<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2019.105062</article-id><article-id pub-id-type="publisher-id">AJPS-92720</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Mitigating Root Knot Nematode Propagation on Transgenic Tobacco via &lt;i&gt;in Planta&lt;/i&gt; Hairpin RNA Expression of &lt;i&gt;Meloidogyne incognita&lt;/i&gt;—Specific PolA1 Sequence
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Peter</surname><given-names>Nkachukwu Chukwurah</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Samuel</surname><given-names>Aduse Poku</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Akira</surname><given-names>Yokoyama</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ai</surname><given-names>Takeda</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Masahiro</surname><given-names>Shishido</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ikuo</surname><given-names>Nakamura</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff4"><addr-line>Chiba Prefectural Agriculture and Forestry Research Center, Daizennocho, Chiba, Japan</addr-line></aff><aff id="aff2"><addr-line>Laboratory of Plant Cell Technology, Chiba University, Matsudo, Japan</addr-line></aff><aff id="aff1"><addr-line>Department of Genetics and Biotechnology University of Calabar, Calabar, Nigeria</addr-line></aff><aff id="aff3"><addr-line>Laboratory of Plant Pathology, Chiba University, Matsudo, Japan</addr-line></aff><pub-date pub-type="epub"><day>10</day><month>05</month><year>2019</year></pub-date><volume>10</volume><issue>05</issue><fpage>866</fpage><lpage>884</lpage><history><date date-type="received"><day>12,</day>	<month>March</month>	<year>2019</year></date><date date-type="rev-recd"><day>27,</day>	<month>May</month>	<year>2019</year>	</date><date date-type="accepted"><day>30,</day>	<month>May</month>	<year>2019</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Root knot
   nematodes are top priority nematode pests that significantly constrain agricultural productivity globally especially in developing countries. However, expressing double stranded RNA (dsRNA) of essential nematode genes in susceptible plants is known to confer protection against these pests via RNA silencing. This molecular-based strategy is called host induced gene silencing (HIGS) and the selection of appropriate target nematode gene is critical to its success. In this study, therefore, we focused on root knot nematode PolA1, an essential single copy nuclear gene encoding the largest subunit of RNA polymerase I enzyme and evaluated its effectiveness as a target in conferring nematode resistance on Agrobacterium
  -
  mediated
   transformed tobacco plants. Transgenic tobacco expressing Meloidogyne incognita-specific (MiS) dsRNA of PolA1 gene showed significant reduction in nematode fecundity and multiplication compared to wild type plants in both T<sub>0</sub> and T<sub>1</sub> generations. T<sub>0</sub> plants showed varying degrees of agronomic vigorover WT plants possibly due to varying levels of processed siRNA. However, production of MiS siRNAs in the transgenic plants coupled with significant reduction of PolA1 transcript expression in nematodes feeding on roots of transgenic plants provided evidence of HIGS. Taken together, our results show that PolA1 is a potentially effective target for HIGS-mediated reduction of root knot nematode damage on transgenic tobacco. Given the homology of our target sequence among Meloidogyne species, this protection could be broad range against other root knot nematodes aside M. incognita.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;M. incognita&lt;/i&gt;</kwd><kwd> Nematode Resistance</kwd><kwd> &lt;i&gt;N. tabacum&lt;/i&gt;</kwd><kwd> RNA Silencing</kwd><kwd> &lt;i&gt;PolA&lt;/i&gt;1 Gene</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Plant parasitic nematodes are among the most significant constraints to sustainable agriculture and achievement of food security [<xref ref-type="bibr" rid="scirp.92720-ref1">1</xref>] . Root knot nematodes (Meloidogyne spp.), in particular, are the most economically important of the plant parasitic nematodes with a wide global distribution and broad host range [<xref ref-type="bibr" rid="scirp.92720-ref2">2</xref>] . Developing countries are particularly devastated by these pests through reduction in yield of key staple crops and impoverishment of resource-poor subsistence farmers. Most successful nematode management strategy over the years involved the integrated use of nematicides, resistant crop varieties and good cultural practices [<xref ref-type="bibr" rid="scirp.92720-ref3">3</xref>] . Concerns, however, exist over environmental and health risks associated with increased use of toxic chemical nematicides.</p><p>Engineering nematode resistance in plants through biotechnology is regarded as a multi-beneficial, less risky alternative for achieving durable, broad-spectrum resistance [<xref ref-type="bibr" rid="scirp.92720-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.92720-ref5">5</xref>] . With the complete sequencing of the Meloidogyne incognita genome, the past decade has proven the possibility of engineering nematode resistance in plants via molecular-based strategies like host induced gene silencing [<xref ref-type="bibr" rid="scirp.92720-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.92720-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.92720-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.92720-ref9">9</xref>] . This strategy involves the engineering of suitable host plants to express double stranded RNA (dsRNA) of an essential nematode gene in planta. This dsRNA then triggers the plants’ conserved innate RNA silencing mechanism which rapidly processes the dsRNA into 21 - 24 bp RNA duplexes called small interfering RNAs (siRNAs). Small interfering RNAs then combine with RNA-induced silencing complex (RISC) and guide the sequence-specific recognition and degradation of complementary gene transcripts [<xref ref-type="bibr" rid="scirp.92720-ref10">10</xref>] . In HIGS, expression of nematode-specific dsRNA in plants generates siRNAs which are ingested by the nematodes during feeding and mediate silencing of the target nematode gene with possible conferment of plant protection [<xref ref-type="bibr" rid="scirp.92720-ref11">11</xref>] .