIB, Oxoid, Basingstoke, UK) at −80˚C and then recovered at the Microbiology Laboratory by subculturing in BHIB at 37˚C for 24 h followed by two further subcultures on brain heart infusion agar [<xref ref-type="bibr" rid="scirp.95420-ref21">21</xref>].</p><p>The sensitivity to antimicrobials was performed using the disk diffusion method on Mueller-Hinton Agar (Oxoid, UK) [<xref ref-type="bibr" rid="scirp.95420-ref22">22</xref>]. The following antibiotics were used to determine the antibiotic susceptibility patterns; penicillin (10 mg), cefoxitin (30 mg), ceftaroline (30 mg), erythromycin (15 mg), amikacin (30 mg), linezolid (30 mg), trimethoprim-sulfamethoxazole (25 mg), minocycline (30 mg), levofloxacin (5 mg), clindamycin (2 mg), tetracycline (10 mg), kanamycin (30 mg), mupirocin (200 mg), gentamicin (10 mg), chloramphenicol (30 mg), Rifampicin (5 mg), and Ciprofloxacin (5 mg) (Oxoid, England).</p></sec><sec id="s2_3"><title>2.3. Identification of Methicillin Resistance</title><p>Methicillin resistance was confirmed for all isolates by the following.</p><sec id="s2_3_1"><title>2.3.1. Minimum Inhibitory Concentration</title><p>Minimum Inhibitory Concentration (MIC) of oxacillin (Sigma St. Louis, Mo, USA) was determined using Cation-Adjusted Muller Hinton Broth (CAMHB) according to CLSI guidelines. An MIC of oxacillin ≥ 4 &#181;g/ml was considered MRSA and ≤2 &#181;g/mL was considered methicillin sensitive S. aureus (MSSA) [<xref ref-type="bibr" rid="scirp.95420-ref22">22</xref>].</p></sec><sec id="s2_3_2"><title>2.3.2. Cefoxitin Disk Diffusion (CDD) Method</title><p>The antibiotic susceptibility was performed using cefoxitin (30 &#181;g) disks (surrogate test for oxacillin) by Kirby-Bauer disk diffusion method as recommended by CLSI 2017. Resistance was reported if the inhibition zone of cefoxitin was ≤21 mm and sensitive if ≥22 mm [<xref ref-type="bibr" rid="scirp.95420-ref22">22</xref>].</p></sec><sec id="s2_3_3"><title>2.3.3. Oxacillin Agar Screening</title><p>Culture on mannitol salt agar containing oxacillin was performed. Media was prepared by adding 11.1 gm of mannitol salt agar base into 100 ml of distilled water and autoclaved. When the autoclaved medium temperature reaches around 50˚C, we added oxacillin as a solution with a final concentration of 6 &#181;g/ml of medium. Any growth in the cultured media was considered as MRSA [<xref ref-type="bibr" rid="scirp.95420-ref22">22</xref>].</p></sec><sec id="s2_3_4"><title>2.3.4. Molecular Typing Using Multiplex-PCR</title><p>Fresh overnight plate cultures of MRSA strains were obtained. Extraction of DNA from bacterial colonies was done using Qiagen DNA Mini kit 51304. mecA gene and SCCmec genotyping were determined for all isolates via a single multiplex PCR as illustrated by Zhang et al. [<xref ref-type="bibr" rid="scirp.95420-ref16">16</xref>]. Multiplex PCR was carried out in a 25 &#181;l total volume using 2 &#181;l volume of DNA template added to 23 &#181;l of PCR buffer containing (50 mM KCl, 20 mM TRis-HCl pH 8.4, 2.5 mM MgCl<sub>2</sub>, 0.2 mM of each dNTPs, various concentrations of each primer were used [<xref ref-type="bibr" rid="scirp.95420-ref16">16</xref>] , and 1.0 unit of Taq polymerase (<xref ref-type="table" rid="table1">Table 1</xref>).</p><p>The optimal cycling conditions using Eppendorf Mastercycler&#174; nexus PCR thermal cycler were: first denaturation step at 94˚C for 5 min, then 10 cycles of 94˚C for 45 sec, 65˚C for 45 sec, and 72˚C for 90 sec. A further 25 cycles of 94˚C for 45 sec, 55˚C for 45 sec, and 72˚C for 2 min terminated by a final extension step at 72˚C for 10 min and followed by a final hold at 4˚C. Inclusion of NTC (Non template control) in each experiment was done.</p><p>PCR products were analyzed using 2.5% agarose gel (Promega, Madison, USA). Syngene G.Box (Syngene, UK) was used to take photos for the stained gel. The SCCmec genotypes were determined according to the amplicon size. DNA ladder (100 bp) was used as a marker.