OJVMOpen Journal of Veterinary Medicine2165-3356Scientific Research Publishing10.4236/ojvm.2019.95005OJVM-93074ArticlesMedicine&Healthcare Diagnosis of Bovine Tuberculosis by Comparative Intradermal Tuberculin Test, Interferon Gamma Assay and <i>esxB</i> (CFP-10) PCR in Blood and Lymph Node Aspirates DerhasarBrahma1DeeptiNarang2*MuditChandra2GursimranFilia3AmarjitSingh4SikhTejinder Singh5Department of Veterinary Microbiology, College of Veterinary Science, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab, IndiaAnimal Disease Research Centre, College of Veterinary Science, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab, IndiaDepartment of Veterinary Pathology, College of Veterinary Science, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab, IndiaDirectorate Livestock Farm, College of Veterinary Science, Guru Angad Dev Veterinary and Animal Sciences University,Ludhiana, Punjab, IndiaDepartment of Veterinary Microbiology, College of Veterinary Science,Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab, India17062019090555652, April 201928, May 2019 31, May 2019© Copyright 2014 by authors and Scientific Research Publishing Inc. 2014This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/

Bovine tuberculosis (TB) is a chronic debilitating disease of huge economic importance due to loss in production, morbidity and mortality, and has a potential zoonotic threat. TB is endemic in India and has a worldwide prevalence, therefore, needing early diagnostic technique for the eradication of TB globally. Currently, compared to the eradication programme of TB in Medical sector, Veterinary sector is lagging behind though TB is one of the major zoonotic diseases prevalent in dairy animals and wildlife in India. With the “End TB” strategy by WHO in human, parallel measures for early diagnosis and culling has to be followed in case of animals for an overall successful eradication programme. The objective of this study is diagnosis of TB in cattle and buffaloes by using the cell-mediated immune response tests, i.e. Comparative Intradermal Tuberculin Test (CITT) and Interferon gamma (IFN- γ) assay, and Polymerase Chain Reaction (PCR) targeting esxB gene (CFP-10 protein) and to compare their diagnostic capabilities. This study was carried out in 202 dairy cattle and buffaloes from an organized dairy farm, where almost all of the animals appeared clinically healthy. We found that, the combined use of both CITT and IFN- γ assay lead to more accurate diagnosis of TB, although IFN- γ assay was more specific than CITT. However, esxB PCR showed almost similar sensitivity to IFN- γ assay and may be used as a fast alternative method for the diagnosis of bovine TB from blood samples.

Bovine TB CITT IFN-<i>γ</i> <i>esxB</i> PCR1. Introduction

TB caused by Mycobacterium tuberculosis complex (MTC) comprising of M. bovis, M. caprae and M. tuberculosis; is a major infectious and chronic wasting disease, having a zoonotic potential and a worldwide distribution [1]. TB in milch animals is mainly caused by M. bovis [2]. Since 2015, the World Health Organization (WHO) has adopted a new strategy for TB prevention, care and control—The End TB Strategy—with its targets to end the Global TB epidemic by reduction in the incidence rate and death rate of the disease by 90% and 95% respectively in 20 years (2015-2035) compared with level to 2015 by means of improved diagnostics, prevention and control measures [3].

Diagnosis of TB in the early stage is very important for effective prevention and control of the disease. Conventional diagnostic methods like culture and microscopy, though considered as gold standard, is time consuming and requires more than 3 weeks for the visible growth of MTC colony [4] , besides, symptoms of TB mostly appears in late or advanced phage of the disease. Therefore, ante-mortem tests of cellular immune response (Tuberculin test and Interferon gamma Assay) and molecular diagnosis is required for the early diagnosis of the disease [2] [5]. Serological test like indirect ELISA can also be used complementarily for screening of anti-TB antibody in a herd [6].