</p><p>HIGS strategy, therefore, has the selection of appropriate parasite target gene as a central consideration for success. Studies on HIGS have evaluated different nematode parasitism [<xref ref-type="bibr" rid="scirp.92720-ref7">7</xref>] and housekeeping genes [<xref ref-type="bibr" rid="scirp.92720-ref6">6</xref>] , but there remains a crucial need to identify more effective target genes that can confer durable resistance against root knot nematodes. Among other factors to consider in choosing a candidate gene for silencing to confer durable resistance, [<xref ref-type="bibr" rid="scirp.92720-ref12">12</xref>] recommends a gene which the pest or pathogen cannot risk for mutation. PolA1 is a single-copy nuclear gene that encodes the largest subunit of the multi-subunit RNA polymerase I holoenzyme complex which synthesizes ribosomal RNA precursor, an essential component of ribosomes. Ribosomes play a crucial role in protein synthesis which is essential to proper functioning of cells and organisms. The PolA1 gene was found to contain a nucleotide sequence that encodes species-specific amino acid sequence [<xref ref-type="bibr" rid="scirp.92720-ref13">13</xref>] .</p><p>The PolA1 gene has a function critical to eukaryotic survival and propagation. It also has a potential advantage over multi-copy genes to confer durable resistance due to its existence in single copy per haploid genome in eukaryotes. In light of the above, this study evaluated the suitability of M. incognita-specific (MiS) sequence of thePolA1 gene as target for effective HIGS against M. incognita in transgenic tobacco expressing MiS dsRNA.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. PolA1 Silencing Vector and Tobacco Transformation</title><p>We constructed a binary vector to express hairpin RNA of a 472 bp MiStarget sequence of MeloidogyneincognitaPolA1 gene (Chukwurah et al. submitted, <xref ref-type="fig" rid="fig1">Figure 1</xref>). Briefly, MiS sequence was PCR-amplified from pUC57 vector using MiS5P and MiS3P primers and inserted into the entry vector, pCR8, by TA cloning. MiS target on pCR8 was inserted into pANDA35HK RNAi binary vector using Gateway LR Clonase II enzyme mix (Thermo Fisher Scientific). We checked both pCR8: MiS and pANDA35HK: MiS plasmids from transformed E.</p><p>coli by PCR and restriction analyses to confirmsequence correctness as well MiS integration in both sense and anti-sense orientations, respectively (<xref ref-type="fig" rid="fig2">Figure 2</xref>). The PolA1 silencing construct, pANDA35HK: MiS, was transformed into Agrobacterium tumefaciens strain EHA 105 using the freeze-thaw method.</p><p>We transformed tobacco (Nicotianatabacum “Petit Havana”) using the Agrobacterium-mediated leaf disc method [<xref ref-type="bibr" rid="scirp.92720-ref14">14</xref>] . Transgenic tobacco calli were selected on MS basal medium supplemented with 3% sucrose, 0.1 mg&#183;l<sup>−1</sup> NAA, 1 mg&#183;l<sup>−1</sup> BA, 40 mg&#183;l<sup>−1</sup> hygromycin, 20 mg&#183;l<sup>−1</sup> meropenem and solidified with 0.8% agar. Regenerated shoots were transferred to 1/2 MS medium supplemented with 40 mg&#183;l<sup>−1</sup> hygromycin, 20 mg&#183;l<sup>−1</sup> meropenem and solidified with 0.8% agar but without growth regulators for root development.</p></sec><sec id="s2_2"><title>2.2. Genomic PCR Analysis of T<sub>0</sub> Tobacco</title><p>We extracted genomic DNA from 100 mg young leaves of putative transgenic and wild type plants using Sodium Dodecyl Sulfate (SDS) method [<xref ref-type="bibr" rid="scirp.92720-ref15">15</xref>] . Using different sets of primers (<xref ref-type="table" rid="table1">Table 1</xref>), we targeted regions of the binary vector corresponding to sense and anti-sense orientations of MiS sequence in the plants’ genome (<xref ref-type="fig" rid="fig1">Figure 1</xref>). We also amplified a region corresponding to the hygromycin marker gene. Amplification of these regions was also carried out in the binary vector as a positive control.</p></sec><sec id="s2_3"><title>2.3. Southern Blotanalysis of T<sub>0</sub> Tobacco</title><p>We selected PCR positive transgenic lines and extracted genomic DNA using acetyl trimethyl ammonium bromide (CTAB) protocol [<xref ref-type="bibr" rid="scirp.92720-ref16">16</xref>] . We digested extracted genomic DNA (15 &#181;g) of both transgenic and WT plants with SacI enzyme (TAKARA) at 37˚C. Digestion was done overnight following which DNA fragments were separated on 0.7% agarose gel and transferred to a nylon membrane. A 472 bp MiS probe was labelled using PCR DIG Probe Synthesis Kit (Roche). Probe hybridization, stringency washes and chemiluminescence detection with CDP-Star were carried out following manufacturer’s instructions.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> List of primers used for cloning, PCR amplification, and Southern hybridization</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene</th><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Primer sequence (5'-3')</th><th align="center" valign="middle" >Amplicon size (bp)</th></tr></thead><tr><td align="center" valign="middle" >MiS</td><td align="center" valign="middle" >MiS5P MiS3P</td><td align="center" valign="middle" >tagatctATTTGTTTCGTCCTGAAGTA AGTTCGATTTGCAGCCTCTACACC</td><td align="center" valign="middle" >472</td></tr><tr><td align="center" valign="middle" >Hpt</td><td align="center" valign="middle" >HPT5P HPT3P</td><td align="center" valign="middle" >GTGTCACGTTGCAAGACCTG CGAGTACTTCTACACAGCCA</td><td align="center" valign="middle" >687</td></tr><tr><td align="center" valign="middle" >MiS-sense</td><td align="center" valign="middle" >GUSLK5P MiS3P</td><td align="center" valign="middle" >TGATAGCGCGTGACAAAAACCACCCAAG AGTTCGATTTGCAGCCTCTACACC</td><td align="center" valign="middle" >1083</td></tr><tr><td align="center" valign="middle" >MiS-antisense</td><td