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used in the SCCmec IV multiplex PCR [<xref ref-type="bibr" rid="scirp.95420-ref16">16</xref>]</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >Oligonucleotide sequence (5'-3')</th><th align="center" valign="middle" >Conc (&#181;M)</th><th align="center" valign="middle" >Amplicon size (bp)</th><th align="center" valign="middle" >Specificity</th></tr></thead><tr><td align="center" valign="middle" >Type I-F</td><td align="center" valign="middle" >GCTTTAAAGAGTGTCGTTACAGG</td><td align="center" valign="middle" >0.048</td><td align="center" valign="middle" >613</td><td align="center" valign="middle" >SCCmec I</td></tr><tr><td align="center" valign="middle" >Type I-R</td><td align="center" valign="middle" >GTTCTCTCATAGTATGACGTCC</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Type II-F</td><td align="center" valign="middle" >CGTTGAAGATGATGAAGCG</td><td align="center" valign="middle" >0.032</td><td align="center" valign="middle" >389</td><td align="center" valign="middle" >SCCmec II</td></tr><tr><td align="center" valign="middle" >Type II-R</td><td align="center" valign="middle" >CGAAATCAATGGTTAATGGACC</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Type III-F</td><td align="center" valign="middle" >CCATATTGTGTACGATGCG</td><td align="center" valign="middle" >0.04</td><td align="center" valign="middle" >280</td><td align="center" valign="middle" >SCCmec III</td></tr><tr><td align="center" valign="middle" >Type III-R</td><td align="center" valign="middle" >CCTTAGTTGTCGTAACAGATCG</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Type IVa-F</td><td align="center" valign="middle" >GCCTTATTCGAAGAAACCG</td><td align="center" valign="middle" >0.104</td><td align="center" valign="middle" >776</td><td align="center" valign="middle" >SCCmec IVa</td></tr><tr><td align="center" valign="middle" >Type IVa-R</td><td align="center" valign="middle" >CTACTCTTCTGAAAAGCGTCG</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Type IVb-F</td><td align="center" valign="middle" >TCTGGAATTACTTCAGCTGC</td><td align="center" valign="middle" >0.092</td><td align="center" valign="middle" >493</td><td align="center" valign="middle" >SCCmec IVb</td></tr><tr><td align="center" valign="middle" >Type IVb-R</td><td align="center" valign="middle" >AAACAATATTGCTCTCCCTC</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Type IVc-F</td><td align="center" valign="middle" >ACAATATTTGTATTATCGGAGAGC</td><td align="center" valign="middle" >0.078</td><td align="center" valign="middle" >200</td><td align="center" valign="middle" >SCCmec IVc</td></tr><tr><td align="center" valign="middle" >Type IVc-R</td><td align="center" valign="middle" >TTGGTATGAGGTATTGCTGG</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Type IVd-F</td><td align="center" valign="middle" >CTCAAAATACGGACCCCAATACA</td><td align="center" valign="middle" >0.28</td><td align="center" valign="middle" >881</td><td align="center" valign="middle" >SCCmec IVd</td></tr><tr><td align="center" valign="middle" >Type IVd-R</td><td align="center" valign="middle" >TGCTCCAGTAATTGCTAAAG</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Type V-F</td><td align="center" valign="middle" >GAACATTGTTACTTAAATGAGCG</td><td align="center" valign="middle" >0.6</td><td align="center" valign="middle" >325</td><td align="center" valign="middle" >SCCmec V</td></tr><tr><td align="center" valign="middle" >Type V-R</td><td align="center" valign="middle" >TGAAAGTTGTACCCTTGACACC</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >MecA147-F</td><td align="center" valign="middle" >GTG AAG ATA TAC CAA GTG ATT</td><td align="center" valign="middle" >0.046</td><td align="center" valign="middle" >147</td><td align="center" valign="middle" >mecA</td></tr><tr><td align="center" valign="middle" >MecA147-R</td><td align="center" valign="middle" >ATG CGC TAT AGA TTG AAA GGA T</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap></sec></sec></sec><sec id="s3"><title>3. Results</title><p>The conventional microbiological methods, culture and sensitivity using CDD detected 80 isolates as MRSA (80%). Oxacillin screening agar method (mannitol salt agar with oxacillin) detected 65 isolates as MRSA (65%).