Molecular diagnosis of TB using esxB (CFP-10) PCR targeting esxB gene present in the RD1 region of the pathogenic Mycobacterial species, is a fast diagnostic tool having higher sensitivity and specificity [7]. Therefore, the present study was aimed at comparative diagnosis of bovine TB in cattle and buffaloes using cell-mediated immune response tests viz. CITT and IFN-γ assay; and molecular diagnosis using esxB gene PCR targeting CFP-10 protein.

2. Materials and Methods2.1. Selection of Animals and Collection of Blood and Lymph Node Aspirate Samples

A total of 202 female milch animals (42 HF-cross cows and 160 Murrah and Nili Ravi buffaloes) from 2 years and above were selected randomly from an organized dairy farm in Ludhiana, Punjab. CITT was performed on all the animals and then blood samples were collected for IFN-γ assay and esxB PCR. Lymph node aspirates (n = 15) from the TB reactor animals (positive by either of the two tests viz. CITT or IFN-γ assay) were also collected.

In fact, the sampling size was done irrespective of any criteria of selection and the reason for choosing only female animals for this study was because of the availability of females in large numbers and taking into consideration that female animals are more important in transmission of the causative organism through milk.

2.2. Time and Place of Work

The present study was carried out during the year 2015-2016, at Department of Microbiology, COVS, GADVASU, Ludhiana, Punjab, India.

2.3. Variables

In this study, the variables to be tested/compared are CITT and IFN-γ assay for cell-mediated immune response and esxB PCR for molecular diagnosis of TB in cattle and buffaloes.

2.4. Comparative Intradermal Tuberculin Test (CITT)

The selected animals were subjected to CITT, as per OIE [2]. Bovine tuberculin PPD from culture of M. bovis (strain AN5, 3000 IU) and avian tuberculin PPD from culture of M. avium subspecies avium (strain D4ER, 2500 IU), obtained from Prionics (Netherlands), were used for CITT. Two 2 × 2 square inch areas were shaved at the middle third of left side of neck approximately 12 - 15 cm apart. The zero hour skin thickness was measured with the help of a vernier caliper. The bovine and the avian tuberculin PPD (0.1 ml each) were injected intra-dermally; the bovine PPD being injected in the caudal shaved area. The correction of the injection was confirmed by palpation of a small pea-like swelling at the site. Inflammatory responses were recorded 72 hours post injection. The observations were made on the basis of hot, pain and swelling at the site of injection. Animals were considered positive if the increase in skin thickness at the bovine site of injection was more than 4 mm greater than the reaction shown at the site of the avian injection. The reaction was recorded as negative, if no or ≤1 mm difference in the increase in skinfold thickness was observed. Difference between 1 - 4 mm was considered as doubtful.

2.5. Bovine Interferon Gamma (IFN-γ) Assay

This test was performed using M. bovis Gamma Interferon Assay Kit for Cattle (BOVIGAM, Prionics, Switzerland). BOVIGAM is a rapid in-vitro blood based assay of cell-mediated immune response to M. bovis purified protein derivative (PPD). A minimum volume of 5 ml of blood from jugular veins of each animal was collected in commercially available sterile 10 ml heparinized tubes. Three 1.5 ml aliquots of heparinized blood from each animal were dispensed into wells of 24-well tissue culture plate, to which 100 µl each of PBS as nil antigen control (pH-7.2), avian and bovine PPD (Prionics, Netherlands) were added aseptically into the wells containing heparinized blood. The antigens were mixed thoroughly into the aliquoted blood and then incubated in a humidified atmosphere for 16 - 24 hours at 37˚C. The plasma was then collected and assayed for IFN-γ production in duplicate. Optical densities were measured on an ELISA plate reader (Multiskan, MTX Lab Systems, Inc., USA) at 450 nm filter with a 620 nm reference filter. Animal was considered positive when mean OD of bovine PPD minus mean OD of avian PPD and mean OD of bovine PPD minus mean OD of nil antigen was ≥0.1. Animal was considered negative when mean OD of bovine PPD minus mean OD of avian PPD and mean OD of bovine PPD minus mean OD of nil antigen was <0.1.