align="center" valign="middle" >MiS3P GUSLK3P</td><td align="center" valign="middle" >AGTTCGATTTGCAGCCTCTACACC AAGGCCGACAGCAGCAGTTTCATCAATCA</td><td align="center" valign="middle" >796</td></tr><tr><td align="center" valign="middle" >GUS</td><td align="center" valign="middle" >GUS5P GUS3P</td><td align="center" valign="middle" >CATGAAGATGCGGACTTACG ATCCACGCCGTATTCGG</td><td align="center" valign="middle" >636</td></tr><tr><td align="center" valign="middle" >EF1a</td><td align="center" valign="middle" >EF1a5P EF1a3P</td><td align="center" valign="middle" >ACTGTGCTGTCCTGATTATTGACT GGACCAAAAGTAACAACCATACCA</td><td align="center" valign="middle" >471</td></tr><tr><td align="center" valign="middle" >35SP- GUSLK</td><td align="center" valign="middle" >35SP GUSLK3P</td><td align="center" valign="middle" >GATGTGATATCTCCACTGAC AAGGCCGACAGCAGCAGTTTCATCAATCA</td><td align="center" valign="middle" >956</td></tr><tr><td align="center" valign="middle" >RKN-2</td><td align="center" valign="middle" >RKN-2F RKN-2R</td><td align="center" valign="middle" >TCTAAGTGTTGCTGATACGGTT TCCACCGATAAGGGTAGAAT</td><td align="center" valign="middle" >167</td></tr><tr><td align="center" valign="middle" >PolA1 RT-PCR</td><td align="center" valign="middle" >PolA1RT-F PolA1RT-R</td><td align="center" valign="middle" >AGGCTTTCTACAATCGAGTACAAT TCAATTCCATAAACGCCGAATACA</td><td align="center" valign="middle" >152</td></tr><tr><td align="center" valign="middle" >EF1A- RT</td><td align="center" valign="middle" >EF1aRT-F EF1aRT-R</td><td align="center" valign="middle" >GAAAGACTTTGTTGGAAGCCCTTG GGGAACAGTTCCAATACCTCCAAT</td><td align="center" valign="middle" >122</td></tr></tbody></table></table-wrap></sec><sec id="s2_4"><title>2.4. Expression of MiS dsRNA in T<sub>0</sub> Tobacco</title><p>We used reverse transcription PCR (RT-PCR) to confirm expression of MiS dsRNA in the transgenic plants. Total RNA was extracted from 100 mg young leaves of transgenic and WT plants using the RNeasy Plant Mini Kit (Qiagen). One microgram of the purified RNA (DNAse-treated) was used as template for the synthesis of first strand cDNA using Superscript III First-Strand cDNA Synthesis Kit (Invitrogen). First strand cDNA (2 &#181;l) from both positive and negative control reactions (without enzyme) were used as template in a 50 &#181;l total volume for PCR amplification of a region of the GUS linker using GUS5P and GUS3P primers (<xref ref-type="fig" rid="fig1">Figure 1</xref>(B)). We also amplified elongation factor 1α (EF1α) using primers EF1a5P and EF1a3P (<xref ref-type="table" rid="table1">Table 1</xref>) as an internal control.</p></sec><sec id="s2_5"><title>2.5. Northern Blot Analysis for Detection of MiS siRNA</title><p>We extracted small RNAs (&lt;200 bp) from the selected transgenic and WT plants using ISOGEN II reagent (Nippon Gene). Thirty micrograms of small RNA from each sample was resolved on 17% denaturing polyacrylamide gel (acrylamide: bis 19:1) containing 7M urea. Transfer of separated small RNAs to a nylon membrane was done using a semi-dry cell (Nippon Eido) for 1 hour at 10 V/400mA. Northern hybridization was done using DIG-labelled MiS RNA probe (472 bp) obtained via in vitro transcription of the MiS target sequence using T7 RNA polymerase according to DIG Northern Starter Kit Version 10 (Roche) protocol. Pre-hybridization (30 min) and hybridization (overnight) were performed at 50˚C. Post-hybridization stringency washes and chemiluminescent detection of siRNA using CDP-Star were performed following protocols outlined in the DIG Northern Starter Kit (Roche) manual.</p></sec><sec id="s2_6"><title>2.6. Root Knot Nematode Culture and Preparation of Inoculum</title><p>A pure culture of root knot nematode (Melodoigyneincognita) race 2 was maintained on a highly susceptible tomato cultivar “Kyoryoku-beiju” in a glass house for 2 months to enable gall formation. We prepared nematode egg suspension used asinfection inoculum by extraction from freshly uprooted galled roots. Infected roots were washed, chopped and macerated in an electric blender for 5 mins at full speed. Nematode eggs were recovered by filtration on a 25 &#181;m sieve. Recovered eggs were reconstituted into suspension and one ml egg suspension was used to determine egg concentration by counting under a microscope.</p></sec><sec id="s2_7"><title>2.7. Infection of T<sub>0</sub> Tobacco with M. incognita</title><p>One-internode stem cuttings of 3 selected transgenic (T1, T4 and T7) and WT tobacco lines were rooted in 1/2 MS medium containing 1% sucrose and 0.8% agar for two weeks. Rooted plants were acclimatized on sterile vermiculite [<xref ref-type="bibr" rid="scirp.92720-ref17">17</xref>] , transferred to pots containing 3000 ml of sterile commercial garden soil and allowed further acclimatization in the glasshouse for 12 days. They were then individually infected with approximately 10,000 Meloidogyne incognita eggs of same batch via 3 holes made around each plant root system. All tested plants were replicated 10 times and confined in the glass house for a total period of 7 weeks. Infection experiment was repeated.</p><p>After 7 weeks of nematode infection, transgenic and wild type plants were harvested, and analyzed for nematode parasitic success and key agronomic characters. Galling index (%) was scored according to [<xref ref-type="bibr" rid="scirp.92720-ref18">18</xref>] . Number of eggs per egg mass was evaluated by counting from ten randomly selected egg masses after roots were stained with 15 mg/L Phloxine B and egg masses treated with 1% sodium hypochlorite [<xref ref-type="bibr" rid="scirp.92720-ref19">19</xref>] . We used SYBR Green-based real time PCR to quantify the amount of root knot nematode juveniles in the soil by measuring nematode DNA amount per gram soil. We homogenized and bulked soil samples in which transgenic and wild type plants were grown, separately. Genomic DNA was extracted from 3 replicate soil samples from each lot using ISOIL for Beads Beating Soil DNA extraction kit (Nippon Gene). We adjusted genomic DNA concentration in all samples to 2.8 ng/&#181;l, and used 2 &#181;l as template in 20 &#181;l qPCR cocktail containing 10 &#181;l KOD SYBRqPCR Mix, 4 pmol forward primer (RKN-2F), 4 pmol reverse primer (RKN-2R), 0.4 &#181;l 50x ROX reference dye and sterile water. Real time PCR reaction was performed in a Step One Plus Real-Time PCR system (AB Applied Biosystem). A dilution series of known concentration of M. incognita genomic DNA was prepared and a standard curve of the log of each known concentration in the dilution series (x-axis) was plotted against the C<sub>t</sub> (threshold) value for that concentration (y-axis). Absolute quantification of M. incognita genomic DNA concentration was done by comparison with the standard curve.