</p><p>Multiplex PCR was performed to screen the existence of mecA genes in the entire isolates. mecA gene was identified in 55 isolates out of 100 isolates. Surprisingly, 9 isolates (9%) of PCR positive samples were detected as MSSA by CDD conventional methods and 8 isolates (8%) were detected as MSSA by oxacillin agar screening method.</p><p>Regarding mecA gene PCR negative samples (45 samples), 34 samples (34%) were detected as MRSA by CDD method and 18 isolates (18%) were identified as MRSA using oxacillin agar screening technique.</p><p>The CDD and oxacillin agar screening method results were compared using two-way table analysis. Both methods were evaluated versus PCR. The sensitivity and specificity for CDD method were (83.6% and 24.4%) respectively, with 57% accuracy, 57.5% PPV and 55% NPV. On the other hand, the sensitivity and specificity for oxacillin agar screening method were (85.5% and 60%) respectively, with 74% accuracy, 72.3% PPV and 77.1% NPV.</p><p>Three different SCCmec classes were identified, most of isolates 35/55 (63.7%) were type IVa (amplicon size 776 bp) followed by 13/55 isolates (23.6%) were type V (amplicon size 325 bp), and 7/55 isolates (12.7%) type II (amplicon size 398 bp) as shown in (<xref ref-type="fig" rid="fig1">Figure 1</xref>). Surprisingly, SCCmec types I and III were completely absent.</p>Relation between Antibiotic Resistance and Multiplex PCR<p>SCCmec type II was 100% resistant to erythromycin, ciprofloxacin, oxacillin and cefepime as well as to clindamycin (70%) with the same pattern between all typing strains. SCCmec type IVa isolates illustrated clindamycin resistance (60%) and erythromycin (35%) with 30% of them showed the same antibiotic resistance. Finally, MRSA strains SCCmec type V showed recurrent resistance to aminoglycosides.</p></sec><sec id="s4"><title>4. Discussion</title><p>The emergence of continuous antibiotics pressure and fluctuations in resistance patterns in the novel community acquired MRSA virulent strains resulted in serious blood stream infections in the last two decades [<xref ref-type="bibr" rid="scirp.95420-ref23">23</xref>]. Methicillin resistance in staphylococci is due to the expression of a modified penicillin-binding protein (PBP), PBP 2a encoded by the mecA gene that is located on the staphylococcal cassette chromosome mec (SCCmec) [<xref ref-type="bibr" rid="scirp.95420-ref10">10</xref>].</p><p>Our study utilized two recommended standard tests to screen for MRSA, Cefoxitin disk diffusion (CDD) and oxacillin agar screening. The sensitivities of these 2 tests to detect MRSA as compared to Polymerase Chain Reaction in detecting of mecA gene were 83.6% and 85.5% respectively. The sensitivity of 83.6% of CDD means that the test can detect only 83 cases out of 100 as true positive and 17 cases will be misdiagnosed. This may affect the treatment decision, strategy, cost and hospital stay.</p><p>The specificity of oxacillin agar screening methods was higher than of CDD (60% and 24.4% respectively) but both were below 90%, which can’t be accepted as a standard method for diagnosis MRSA cases especially with low accuracy of both tests (57% for CDD and 47% for oxacillin agar screening). Our findings were similar to Pillai et al. [<xref ref-type="bibr" rid="scirp.95420-ref24">24</xref>] which reported that the sensitivity and specificity of oxacillin disk diffusion (ODD) test were (93.5%, 83.5%) respectively, whereas that of oxacillin agar screening was found to be (87.1%, 89.3%) respectively. Cauwelier et al., mentioned that the sensitivities of both oxacillin disk diffusion method and agar screening method are 83.5% and 91.7% respectively, and both were 100% specific compared with PCR for mecA detection [<xref ref-type="bibr" rid="scirp.95420-ref25">25</xref>].