2.6. DNA Extraction

Initially, buffy coat was obtained from 1 ml of whole blood samples by centrifugation at 10,000 rpm for 10 min. The buffy coat and lymph node aspirates were subjected to DNA extraction using QIAamp DNA blood mini kit (Qiagen). DNA was stored in −20˚C till further use.

2.7. esxB (CFP-10) PCR

PCR targeting esxB gene (Rv3875) present on RD1 region of MTC encoding CFP-10 protein was done for confirmation of TB. The sequences of esxB primer pair were: Forward 5’ATGGCAGAGATGAAGACCGATGCCGCT3’ and Reverse-5’TCAGAAGCCCATTTGCGAGGACAGCGCC3’ with an expected band size of 302 bp [7]. PCR conditions were performed as per Brahma et al. [8]. Briefly, a ready to use GoTaq® Green Master Mix, 2X (Promega) was used. A reaction volume of 25 µl was made containing 12.5 µl of GoTaq® Green Master mix, 1 µl of forward primer (10 pmol/μl), 1 µl of reverse primer (10 pmol/μl), 2.5 µl of nuclease free water and 8 µl of DNA template. Along with sample DNA, a known positive control DNA from M. tuberculosis culture (IMTECH, Chandigarh) was also amplified. Thermal cycling was performed in research thermal cycler (Eppendorf, Germany) with initial denaturation of 10 min at 95˚C for 1 cycle, denaturation, annealing and extension at 95˚C, 63˚C and 72˚C respectively for 45 sec for 40 cycles and final extension at 72˚C for 10 min for 1 cycle. PCR products were run by 1.5% agarose gel electrophoresis and visualized in gel-documentation system (Alpha Innotech, San Leandro, CA). The sensitivity of esxB (CFP-10) primers were assessed in ten-fold serial dilution of the known concentration (8 ng/μl) of the standard genomic DNA of M. tuberculosis and specificity of esxB primers were tested against other non-tuberculous mycobacterial species [M. avium, M. kansasii, M. fortuitum and M. smegmatis (Microbiologics)] and non-mycobacterial species (B. abortus, P. multocida and E. coli).

2.8. Statistical Analysis

The proportions of the animals that were positive by either CITT or IFN-γ assay were calculated. Kappa test was applied to compare the degree of agreement between the two tests at 95% level of significance.

3. Results3.1. CITT and IFN-γ Assay

In this study, out of total 202 animals screened for TB, 40 animals (19.80%) were found to be positive by CITT (18 cattle and 22 buffaloes). Out of these only 30 animals (13 cattle and 17 buffaloes) showed an exclusively positive reaction to CITT by showing an increase in the thickness > 4 mm and a negative response to IFN-γ.

The numbers of animals positive by IFN-γ assay were 17 (7 cattle and 10 buffaloes), out of which only 7 animals (2 cattle and 5 buffaloes) showed an exclusively positive reaction to IFN-γ and a negative response to CITT. However, out of all animals, only 10 showed a positive response to both CITT and IFN-γ assay.

Based on the results of CITT and IFN-γ assay, the animals were divided into four groups, as given in Table 1. Group 4 was considered as the control group for further comparison of various observations. Considering the results of TB positive animals by either one or both the tests, the incidence of TB recorded in cattle (47.62%) was almost three times more than that of buffaloes (16.88%).

3.2. esxB (CFP-10) Gene PCR

The detection limit of the esxB (CFP-10) PCR was upto 8 pg/μl of pure culture M. tuberculosis DNA. None of the organisms other than M. tuberculosis showed amplification which clearly indicates the specificity of esxB gene only for the pathogenic Mycobacterial species viz. M. tuberculosis and M. bovis.

Overall, 13 (6.44%) out of 202 animals were found to be positive for TB by esxB (CFP-10) gene PCR. (Figure 1) in blood samples, where 10 of 13 were positive by both CITT and IFN-γ assay in common and the rest 3 of 13 were IFN-γ positive but CITT negative. In contrast, esxB PCR from the lymph node aspirates of 15 animals revealed only 1 animal to be positive for TB.