</p></sec><sec id="s2_8"><title>2.8. Generation of T<sub>1</sub> Tobacco Plants and Nematode Infection</title><p>We acclimatized T<sub>0</sub> plants (T1and T7) and transferred them to the green house for T<sub>0</sub> seed production. We germinated T<sub>0</sub> seeds of lines T1 and T7 in 0.5x MS medium supplemented with 1% sucrose and 100 mg/L kanamycin to generate their T<sub>1</sub> progeny plants. We confirmed via PCR the presence of MiS sense and anti-sense regions as well as hygromycin gene in the genomes of the T<sub>1</sub> plants.</p><p>T<sub>1</sub> plants showing presence of all three amplicons were transferred to 300 ml autoclaved garden soil and acclimatized under high humid conditions in growth room for 10 days. The plants were further acclimatized in the green house for 11 days after which they were individually infected with approximately 500 freshly extracted eggs of M. incognita. Nematode-infected plants were grown in confinement for 49 days and analyzed for nematode parasitic success. Nematode parasitic parameters evaluated include number of nematode galls on roots, number of nematode egg masses, number of nematodes eggs per mass and nematode multiplication. We counted nematode galls by root inspection with the aid of magnifying lens. Nematode multiplication was evaluated by multiplying the number of egg masses per gram root by number of eggs per egg mass and dividing by initial amount of egg inoculum used for infection. Infection experiment was repeated twice.</p></sec><sec id="s2_9"><title>2.9. PolA1 Target Gene Expression in Adult Feeding Female Nematodes</title><p>We extracted adult female nematodes feeding on roots of WT and T<sub>1</sub> transgenic tobacco plants under a stereo microscope (Olympus SZX9) and stored them in −80˚C after flash freezing in liquid Nitrogen. Total RNA was extracted from the samples using ISOGEN (Nippon Gene), and 300 ng from each was converted to cDNA using PrimeScript<sup>TM</sup> RT reagent Kit with gDNA Eraser (TaKaRa). Quantitative real time PCR (qRT-PCR)was then performed to amplify a 152 bp target region of the PolA1 gene (<xref ref-type="fig" rid="fig1">Figure 1</xref>0(A)) using SYBR Green technology in StepOnePlus<sup>TM</sup> thermal cycler (Applied Biosystems).</p><p>We prepared PCR cocktail for each reaction by mixing 10 &#181;l KOD SYBR qPCR Mix (TOYOBO), 0.2 &#181;M each of forward and reverse primers (PolA RT-F and PolA RT-R), 0.4 &#181;l 50x ROX reference dye, 1 &#181;l cDNA (10x dilution) and distilled water to a total of 20 &#181;l. Amplification reaction was carried out at a hot start of 98˚C for 2 min, followed by 40 cycles of 98˚C for 10 s, 55˚C for 10 s and 68˚C for 30 s in a 96-well &#181;ltra Amp PCR plate (Sorenson Bioscience). We assessed specificity of the amplification by melt curve analysis at 60˚C - 95˚C after 40 cycles.</p><p>Three biological and three technical replicates were used with each sample. We used mean C<sub>t</sub> values (normalized against internal reference gene) to calculate the fold change in PolA1 expression in the nematodes using the 2<sup>−∆∆CT</sup> method. Root knot nematode elongation factor was used as the internal reference gene. We expressed PolA1 transcript abundance in nematodes extracted from transgenic roots as a percentage relative to the transcript level in nematodes extracted from wild type plants.</p></sec><sec id="s2_10"><title>2.10. Statistical Analyses</title><p>All experimental units were laid in a completely randomized design (CRD) in the green house, and data generated after nematode infection were analyzed by a one-way analysis of variance (ANOVA) using SigmaPlot 14.0 software (SYSTAT). Significantly different means were separated using the Duncan’s Multiple Range Test (DMRT).</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Genomic PCR Analyses of T<sub>0</sub> Transgenic Tobacco</title><p>Following agrobacterium transformation, selection and regeneration of tobacco plantlets, we generated and genotyped 13 primary transgenic lines. We used 2 sets of primers GUSLK5P/MiS3P and MiS3P/GUSLK3P (<xref ref-type="fig" rid="fig1">Figure 1</xref>(B)) to amplify 1083 bp and 796 bpgenomic regions corresponding to the sense and anti-sense orientations of MiS target. We also amplified a 687 bp genomic region corresponding to hygromycin marker gene (hpt) using primers HPT5P and HPT3P (<xref ref-type="fig" rid="fig1">Figure 1</xref>(B)). Sense, anti-sense and hpt amplicons for 13 transgenic lines are shown in <xref ref-type="fig" rid="fig3">Figure 3</xref>(A). Plasmid DNA was amplified as a positive control while untransformed plants (WT) showed no amplification.</p></sec><sec id="s3_2"><title>3.2. Southern Analysis of T<sub>0</sub> Transgenic Tobacco</title><p>We subjected nine PCR-positive transgenic lines to Southern hybridization to analyze their MiST-DNA integration patterns. Using probes specific to MiS target, single, double and triple copy T-DNA insertions were observed with the different lines (<xref ref-type="fig" rid="fig3">Figure 3</xref>(B)). Wild type plants showed no hybridization signal with the probe.