</p><p>In our study, only 55 isolates were confirmed MRSA strains by means of PCR detecting mecA gene. Surprisingly, out of mecA PCR positive isolates, only 9 isolates were diagnosed as MSSA by CDD and 8 isolates were diagnosed as MSSA by oxacillin agar screening phenotypically. This may attributed to the fact that conventional tests are subjective tests depend on many factors as incubation time, PH and salt concentration of the culture medium and finally the inoculum</p><p>size [<xref ref-type="bibr" rid="scirp.95420-ref26">26</xref>]. Out of 45 isolates detected as MSSA by mecA PCR, only 11 isolates were detected as MSSA by CDD method and only 27 isolates were detected as MSSA by oxacillin agar screening. These false positive strains by conventional methods may be due to the heterogenous phenotypes of methicillin resistance in staphylococcus species “moderately resistant S. aureus” (MODSA). It might not be easy to differentiate MODSA from true MRSA strains carrying mecA gene owing to their overproduction of penicillinase (penicillinase hyper producers) [<xref ref-type="bibr" rid="scirp.95420-ref27">27</xref>] [<xref ref-type="bibr" rid="scirp.95420-ref28">28</xref>].</p><p>Despite that types I, II and III of the SCCmec are the highest prevalent HA-MRSA strains in western countries as Europe, Switzerland and USA [<xref ref-type="bibr" rid="scirp.95420-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.95420-ref30">30</xref>]. These strains were either undetected (type I and III) or sparsely detected (12.7%; type II) in our work.</p><p>We noticed the general dominance of MRSA strains carrying SCCmec types IVa and V (63.7% and 23.6% respectively). This data was matched with a study from Switzerland in 2010 [<xref ref-type="bibr" rid="scirp.95420-ref31">31</xref>] which reported the absence of type III and presence of types I and II in very low proportions (10%). In healthcare-associated infections, some studies reported 87% isolation rates of SCCmec types IV and V, others reported comparable distribution of SCCmec-IV and SCCmec-II/III types among the MRSA isolates [<xref ref-type="bibr" rid="scirp.95420-ref32">32</xref>] [<xref ref-type="bibr" rid="scirp.95420-ref33">33</xref>]. Fatholahzadeh and his colleagues reported 98% isolation rates of SCCmec type III or IIIA and only 2% for SCCmec type IV, but didn’t isolate both types I and II [<xref ref-type="bibr" rid="scirp.95420-ref34">34</xref>]. These results are alike most Asian studies [<xref ref-type="bibr" rid="scirp.95420-ref35">35</xref>].</p><p>We couldn’t identify MRSA isolates of the SCCmec types I or III, probably due to the limited number of isolates analysed. To our knowledge, we are the first study describing the SCCmec typing in our hospital with such high prevalence of SCCmec types IV and V.</p><p>Antimicrobial sensitivity rates among SCCmec-V isolates were expectedly higher than those among Type-II isolates. However, SCCmec type II was 100% resistant to ciprofloxacin, erythromycin, oxacillin and cefepime as well as greater resistance to clindamycin (70%). This was matched by Davis and his group who pointed the superior antibiotics sensitivity pattern among Type IV isolates compared to Types-II/III isolates [<xref ref-type="bibr" rid="scirp.95420-ref32">32</xref>].</p><p>In this study, the majority of cases (63.7%) were carrying SCCmec-IV and all were of the subtype SCCmec-Iva. The resistance was mainly to clindamycin (60%) and erythromycin (35%). In 2008, Fatholahzadeh reported resistance most of SCCmec types III and IIIA to, erythromycin, azithromycin, kanamycin, ciprofloxacin, cotrimoxazole gentamicin, netilmicin, ofloxacin, and tetracycline [<xref ref-type="bibr" rid="scirp.95420-ref35">35</xref>].