3.3. Statistical Analysis

The proportions of the animals that were positive by either CITT or IFN-γ assay are given in Table 2. At 95% level of significance, kappa value between CITT and IFN-γ assay was 0.264, indicating a fair degree of agreement between the two tests.

Grouping of cattle and buffaloes based on the results of CITT and IFN-γ Assay
Group No.CriteriaNumber of Cattle (%)Number of Buffaloes (%)Total no. of cattle and buffaloes (%)
Group 1Animals tested positive for TB by both the tests i.e. CITT and IFN-γ Assay5 (11.90%)5 (3.13%)10 (4.95%)
Group 2Animals tested positive for TB by CITT but tested negative by IFN-γ Assay13 (30.95%)17 (10.63%)30 (14.85%)
Group 3Animals tested negative for TB by CITT but tested positive by IFN-γ Assay2 (4.76%)5 (3.13%)7 (3.47%)
Group 4Animals tested negative by both CITT and IFN-γ Assay22 (52.38%)133 (83.13%)155 (76.73%)
Total TB positive AnimalsNumber of animals tested TB positive with one or both the tests20 (47.62%)27 (16.88%)47 (23.27%)
 Proportions of animals positive or negative by CITT and INF-γ Assay
Intra-dermal Test ResultNo. of Animals with IFN-γ +veNo. of Animals with IFN-γ −veTotal No. of Animals
CITT +ve103040
CITT −ve7155162
Total17185202
4. Discussions

In this study, the incidence of TB recorded in cattle (47.62%) either by one or both the tests were almost three times more than that of buffaloes (16.88%). Probably the cattle which were mostly HF-cross may be more susceptible to the disease due to production and environmental stress, compared to the local indigenous buffaloes, similar findings have also been reported by Das et al. [9] After all, the overall prevalence rate of TB in the farm was 23.27%, which is higher than the overall prevalence rate of TB in the state (Punjab) i.e. 5.38% [10]. However, based on a random-effects meta-regression model analysis, Srinivasan et al. [11] , revealed a pooled prevalence estimate of 7.3% indicating that there may be an estimated 21.8 million infected cattle in India.

Numerous studies have been carried out in the last decades to evaluate sensitivity and specificity of the intradermal test and IFN-γ assay in cattle under different epidemiological situations using different antigens [12] [13] [14]. Since both the tests measure the cell-mediated T-cell response, there is to be expected a considerable overlap (~80%) between the animals that respond to these tests [15]. In our study, no significant difference has been observed between the sensitivity and specificity of CITT and IFN-γ assay, similar to the findings by Ameni et al. [16]. However, the sensitivity of the IFN-γ assay was less than the CITT whereas specificity of IFN-γ assay was greater than the CITT in our study. The IFN-γ assay has a sensitivity of 84% that is comparable to, but lower than, the observed sensitivity of the CITT (90%), whereas, the specificity of the IFN-γ assay (97%) is lower than that of the CITT (99.9%) [15]. When used in parallel with i.e. at the same time as the tuberculin test, the combined tests give a sensitivity of over 90% - 95% [5] [15] [17] [18] , which is also supported by the findings in our study as well as Ahir et al. [19]

The probable reason of our findings, that is, 30 CITT positive animals testing negative for IFN-γ assay may be due to co-infection of the animals with an environmental mycobacterium or anergic situation of infected animals, as recorded by other workers [13] [20]. In contrast, 7 CITT negative animals which were tested positive by IFN-γ assay suggested that these animals might be in the early stage of the disease that couldn’t be determined by CITT, as the same has been recorded by Gormley et al. [5] , Strain et al. [21] Good et al. [15] also reported subpopulations of M. bovis-infected cattle which give a positive reaction to the IFN-γ assay and not to the tuberculin test and vice versa. However, animals which tested positive for IFN-γ assay and negative for intra-dermal tuberculin test were subsequently converted to tuberculin positive and posed an increased risk to the other cattle [20].