</p></sec><sec id="s3_3"><title>3.3. Expression of MiS dsRNA in T<sub>0</sub> Tobacco</title><p>We derived complementary DNA (cDNA) from selected T<sub>0</sub> plants (T1, T4 and T7) and conducted reverse-transcription PCR (RT-PCR) analysis to confirm expression of MiS dsRNA in the transgenic lines. Using primers GUS5P and GUS3P (<xref ref-type="fig" rid="fig1">Figure 1</xref>(B)), we amplified a 636 bp fragment corresponding to the GUS linker region between sense and anti-sense orientations of the MiS target sequence in the selected lines (<xref ref-type="fig" rid="fig3">Figure 3</xref>(C)). Wild type plants showed no amplification for the GUS linker region. Elongation factor (EF1a) used as internal</p><p>control reference gene was amplified using primers EF1a5P and EF1a3P (<xref ref-type="table" rid="table1">Table 1</xref>). Transgenic and wild type plants both showed a 481 bp amplicon of EF1a. We also amplified 2 genomic DNA controls containing a 77 bp intron with the same primers and obtained a higher 558 bp amplicon (<xref ref-type="fig" rid="fig3">Figure 3</xref>(D)).</p></sec><sec id="s3_4"><title>3.4. Northern Blot Analysis for MiS siRNA in T<sub>0</sub> Tobacco</title><p>DIG-labelled MiSRNA probe hybridized to sequence-specific siRNAsin the transgenic plants that expressed MiSdsRNA (<xref ref-type="fig" rid="fig4">Figure 4</xref>). We did not detect any hybridization signal with WT plants. Ethidium-bromide staining of the polyacrylamide gel after electrophoresis showed equivalent loading of small RNAs across all samples.</p></sec><sec id="s3_5"><title>3.5. Bio-Efficacy of T<sub>0</sub> Transgenic Tobacco against M. incognita</title><p>An inspection of the test plants’ roots showed wild type plants with reduced and necrotic root system having larger multiple fused galls compared to the transgenic lines (<xref ref-type="fig" rid="fig5">Figure 5</xref>(A)). Nematode galling index was equally highest on roots of wild type tobacco plants (70.0%). The transgenic lines showed reduced root galling indices particularly T1 and T7 (54.3% and 58.6% respectively. Galling index on T4 was 62.7% (<xref ref-type="fig" rid="fig5">Figure 5</xref>(B)). Nematode eggs per mass was highest on roots of WT plants (613) but significantly reduced (p &lt; 0.05) by 26.4% in transgenic line T1. Nematodes eggs on lines T7 and T4 were reduced by 17.3% and 2.5% respectively but not significantly (<xref ref-type="fig" rid="fig5">Figure 5</xref>(C)). Quantification of nematode DNA by real time PCR showed that soil pooled from wild type plants contained significantly more (p &lt; 0.05) nematode DNA per gram (617.6 ng/g soil) than those of transgenic plants T1 (235.0 ng/g), T7 (149.8 ng/g) and T4 (303.4 ng/g) (<xref ref-type="fig" rid="fig5">Figure 5</xref>(D)). This represented a 61.9%, 75.7% and 50.9% reduction respectively.</p><p>The transgenic plants were generally more vigorous post-infection compared to WT plants (<xref ref-type="fig" rid="fig6">Figure 6</xref>(A)). Number of leaves determined for all treatment groups before nematode infection was comparable (p &gt; 0.05). All plants had an average of 13 healthy leaves (<xref ref-type="fig" rid="fig6">Figure 6</xref>(B)). After 7 weeks of nematode infection,</p><p>however, mean percentage of green, standing leaves reduced significantly (p &lt; 0.001) in WT plants by 32.5% and 20.7% respectively compared to T1 and T7 (<xref ref-type="fig" rid="fig6">Figure 6</xref>(C)). Fresh root biomass was also significantly reduced (p &lt; 0.05) in the WT plants by 23.1% and 21.4% compared to lines T1 and T7 respectively, but comparable to T4 (<xref ref-type="fig" rid="fig6">Figure 6</xref>(D)).</p><p>Disease condition was more outstanding on WT leaves compared to transgenic plants (<xref ref-type="fig" rid="fig7">Figure 7</xref>(A)). We measured the distance from base of each plant up the stem to the last diseased leaf. This parameter, termed disease progression, was significantly reduced (p &lt; 0.001) in transgenic lines T1 and T7 by about 80.0% compared to WT plants. Compared to T4, disease progression was significantly reduced by 12.0% (<xref ref-type="fig" rid="fig7">Figure 7</xref>(B)). Fresh leaf biomass was significantly reduced (p &lt; 0.001) in WT plants compared to those of T1 and T7 by 22.0% and 14.2% respectively. Compared to T4, WT plants showed 6.9% reduction in fresh leaf biomass (<xref ref-type="fig" rid="fig7">Figure 7</xref>(C)). In the same vein, dry leaf biomass in WT plants was reduced significantly by 19.9% and 14.2% compared to T1 and T7 respectively, but comparable to T4 (<xref ref-type="fig" rid="fig7">Figure 7</xref>(D)).</p></sec><sec id="s3_6"><title>3.6. Molecular Characterization of T<sub>1</sub> Tobacco Lines</title><p>We extracted genomic DNA from 100 mg young leaves of T<sub>1</sub> tobacco progeny plants generated from transgenic lines T1 and T7. We excluded T4 from further</p><p>analyses owing to its comparatively weaker T<sub>0</sub> phenotype. PCR amplification was carried out with same primer sets used with T<sub>0</sub> plants. We obtained correct amplicons for hygromycin gene (687 bp) as well as MiS target in both sense (1083 bp) and anti-sense orientations (796 bp) with the transgenic lines. Wild type plants showed no amplification signal (<xref ref-type="fig" rid="fig8">Figure 8</xref>(A)).</p></sec><sec id="s3_7"><title>3.7. Bio-Efficacy of T<sub>1</sub> Tobacco against M. incognita</title><p>Nematode galls per gram root were significantly reduced (p &lt; 0.05) in T<sub>1</sub> plants of transgenic lines T7 and T1 by 25.5% and 20.6% respectively compared to WT plants. T7 and T1 were comparable (p &gt; 0.05) in mean number of galls on their roots (<xref ref-type="fig" rid="fig8">Figure 8</xref>(B)). Nematode egg masses were also significantly reduced (p &lt; 0.05) by 13.8% and 11.4% on transgenic lines T1 and T7 respectively, compared to WT plants (<xref ref-type="fig" rid="fig8">Figure 8</xref>(C) and <xref ref-type="fig" rid="fig8">Figure 8</xref>(A)). The transgenic plants had significantly reduced (p &lt; 0.05) number of nematode eggs permass. Compared to WT plants, nematode eggs per mass on T1 and T7 were reduced by 20.9% and 17.7% respectively (<xref ref-type="fig" rid="fig8">Figure 8</xref>(D)). Nematode multiplication on transgenic lines T1 and T7 was also significantly reduced (p &lt; 0.05) by 30.7% and 26.9% respectively compared to WT plants (<xref ref-type="fig" rid="fig8">Figure 8</xref>(E)).