</p><p>This study has many limitations because MRSA surveillance cultures are not routinely performed, so it was difficult to track the source and starting time of MRSA acquirement. We also need more studies to recognize the risk factors for the acquisition of blood stream infections (BSI) as it is essential to follow up the performance of infection control preventive measures. Similarly, to our knowledge, no available data are published until now characterizing molecular, clinical and epidemiological basis for CA-MRSA colonization and infection. Additional prospective epidemiological work is required to assess the level of CA-MRSA strains in healthcare facilities.</p></sec><sec id="s5"><title>5. Conclusion</title><p>In conclusion, SCCmec types IVa and V are generally dominant in our community with no detection of SCCmec types I or III. Antimicrobial sensitivity rates among SCCmec-V isolates were expectedly higher than those among Type-II isolates. PCR is the optimum method to be used in detecting these serious infections and preferred over the usual standard methods. PCR can pick up the wrong negative results in addition to the sensitivity, specificity, accuracy and the rapid diagnosis of MRSA strains as the detection of mecA gene can last for only 5 h from the bacterial isolation. Hence, the conventional methods are not reliable for detecting MRSA strains especially in seriously ill-patients.</p></sec><sec id="s6"><title>Ethical Considerations</title><p>The study was approved by the medical ethics committee of our institute in agreement with the 1964 Helsinki declaration and its later modification.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>Authors declare no conflicts of interests.</p></sec><sec id="s8"><title>Cite this paper</title><p>Kishk, R.M., Mandour, M.F. and Saleh, R.M. (2019) Staphylococcal Cassette Chromosome mec (SCCmec) Gene Typing in Detection of Methicillin-Resistant Staphylococcus aureus: Toward Precise Detection in Health Care Facility. Open Journal of Medical Microbiology, 9, 127-137. https://doi.org/10.4236/ojmm.2019.93013</p></sec></body><back><ref-list><title>References</title><ref id="scirp.95420-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Mermel, L.A. (2000) Prevention of Intravascular Catheter-Related Infections. Annals of Internal Medicine, 132, 391.</mixed-citation></ref><ref id="scirp.95420-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Centers for Disease Control and Prevention (CDC) (2011) Vital Signs: Central Line-Associated Blood Stream Infections-United States, 2001, 2008, and 2009. 2011. Morbidity and Mortality Weekly Report, 60, 243-248. http://www.cdc.gov/HAI/bsi/bsi.html</mixed-citation></ref><ref id="scirp.95420-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Wisplinghoff, H., Bischoff, T., Tallent, S.M., Seifert, H., Wenzel, R.P. and Edmond, M.B. (2004) Nosocomial Blood-stream Infections in US Hospitals: Analysis of 24,179 Cases from a Prospective Nationwide Surveillance Study. Clinical Infectious Diseases, 39, 309-317. https://doi.org/10.1086/421946</mixed-citation></ref><ref id="scirp.95420-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Gaynes, R. and Edwards, J.R. (2005) National Nosocomial Infections Surveillance System. Overview of Nosocomial Infections Caused by Gram-Negative Bacilli. Clinical Infectious Diseases, 41, 848-854. https://doi.org/10.1086/432803</mixed-citation></ref><ref id="scirp.95420-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Calfee, D.P., Durbin, L.J., Germanson, T.P., Toney, D.M., Smith, E.B. and Farr, B.M. (2003) Spread of Methicillin-Resistant Staphylococcus aureus (MRSA) among Household Contacts of Individuals with Nosocomially Acquired MRSA. Infection Control &amp; Hospital Epidemiology, 24, 422-426. https://doi.org/10.1086/502225</mixed-citation></ref><ref id="scirp.95420-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Enright, M.C., Robinson, D.A., Randle, G., Feil, E.J., Grundmann, H. and Spratt, B.G. (2002) The Evolutionary History of Methicillin-Resistant Staphylococcus aureus (MRSA). Proceedings of the National Academy of Sciences of the United States of America, 99, 7687-7692. https://doi.org/10.1073/pnas.122108599</mixed-citation></ref><ref id="scirp.95420-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Fluit, A.C., Verhoef, J. and Schmitz, F.J. (2001) European SENTRY Participants. Frequency of Isolation and Antimicrobial Resistance of Gram-Negative and Gram-Positive Bacteria from Patients in Intensive Care Units of 25 European University Hospitals Participating in the European Arm of the Sentry Antimicrobial Surveillance Program 1997-1998. European Journal of Clinical Microbiology &amp; Infectious Diseases, 20, 617-625.