At 95% level of significance, kappa value between CITT and IFN-γ assay was 0.264, indicating a fair degree of agreement between the two tests. So both the tests, when used simultaneously increase the accuracy of detection of TB positive dairy animals, similar to the findings by Gormley et al. [5] , Ahir et al. [19]

The sensitivity (detection limit) of the esxB (CFP-10) PCR was up to 8 pg/μl of pure culture M. tuberculosis DNA [8]. There are reports of PCR from blood and tissue samples of cattle, using JB21 and JB22 primers specific for M. bovis, detecting as low as 10 fg/ul of purified M. bovis DNA [22] [23].

Several PCR systems have been developed for the detection of TB viz. PCR amplification of esxA and esxB genes targeting ESAT-6 and CFP-10 proteins respectively, present in pathogenic Mycobacterial species, can be used for confirmation of M. tuberculosis as well as M. bovis [7] [24]. Although the presence of ESAT-6 and CFP-10 has also been detected in other mycobacterial species and further studies of their extent of amino acid sequence similarities are required [25]. Besides, M. tuberculosis, as well as M. bovis, can also be detected by PCR targeting IS6110 insertion sequence [2] [26]. M. bovis in cattle lymph nodes were detected by PCR using TB1 and TB2 primers targeting gene that codes for MPB70 protein [27].

In our study, the 3 PCR positive animals that were IFN-γ positive but CITT negative may be in their early stage of TB infection. Besides, the probability that most of the TB reactor animals positive by CITT and IFN-γ assay failed to be detected by PCR may be due to low concentration of DNA (even less than 8 pg/µl) in clinical samples which remained undetected by PCR, besides M. bovis DNA may not be present in the clinical samples as the animal may not be in the stage of bacteriaemia. Therefore, information on M. bovis or M. tuberculosis bactaeriaemia and time of dissemination in blood stream need to be further explored for proper sampling time. However, compared to lymph node aspirate PCR which detected only 1 TB positive out of 15 animals, blood PCR had better sensitivity as the later detected TB positive in more numbers (13 out of 47) of either CITT and IFN-γ positive animals.

After all, there were certain limitations in this study, as no test is 100% sensitive and 100% specific [28] and no single test can diagnose bovine TB at all stages of infection [29] [30]. CITT has many limitations including difficulties in administration and interpretation of results, need for a second step visit, low degree of standardization and imperfect test accuracy [13]. The sensitivity of the test is affected by the potency and dose of tuberculin administered, desensitization, deliberate interference, post-partum immune-suppression and observer variation. Specificity is influenced by sensitisation as a result of exposure to M. avium, M. avium paratuberculosis and other environmental mycobacteria [31]. Because intradermal tuberculin testing elevates the production of IFN-γ by lymphocytes of cattle that have had prior exposure to M. bovis antigens [32] , there is the potential for multiple injections of tuberculin to increase the production of IFN-γ, resulting in higher optical density (OD) values of the IFN-γ assay and thus, for animals subsequently being classified falsely as positive [33]. Besides, TB is a chronic granulomatous disease, therefore, diagnosis of TB from blood samples may be done especially during the stage of bacteriaemia. After all, the difficulty in lymph node aspirate sampling from cattle and buffaloes were an inevitable drawback in this study. So, the accurate sense of the lymph node aspirate PCR cannot be ascertained from the present study as the numbers of samples are insufficient to make a correct judgement.

5. Conclusion

From this study, we can conclude that diagnosis of bovine TB can be done in early stage in live animals with cell-mediated immune response based tests (CITT and IFN-γ assay) and blood PCR especially during the stage of bacteriaemia. Combined use of both CITT and IFN-γ assay lead to more accurate screening of TB, though IFN-γ assay was more specific than CITT. However, esxB (CFP-10) PCR can also be used as a fast and easy alternative method for the laboratory diagnosis of bovine TB. Early diagnosis of TB can lead to quick segregation of infected animals, restrict transmission and help in eradication of bovine TB from the country. In fact, equal importance must be given for eradication of TB from the dairy animals to make the WHO’s “End TB strategy” a 100% success.