</p><p>Agronomic traits evaluated in the test plants included shoot weights, fresh root weights and root lengths. All T<sub>1</sub> test plants were comparable (p &gt; 0.05) in these characters (Figures 9(B)-(D)).</p></sec><sec id="s3_8"><title>3.8. Relative Expression of PolA1 in Adult Feeding Female Nematodes</title><p>We used qRT-PCR analyses to compare PolA1 transcript expression in adult female nematodes feeding on roots of transgenic and wild type plants. Relative to expression in nematodes feeding on roots of WT plants, PolA1expression was significantly reduced (p &lt; 0.05) by 34.3% and 31.5% respectively in nematodes feeding on transgenic lines T1 and T7 (<xref ref-type="fig" rid="fig1">Figure 1</xref>0(B)). Analysis of melt curves for reference and PolA1 after qRT-PCR showed single peaks that indicate specific target amplification.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>HIGS strategy against parasitic nematodes employs an in planta approach in which susceptible host plants are engineered to express dsRNA of essential nematode genes and deliver resultant siRNAs to the feeding pests. These small regulatory RNAs achieve silencing of targeted endogenous gene transcripts in the nematodes and confer protection on host plants [<xref ref-type="bibr" rid="scirp.92720-ref20">20</xref>] . In this study, we targeted M. incognita PolA1 gene for HIGS considering that it plays a crucial role in protein synthesis and its effective silencing in eukaryotes (including nematodes) could lead to deleterious effects. We constructed pANDA35HK: MiS plant expression vector to integrate MiS target sequence in sense and anti-sense orientations (<xref ref-type="fig" rid="fig1">Figure 1</xref>(B)) such that upon expression, would produce MiSdsRNA.</p><p>We confirmed successful transformation of tobacco with this silencing construct via PCR and Southern blot analyses (<xref ref-type="fig" rid="fig3">Figure 3</xref>(A) and <xref ref-type="fig" rid="fig3">Figure 3</xref>(B)). We also showed evidence of expression of MiS dsRNA via RT-PCR amplification of the GUS linker between the target sequences in the transgenic lines (<xref ref-type="fig" rid="fig3">Figure 3</xref>(C)). Production of dsRNAs triggers eukaryotic cellular RNA silencing machinery [<xref ref-type="bibr" rid="scirp.92720-ref21">21</xref>] , thus MiS dsRNAs can activate RNAi events in the transgenic tobacco. Detection of MiS siRNAs in the transformed plants (<xref ref-type="fig" rid="fig4">Figure 4</xref>) is a confirmation that MiS dsRNAs produced by the transgenic plants were processed by dicer into siRNAs. Inplanta-produced siRNAs act as mediators of gene silencing via facilitation of the degradation of complementary genes’ transcripts in invading parasites [<xref ref-type="bibr" rid="scirp.92720-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.92720-ref22">22</xref>] .</p><p>Nematode bioassay results showed that all tested plants (transgenic and WT) had nematode galls on their roots and none of the transgenic lines exhibited complete resistance to root knot infection. However, reduced gall indices on T<sub>0</sub> and T<sub>1</sub> transgenic lines (<xref ref-type="fig" rid="fig5">Figure 5</xref>(A), <xref ref-type="fig" rid="fig8">Figure 8</xref>(B)) is an evidence of superior root reaction to nematode infection among the transgenic lines, which according to [<xref ref-type="bibr" rid="scirp.92720-ref19">19</xref>] depicts a relative indication of resistance. Our T<sub>0</sub> and T<sub>1</sub> transgenic tobacco showed reduced nematode egg masses (<xref ref-type="fig" rid="fig9">Figure 9</xref>(A)), and eggs per mass compared to wild type plants (<xref ref-type="fig" rid="fig5">Figure 5</xref>(C), <xref ref-type="fig" rid="fig8">Figure 8</xref>(C), <xref ref-type="fig" rid="fig8">Figure 8</xref>(D)). This finding indicates a higher level of resistance due to reduced reproductive ability of nematodes on the transgenic lines. Reduction in the amount of root knot nematode DNA in soil on which T<sub>0</sub> transgenic plants were grown compared to wild type (<xref ref-type="fig" rid="fig5">Figure 5</xref>(D)) as well as reduced parasite multiplication on T<sub>1</sub> plants (<xref ref-type="fig" rid="fig8">Figure 8</xref>(E)) are complementary data that provide evidence of restrained parasite propagation. This is proof of some resistance in plants expressing nematode MiS dsRNA. Suppressed nematode reproduction and development is a phenotype that is consistent with previous successful HIGS studies using different target genes like MSP [<xref ref-type="bibr" rid="scirp.92720-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.92720-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.92720-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.92720-ref26">26</xref>] .</p><p>All T<sub>0</sub> transgenic lines except T4 showed superiority in agronomic vigour and susceptibility to disease conditions compared to WT plants (Figures 6(A)-(D), Figures 7(A)-(D)). This indicates their relative resistance to a disease complex initiated by nematode infection and compounded by other secondary pathogens. Nematodes are known to have both direct and indirect effects on tobacco plants particularly. Indirect effects include the ability of nematodes to increase the susceptibility of the plant to other diseases such as brown spot and blank shank diseases [<xref ref-type="bibr" rid="scirp.92720-ref27">27</xref>] [<xref ref-type="bibr" rid="scirp.92720-ref28">28</xref>] . The weaker phenotype of T4 lines may have to do with reduced amount of processed MiS siRNAs (<xref ref-type="fig" rid="fig4">Figure 4</xref>), which in turn reduced plant protection against nematode-initiated disease complex. Small interfering RNAs are known to mediate the RNA silencing machinery which down-regulates target gene transcripts in the parasites resulting in attenuated development and reduced host parasitism [<xref ref-type="bibr" rid="scirp.92720-ref29">29</xref>] . Reduced silencing efficiency due to relatively low siRNA production may be attributable in part to inefficient processing of PolA1 dsRNA to siRNAs by dicer enzymes. Moderate silencing of NtFAD3 gene in tobacco was attributed to inefficient dsRNA processing by dicer [<xref ref-type="bibr" rid="scirp.92720-ref30">30</xref>] .