</mixed-citation></ref><ref id="scirp.95420-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Hussain, Z., Stoakes, L., Massey, V., Diagre, D., Fitzgerald, V., El Sayed, S. and Lannigan, R. (2000) Correlation of Oxacillin MIC with mecA Gene Carriage in Coagulase-Negative Staphylococci. Journal of Clinical Microbiology, 38, 752-754.</mixed-citation></ref><ref id="scirp.95420-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Ito, T., Katayama, Y., Asada, K., Mori, N., Tsutsumimoto, K., Tiensasitorn, C. and Hiramatsu, K. (2001) Structural Comparison of Three Types of Staphylococcal Cassette Chromosome mec Integrated in the Chromosome in Methicillin-Resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy, 45, 1323-1336. https://doi.org/10.1128/AAC.45.5.1323-1336.2001</mixed-citation></ref><ref id="scirp.95420-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Ito, T., Ma, X.X., Takeuchi, F., Okuma, K., Yuzawa, H. and Hiramatsu, K. (2004) Novel Type V Staphylococcal Cassette Chromosome mec Driven by a Novel Cassette Chromosome Recombinase, ccrC. Antimicrob. Antimicrobial Agents and Chemotherapy, 48, 2637-2651. https://doi.org/10.1128/AAC.48.7.2637-2651.2004</mixed-citation></ref><ref id="scirp.95420-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Ma, X.X., Ito, T., Tiensasitorn, C., Jamklang, M., Chongtrakool, P., Boyle-Vavra, S., Daum, R.S. and Hiramatsu, K. (2002) Novel Type of Staphylococcal Cassette Chromosome mec Identified in Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains. Antimicrobial Agents and Chemotherapy, 46, 1147-1152. https://doi.org/10.1128/AAC.46.4.1147-1152.2002</mixed-citation></ref><ref id="scirp.95420-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Herold, B.C., Immergluck, L.C., Maranan, M.C., Lauderdale, D.S., Gaskin, R.E., Boyle-Vavra, S., Leitch, C.D. and Daum, R.S. (1998) Community-Acquired Methicillin-Resistant Staphylococcus aureus in Children with No Identified Predisposing Risk. The Journal of the American Medical Association, 279, 593-598.</mixed-citation></ref><ref id="scirp.95420-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Lindsay, J.A. and Holden, M.T. (2004) Staphylococcus aureus: Superbug, Super Genome? Trends in Microbiology, 12, 378-385. https://doi.org/10.1016/j.tim.2004.06.004</mixed-citation></ref><ref id="scirp.95420-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Vandenesch, F., Naimi, T., Enright, M.C., Lina, G., Nimmo, G.R., Heffernan, H., Liassine, N., Bes, M., Greenland, T., Reverdy, M.E. and Etienne, J. (2003) Community-Acquired Methicillin-Resistant Staphylococcus aureus Carrying Panton-Valentine Leukocidin Genes: Worldwide Emergence. Emerging Infectious Diseases, 9, 978-984. https://doi.org/10.3201/eid0908.030089</mixed-citation></ref><ref id="scirp.95420-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">O’Brien, F.G., Lim, T.T., Chong, F.N., Coombs, G.W., Enright, M.C., Robinson, D.A., Monk, A., Sa&amp;iuml;d-Salim, B., Kreiswirth, B.N. and Grubb, W.B. (2004) Diversity among Community Isolates of Methicillin-Resistant Staphylococcus aureus in Australia. Journal of Clinical Microbiology, 42, 3185-3190. https://doi.org/10.1128/JCM.42.7.3185-3190.2004</mixed-citation></ref><ref id="scirp.95420-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, K., McClure, J.A., Elsayed, S., Louie, T. and Conly, J.M. (2005) Novel Multiplex PCR Assay for Characterization and