Acknowledgements

The authors are grateful to DBT (Department of Biotechnology) Government of India for providing funds for the present work through a Project (BT/PR5776/MED/30/928/2012).

Ethical Approval

This study was approved by Animal Ethics Committee of Guru Angad Dev Veterinary and Animal Sciences University (GADVASU), Ludhiana, Punjab.

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

Cite this paper

Brahma, D., Narang, D., Chandra, M., Filia, G., Singh, A. and Singh, S.T. (2019) Diagnosis of Bovine Tuberculosis by Comparative Intradermal Tuberculin Test, Interferon Gamma Assay and esxB (CFP-10) PCR in Blood and Lymph Node Aspirates. Open Journal of Veterinary Medicine, 9, 55-65. https://doi.org/10.4236/ojvm.2019.95005

ReferencesOIE (World Organisation for Animal Health) (2018) Chapter 8.11. Infection with Mycobacterium tuberculosis Complex. Terrestrial Animal Health Code.OIE (2009) Chapter 2.4.6: Bovine Tuberculosis. Terrestrial Manual. World Organization for Animal Health, Paris.World Health Organization (2018) Global Tuberculosis Report.Pfyffer, G.E. and Wittwer, F. (2012) Incubation Time of Mycobacterial Cultures: How Long Is Long Enough to Issue a Final Negative Report to the Clinician? Journal of Clinical Microbiology, 50, 4188-4189. https://doi.org/10.1128/JCM.02283-12Gormley, E., Doyle, M.B., Fitzsimons, T., McGill, K. and Collins, J.D. (2006) Diagnosis of Mycobacterium bovis Infection in Cattle by Use of the Gamma-Interferon (Bovigam1) Assay. Veterinary Microbiology, 112, 171-179. https://doi.org/10.1016/j.vetmic.2005.11.029OIE (2012) Chapter 2.4.7. Bovine Tuberculosis. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Seventh Edition, Paris.Dikshit, M., Sharma, R.J., Adsool, A.D. and Chaphalkar, S.R. (2012) ESAT-6 and CFP-10 Proteins of Mycobacterium tuberculosis in Making Diagnostic Tool for TB. Journal of Biotechnology Letters, 3, 28-30.Rangen, S.A., Surujballi, O.P., Lutze-Wallace, C. and Lees, V.W. (2009) Is the Gamma Interferon Assay in Cattle Influenced by Multiple Tuberculin Injections? Canadian Veterinary Journal, 50, 270-274.Whipple, D.L., Palmer, M.V., Slaughter, R.E. and Jones, S.L. (2001) Comparison of Purified Protein Derivatives and Effect of Skin Testing on Results of a Commercial Gamma Interferon Assay for Diagnosis of Tuberculosis in Cattle. Journal of Veterinary Diagnostic Investigation, 13, 117-122. https://doi.org/10.1177/104063870101300204Monaghan, M.L., Doherty, M.L., Collins, J.D., Kazda, J.F. and Quinn, P.J. (1994) The Tuberculin Test. Veterinary Microbiology, 40, 111-124. https://doi.org/10.1016/0378-1135(94)90050-7Bezos, J., Alvarez, J., Romero, B., De Juan, L. and Dominguez, L. (2014) Bovine Tuberculosis: Historical Perspective. Research in Veterinary Science, 97, S3-S4. https://doi.org/10.1016/j.rvsc.2014.09.003Marassi, C.D., Medeiros, L., Figueiredo, E., Fonseca, L.S., Duarte, R., Paschoalin, V., Oelemann, W.R.M. and Lilenbaum, W. (2013) A Multidisciplinary Approach to Diagnose Naturally Occurring Bovine Tuberculosis in Brazil. Pesquisa Veterinária