</p><p>T<sub>1</sub> tobacco plants, however, were comparable to WT in agronomic traits evaluated after 35 days of nematode infection (Figures 9(B)-(D)). We attribute this result to the low amount of inoculum (500 eggs) used to induce infection since higher inoculum can usually induce greater pest pressure and disease condition in the host plants [<xref ref-type="bibr" rid="scirp.92720-ref19">19</xref>] . Unlike T<sub>0</sub> plants infection where 10,000 eggs were used, we used 20 times lesser eggs with T1 plants due to their relatively young age at infection. This concentration seems inadequate to produce distinguishable agronomic data in the plants at 35 days post infection. Longer exposure to nematodes may be required for optimum nematode multiplication and plant stress induction.</p><p>Feeding nematodes isolated from roots of transgenic tobacco plants showed significant reduction of MiS transcripts relative to those on WT (<xref ref-type="fig" rid="fig1">Figure 1</xref>0(B)). Down-regulation of target gene transcripts in parasites has been characterized as an indicator of effective host induced RNAi in transgenic plants [<xref ref-type="bibr" rid="scirp.92720-ref29">29</xref>] . Effective silencing of PolA1 gene in the feeding nematodes provides evidence of uptake of small regulatory RNAs from the transgenic plants. It further corroborates the enhanced suppression of nematode multiplication in the transgenic plants showing that PolA1 plays a crucial reproductive and developmental function in these pests.</p><p>According to [<xref ref-type="bibr" rid="scirp.92720-ref12">12</xref>] , a good candidate gene for HIGS to achieve durable resistance must be one for which the host pest or pathogen cannot risk its mutation. PolA1 satisfies this requirement due to its single copy existence and essentiality in eukaryotic survival. Hence, although some previously evaluated candidate genes [<xref ref-type="bibr" rid="scirp.92720-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.92720-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.92720-ref31">31</xref>] showed greater potency for nematode control than was obtained in this study with PolA1, the potential durability of PolA1-conferred resistance will be a crucial benefit for crop production. The high homology of our target sequence among Meloidogyne species is an additional benefit that can extend durable resistance across all root knot species in the Meloidogyne genus.</p></sec><sec id="s5"><title>5. Conclusion</title><p>In this study, we have shown that transgenic tobacco plants expressing MiSdsRNA of root knot nematode PolA1 gene processed regulatory siRNAs and knocked down PolA1 transcript expression in feeding nematodes. T1 and T7 transgenic lines showed reduced nematode damage and improved agronomic vigor possibly due to host induced PolA1 silencing in the nematode pests. Targeting PolA1 gene for silencing in pathogens may thus be an effective strategy for molecular-based plant protection. However, it is important to aim at improving the resistance obtained in this study by using other RNAi vectors containing intron linkers for increased siRNA processing and improved silencing efficiency.</p></sec><sec id="s6"><title>Acknowledgements</title><p>The authors are grateful to Dr. Hiroyuki Tsuji of the Kihara Institute of Biological Research, Yokohama City University, Japan for kindly providing pANDA35HK RNAi binary vector. We also appreciate the Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT) for the award of scholarship to P. N. Chukwurah.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s8"><title>Cite this paper</title><p>Chukwurah, P.N., Poku, S.A., Yokoyama, A., Takeda, A., Shishido, M. and Nakamura, I. (2019) Mitigating Root Knot Nematode Propagation on Transgenic Tobacco via in Planta Hairpin RNA Expression of Meloidogyne incognita—Specific PolA1 Sequence. American Journal of Plant Sciences, 10, 866-884. https://doi.org/10.4236/ajps.2019.105062</p></sec></body><back><ref-list><title>References</title><ref id="scirp.92720-ref1"><label>1</label><mixed-citation publication-type="book" xlink:type="simple">Abd-Elgawad, M.M.M. and Askary, T.H. (2015) Impact of Phytonematodes on Agriculture Economy. In: Askary, T.H. and Martinelli, P.R.P., Eds., Biocontrol Agents of Phytonematodes, CABI, Wallington, 1-49.  
https://doi.org/10.1079/9781780643755.0003</mixed-citation></ref><ref id="scirp.92720-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Ajjappala, H., Sim, J. and Hahn, B. (2012) RNA Interference Silencing in Root Knot Nematodes. Korean Journal of International Agriculture, 24, 485-493.</mixed-citation></ref><ref id="scirp.92720-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Fuller, V.L., Lilley, C.J. and Urwin, P.E. (2008) Nematode Resistance. New Phytologist, 180, 27-44. https://doi.org/10.1111/j.1469-8137.2008.02508.x</mixed-citation></ref><ref id="scirp.92720-ref4"><label>4</label><mixed-citation publication-type="book" xlink:type="simple">Atkinson, H.J. (1995) Plant Nematode Interactions: Molecular and Genetic Basis. In: Kohmoto, K., Singh, U.S. and Singh, R.P., Eds., Pathogenesis and Host Specificity in Plant Diseases: Histopathological, Biochemical, Genetic and Molecular Bases, Pergamon Press, Oxford, 355-369.</mixed-citation></ref><ref id="scirp.92720-ref5"><label>5</label><mixed-citation publication-type="book" xlink:type="simple">Thomas, C. and Cottage, A. (2006) Genetic Engineering for Resistance. In: Perry, R.N. and Moens, M., Eds., Plant Nematology, CABI, Wallington, 255-272.  
https://doi.org/10.1079/9781845930561.0255</mixed-citation></ref><ref id="scirp.92720-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Yadav, B.C., Veluthambi, K. and Subramaniam, K. (2006) Host-Generated Double Stranded RNA Induces RNAi in Plant-Parasitic Nematodes and Protects the Host from Infection. Molecular and Biochemical Parasitology, 148, 219-222.  