Concomitant Subtyping of Staphylococcal Cassette Chromosome mec Types I to V in Methicillin-Resistant Staphylococcus aureus. Journal of Clinical Microbiology, 43, 5026-5033. https://doi.org/10.1128/JCM.43.10.5026-5033.2005</mixed-citation></ref><ref id="scirp.95420-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Naimi, T.S., LeDell, K.H., Como-Sabetti, K., Borchardt, S.M., Boxrud, D.J., Etienne, J., Johnson, S.K., Vandenesch, F., Fridkin, S., O’Boyle, C., Danila, R.N. and Lynfield, R. (2003) Comparison of Community-and Health Care-Associated Methicillin-Resistant Staphylococcus aureus Infection. The Journal of the American Medical Association, 290, 2976-2984. https://doi.org/10.1001/jama.290.22.2976</mixed-citation></ref><ref id="scirp.95420-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Milheirio, C., Oliveira, D.C. and de Lencastre, H. (2007) Multiplex PCR Strategy for Subtyping the Staphylococcal Cassette Chromosome mec Type IV in Methicillin-Resistant Staphylococcus aureus: “SCCmec IV Multiplex.” Journal of Antimicrobial Chemotherapy, 60, 42-48. https://doi.org/10.1093/jac/dkm112</mixed-citation></ref><ref id="scirp.95420-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Kondo, Y., Ito, T., Ma, X.X., Watanabe, S., Kreiswirth, B.N., Etienne, J. and Hiramatsu, K. (2007) Combination of Multiplex PCRs for Staphylococcal Cassette Chromosome mec Type Assignment: Rapid Identification System for mec, ccr, and Major Differences in Junkyard Regions. Antimicrobial Agents and Chemotherapy, 51, 264-274. https://doi.org/10.1128/AAC.00165-06</mixed-citation></ref><ref id="scirp.95420-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Murray, P.R. (2007) Manual of Clinical Microbiology. 8th Edition, American Society for Microbiology Press, Washington DC.</mixed-citation></ref><ref id="scirp.95420-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Clinical and Laboratory Standards Institute (2017) Performance Standards for Antimicrobial Disk Susceptibility Test: Twenty-Fifth Informational Supplement. Committee for Clinical Laboratory Standards, Wayne, PA, 236 p.</mixed-citation></ref><ref id="scirp.95420-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">McClure, J.A., Conly, J.M. and Zhang, K. (2013) Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome mec Types I to V in Methicillin-Resistant Staphylococcus aureus. Journal of Visualized Experiments, 2013, e50779.</mixed-citation></ref><ref id="scirp.95420-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Fowler Jr., V.G., Sakoulas, G., McIntyre, L.M., Meka, V.G., Arbeit, R.D., Cabell, C.H., Stryjewski, M.E., Eliopoulos, G.M., Reller, L.B., Corey, G.R., Jones, T., Lucindo, N., Yeaman, M.R. and Bayer, A.S. (2004) Persistent Bacteremia due to Methicillin-Resistant Staphylococcus aureus Infection Is Associated with agr Dysfunction and Low-Level in Vitro Resistance to Thrombin-Induced Platelet Microbicidal Protein. The Journal of Infectious Diseases, 190, 1140-1149. https://doi.org/10.1086/423145</mixed-citation></ref><ref id="scirp.95420-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Pillai, G.M., Latha, R. and Sarkar, G. (2012) Detection of Methicillin Resistance in Staphylococcus Aureus by Polymerase Chain Reaction and Conventional Methods: A Comparative Study. Journal of Laboratory Physicians, 4, 83-88.https://doi.org/10.4103/0974-2727.105587</mixed-citation></ref><ref id="scirp.95420-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Cauwelier, B., Gordts, B., Descheemaecker, P. and Van Landuyt, H. (2004) Evaluation of a Disk Diffusion Method with Cefoxitin (30 microg) for Detection of Methicillin-Resistant Staphylococcus aureus. European Journal of Clinical Microbiology and Infectious Diseases, 23, 389-392. https://doi.org/10.1007/s10096-004-1130-8</mixed-citation></ref><ref id="scirp.95420-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Menon, P.K. and Nagendra, A. (2001) Comparison of Rapid Method of DNA Extraction Using Microwave