Brasileira, 33, 15-20. https://doi.org/10.1590/S0100-736X2013000100004Pucken, V.B., Knubben-Schweizer, G., Dopfer, D., Groll, A., Hafner-Marx, A., Hoèrmansdorfer, S., Sauter-Louis, C, Straubinger, R.K., Zimmermann, P. and Hartnack, S. (2017) Evaluating Diagnostic Tests for Bovine Tuberculosis in the Southern Part of Germany: A Latent Class Analysis. PLoS ONE, 12, e0179847. https://doi.org/10.1371/journal.pone.0179847Helmy, N.M., Abdel-Moghney, A.R.F. and Atia, M.A.M. (2015) Evaluation of Different PCR-Based Techniques in Diagnosis of Bovine Tuberculosis in Infected Cattle Lymph Nodes. American Journal of Microbiology and Biotechnology, 2, 75-81.Bassessar, V., Shrivastav, A.B., Swamy, M., Jadhav, K. and Rajput, N. (2014) Polymerase Chain Reaction Based Detection of Mycobacterium tuberculosis IS6110 in Cattle Faeces. Indian Journal of Veterinary Pathology, 38, 10-13. https://doi.org/10.5958/0973-970X.2014.01126.2Van Pittius, N.C.G., Warren, R.M. and van Helden, P.D. (2002) Letter to the Editor. ESAT-6 and CFP-10: What Is the Diagnosis? Infection and Immunity, 70, 6509-6511. https://doi.org/10.1128/IAI.70.11.6509-6511.2002Pinxteren, L.A.H.V., Ravn, P., Agger, E.M., Pollock, J. and Andersen, P. (2000) Diagnosis of Tuberculosis Based on the Two Specific Antigens ESAT-6 and CFP-10. Clinical and Diagnostic Laboratory Immunology, 7, 155-160. https://doi.org/10.1128/CDLI.7.2.155-160.2000Zali, M.H.S., Farajnia, F., Yahyapour, H., Moslemzadeh, T. and Hashempour, A. (2014) Detection of Mycobacterium bovis in Cattle Suspected to Tuberculosis by PCR Method in Urmia-Iran. Bulletin of Environment, Pharmacology and Life Sciences, 3, 152-157.Rodriguez, J.G., Mejia, G.A., Portillo, P.D., Patarroyo, M.E. and Murillo, L.A. (1995) Species-Specific Identification of Mycobacterium bovis by PCR. Microbiology, 141, 2131-2138. https://doi.org/10.1099/13500872-141-9-2131Strain, S.A.J., McNair, J. and McDowell, S.W.J. (2011) Bovine Tuberculosis. A Review of Diagnostic Tests for M. bovis Infection in Cattle. Bacteriology Branch, Veterinary Sciences Division, AgriFood and Biosciences Institute, Belfast, Northern Ireland, UK.Gormley, E., Doyle, M.B., McGill, K., Costello, E., Good, M. and Collins, J.D. (2004) The Effect of the Tuberculin Test and the Consequences of a Delay in Blood Culture on the Sensitivity of a Gamma-Interferon Assay for the Detection of Mycobacterium bovis Infection in Cattle. Veterinary Immunology and Immunopathology, 102, 413-420. https://doi.org/10.1016/j.vetimm.2004.08.002Ahir, P., Filia, G., Mahajan, V., Leishangthem, G.D., Rai, T.S. and Singh, A. (2016) Diagnosis of Bovine Tuberculosis in Lactating Cattle and Buffaloes by Comparative Intradermal Tuberculin Test and Bovine Gamma-Interferon Immunoassay. Journal of Animal Research, 6, 1069-1072. https://doi.org/10.5958/2277-940X.2016.00157.1Liebana, E., Girvin, R.M., Welsh, M., Neill, S.D. and Pollock, J.M. (1999) Generation of CD8 (+) T-Cell Responses to Mycobacterium bovis and Mycobacterial Antigen in Experimental Bovine Tuberculosis. Infection and Immunity, 