Irradiation with Conventional Phenol Chloroform Technique for Use in Multiplex PCR for mecA and femB Genes. Medical Journal Armed Forces India, 57, 194-196. https://doi.org/10.1016/S0377-1237(01)80041-1</mixed-citation></ref><ref id="scirp.95420-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Fluit, A.C., Wielders, C.L., Verhoef, J. and Schmitz, F.J. (2001) Epidemiology and Susceptibility of 3,051 Staphylococcus aureus Isolates from 25 University Hospitals Participating in the European SENTRY Study. Journal of Clinical Microbiology, 39, 3727-3732. https://doi.org/10.1128/JCM.39.10.3727-3732.2001</mixed-citation></ref><ref id="scirp.95420-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Mohanasoundaram, K.M. and Lalitha, M.K. (2008) Comparison of Phenotypic Versus Genotypic Methods in the Detection of Methicillin Resistance in Staphylococcus aureus. Indian Journal of Medical Research, 127, 78-84.</mixed-citation></ref><ref id="scirp.95420-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Davies, T.A., Shang, W., Amsler, K.M., Bajaksouzian, S., Jacobs, M.R. and Bush, K. (2009) Molecular Characterisation of Meticillin-Resistant Staphylococcus aureus Isolates from Two Ceftobiprole Phase 3 Complicated Skin and Skin-Structure Infection Clinical Trials. International Journal of Antimicrobial Agents, 34, 166-168. https://doi.org/10.1016/j.ijantimicag.2009.02.013</mixed-citation></ref><ref id="scirp.95420-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Strandén, A.M., Frei, R., Adler, H., Fl&amp;uuml;ckiger, U. and Widmer, A.F. (2009) Emergence of SCCmec Type IV as the Most Common Type of Methicillin-Resistant Staphylococcus aureus in a University Hospital. Infection, 37, 44-48. https://doi.org/10.1007/s15010-008-7430-7</mixed-citation></ref><ref id="scirp.95420-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Valsesia, G., Rossi, M., Bertschy, S. and Pfyffer, G.E. (2010) Emergence of SCCmec Type IV and SCCmec Type V Methicillin-Resistant Staphylococcus aureus Containing the Panton-Valentine Leukocidin Genes in a Large Academic Teaching Hospital in Central Switzerland: External Invaders or Persisting Circulators? Journal of Clinical Microbiology, 48, 720-727. https://doi.org/10.1128/JCM.01890-09</mixed-citation></ref><ref id="scirp.95420-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Davis, S.L., Rybak, M.J., Amjad, M., Kaatz, G.W. and McKinnon, P.S. (2006) Characteristics of Patients with Healthcare-Associated Infection due to SCCmec Type IVmethicillin-Resistant Staphylococcus aureus. Infection Control &amp; Hospital Epidemiology, 27, 1025-1031. https://doi.org/10.1086/507918</mixed-citation></ref><ref id="scirp.95420-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Aires de Sousa, M., Cris&amp;oacute;stomo, M.I., Sanches, I.S., Wu, J.S., Fuzhong, J., Tomasz, A. and de Lencastre, H. (2003) Frequent Recovery of a Single Clonal Type of Multidrug-Resistant Staphylococcus aureus from Patients in Two Hospitals in Taiwan and China. Journal of Clinical Microbiology, 41, 159-163.https://doi.org/10.1128/JCM.41.1.159-163.2003</mixed-citation></ref><ref id="scirp.95420-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Fatholahzadeh, B., Emaneini, M., Gilbert, G., Udo, E., Aligholi, M. and Modarressi, M.H. (2008) Staphylococcal Cassette Chromosome mec (SCCmec) Analysis and Antimicrobial Susceptibility Patterns of Methicillin-Resistant Staphylococcus aureus (MRSA) Isolates in Tehran, Iran. Microbial Drug Resistance, 14, 217-220. https://doi.org/10.1089/mdr.2008.0822</mixed-citation></ref><ref id="scirp.95420-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Arakere, G., Nadig, S., Swedberg, G., Macaden, R., Amarnath, S.K. and Raghunath, D. (2005) Genotyping of Methicillin-Resistant Staphylococcus aureus Strains from Two Hospitals in Bangalore, South India. Journal of Clinical Microbiology, 43, 3198-3202. https://doi.org/10.1128/JCM.43.7.3198-3202.2005</mixed-citation></ref></ref-list></back></article>