67, 1034-1044.Wood, P.R., Corner, L.A., Rothel, J.S., Baldock, C., Jones, S.L., Cousins, D.B., McCormick, B.S., Rancis, B.R., Creeper, J. and Tweddle, N.E. (1991) Field Comparison of the Interferon-Gamma Assay and the Intra-Dermal Tuberculin Test for the Diagnosis of Bovine Tuberculosis. Australian Veterinary Journal, 68, 286-290. https://doi.org/10.1111/j.1751-0813.1991.tb03254.xAmeni, G., Miorner, H., Roger, F. and Tibbo, M. (2000) Comparison between Comparative Tuberculin and Gamma-Interferon Tests for the Diagnosis of Bovine Tuberculosis in Ethiopia. Tropical Animal Health and Production, 32, 267-276. https://doi.org/10.1023/A:1005271421976Good, M., Duignan, A., Maher, P. and O’Keeffe, J. (2010) Veterinary Handbook for Herd Management in the Bovine TB Eradication Programme.Aagaard, C., Govaerts, M., Meikle, V., Gutiérrez-Pabello, J.A., McNair, J., Andersen, P., SuárezGüemes, F., Pollock, J., Espitia, C. and Cataldi, A. (2010) Detection of Bovine Tuberculosis in Herds with Different Disease Prevalence and Influence of Paratuberculosis Infection on PPDB and ESAT-6/CFP10 Specificity. Preventive Veterinary Medicine, 96, 161-169. https://doi.org/10.1016/j.prevetmed.2010.06.007De La Rua-Domenech, R., Goodchild, A.T., Vordermeier, H.M., Hewinson, R.G., Christiansen, K.H. and Clifton-Hadley, R.S. (2006) Ante Mortem Diagnosis of Tuberculosis in Cattle: A Review of the Tuberculin Tests, Gamma-Interferon Assay and Other Ancillary Diagnostic Techniques. Research in Veterinary Science, 81, 190-210. https://doi.org/10.1016/j.rvsc.2005.11.005Buddle, B.M., Ryan, T.J., Pollock, J.M., Andersen, P. and de Lisle, G.W. (2001) Use of ESAT-6 in the Interferon-g Test for Diagnosis of Bovine Tuberculosis Following Skin Testing. Veterinary Microbiology, 80, 37-46. https://doi.org/10.1016/S0378-1135(00)00375-8Srinivasan, S., Easterling, L., Rimal, B., Niu, X.M., Conlan, A.J.K., Dudas, P. and Kapur, V. (2018) Prevalence of Bovine Tuberculosis in India: A Systematic Review and Meta-Analysis. Transboundary and Emerging Diseases, 65, 1627-1640. https://doi.org/10.1111/tbed.12915Sharma, S., Patil, P.K., Kumar, H., Mahajan, V., Filia, G., Verma, S. and Sandhu, K.S. (2011) Bovine Tuberculosis in Intensive Dairy Operations of Punjab: Longitudinal Comparative Study on Prevalence and the Associated Risk Factors. Indian Journal of Comparative Microbiology, Immunology and Infectious Diseases, 32, 41-44.Das, R., Dandapat, P., Chakrabarty, A., Nanda, P.K., Bandyopadhyay, S. and Bandyopadhyay, S. (2018) A Cross-Sectional Study on Prevalence of Bovine Tuberculosis in Indian and Crossbred Cattle in Gangetic Delta Region of West Bengal, India. International Journal of One Health, 4, 1-7. https://doi.org/10.14202/IJOH.2018.1-7Brahma, D., Narang, D., Chandra, M., Gupta, K., Singh, A. and Kaur, G. (2017) Diagnosis of Mycobacterial Infections (Tuberculosis and Paratuberculosis) in Tissue Samples Using Molecular (In-House Multiplex PCR, PCR and TaqMan Real-Time PCR), Histopathology and Immunohistochemical Techniques. Tropical Biomedicine, 34, 1-17.