https://doi.org/10.1016/j.molbiopara.2006.03.013</mixed-citation></ref><ref id="scirp.92720-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Huang, G., Allen, R., Davis, E.L., Baum, T.J. and Hussey, R.S. (2006) Engineering Broad Range Root-Knot Resistance in Transgenic Plants by RNAi Silencing of a Conserved and Essential Root-Knot Nematode Parasitism Gene. Proceedings of the National Academy of Science, 103, 39. https://doi.org/10.1073/pnas.0604698103</mixed-citation></ref><ref id="scirp.92720-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Xue, B., Hamamouch, N., Li, C., Huang, G., Hussey, R.S., Baum, T.J. and Davis, E.L. (2013) The 8D05 Parasitism Gene of Meloidogyne incognita Is Required for Successful Infection of Host Roots. Phytopathology, 103, 175-181.  
https://doi.org/10.1094/PHYTO-07-12-0173-R</mixed-citation></ref><ref id="scirp.92720-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Hirai, S. and Kodama, H. (2008) RNAi Vectors for Manipulation of Gene Expression in Higher Plants. The Open Plant Science Journal, 2, 21-30.  
https://doi.org/10.2174/1874294700801010021</mixed-citation></ref><ref id="scirp.92720-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Papolu, P.K., Gantasala, N.P., Kamaraju, D., Banakar, P., Sreevathsa, R. and Rao, U. (2013) Utility of Host Delivered RNAi of Two FMRF Amide like Peptides, flp-14 and flp-18, for the Management of Root Knot Nematode, Meloidogyne incognita. PLoS ONE, 8, e80603. https://doi.org/10.1371/journal.pone.0080603</mixed-citation></ref><ref id="scirp.92720-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Rich, J.R. and Kinloch, R.A. (2005) Tobacco Nematode Management. Institute of Food and Agricultural Sciences, University of Florida, Gainesville.</mixed-citation></ref><ref id="scirp.92720-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Mitkowski, N.A. and Abawi, G.S. (2003) Root-Knot Nematodes. The Plant Health Instructor. https://doi.org/10.1094/PHI-I-2003-0917-01</mixed-citation></ref><ref id="scirp.92720-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Lourenco-Tessutti, I.T., Souza Junior, J.D.A., Martins-de-Sa, D., Viana, A.A.B., Carneiro, R.M.D.G., Togawa, R.C., de Almeida-Engler, J., Batista, J.A.N., Silva, M.C.M., Fragoso, R.R. and Grossi-de-Sa, M.F. (2015) Knock-Down of Heat-Shock Protein 90 and Isocitrate Lyase Gene Expression Reduced Root-Knot Nematode Reproduction. Phytopathology, 105, 628-637.  
https://doi.org/10.1094/PHYTO-09-14-0237-R</mixed-citation></ref><ref id="scirp.92720-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Antonio de Souza Junior, J.D., Ramos Coelho, R., Tristan Lourenco, I., da Rocha Fragoso, R., Barboso Viana, A.A., Pepino de Macedo, L.L., Mattar da Silva, M.C., Gomes Carneiro, R.M., Engler, G., Engler, J. and Grossi-de-Sa, M.F. (2013) Knocking down Meloidogyne incognita Proteases by Plant-Delivered dsRNA Has Negative Pleiotropic Effect on Nematode Vigor. PLoS ONE, 8, e85364.  
https://doi.org/10.1371/journal.pone.0085364</mixed-citation></ref><ref id="scirp.92720-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Li, J., Todd, T.C. and Trick, H.N. (2010) Rapid in Planta Evaluation of Root Expressed Transgenes in Chimeric Soybean Plants. Plant Cell Reports, 29, 113-123.  
https://doi.org/10.1007/s00299-009-0803-2</mixed-citation></ref><ref id="scirp.92720-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Steeves, R.M., Todd, T.C., Oakley, T.R., Lee, J. and Trick, H.N. (2006) Transgenic Soybeans Expressing siRNAs Specific to a Major Sperm Protein Gene Suppresses Heterodera glycines Reproduction. Functional Plant Biology, 33, 991-999.  
https://doi.org/10.1071/FP06130</mixed-citation></ref><ref id="scirp.92720-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Niu, J.H., Jian, H., Xu, J., Chen, C. and Guo, Q. (2012) RNAi Silencing of the Meloidogyne incognita Rpn7 Gene Reduced Nematode Parasitic Success. European Journal of Plant Pathology, 134, 131-144.  
https://doi.org/10.1007/s10658-012-9971-y</mixed-citation></ref><ref id="scirp.92720-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Mlotshwa, S., Pruss, G.J., Peragine, A., Endres, M.W., Li, J., Chen, X., Poethig, R.S., Bowman, L.H. and Vance, V. (2008) DICER-LIKE2 Plays a Primary Role in Transitive Silencing of Transgenes in Arabidopsis. PLoS ONE, 3, e1755.  
https://doi.org/10.1371/journal.pone.0001755</mixed-citation></ref><ref id="scirp.92720-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Banerjee, S., Banerjee, A., Gill, S.S., Gupta, O.P., Dahuja, A., Jain, P.K. and Sirohi, A. (2017) RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes. Frontiersin Plant Science, 8, 834.  
https://doi.org/10.3389/fpls.2017.00834</mixed-citation></ref><ref id="scirp.92720-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Coyne, D.L. and Ross, J.L. (2014) Protocol for Nematode Resistance Screening: Root Knot Nematodes, Meloidogyne spp. International Institute of Tropical Agriculture (IITA), Ibadan.</mixed-citation></ref><ref id="scirp.92720-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Bridge, J. and Page, S.L.J. (1980) Estimation of Root Knot Nematode Infestation Levels in Roots Using a Rating Chart. Tropical Pest Management, 26, 296-298.  
https://doi.org/10.1080/09670878009414416</mixed-citation></ref><ref id="scirp.92720-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Cruz-Mendivil, A., Rivera-Lopez, J., German-Baez, L.J., Lopez-Meyer, M., Hernandez-Verdugo, S., Lopez-Valenzuela, J.A., Reyes-Moreno, C. and Valdez-Ortiz, A. (2011) Transformation of Tomato cv. Micro-Tom from Leaf Explants. Hort Science, 46, 1655-1660. https://doi.org/10.21273/HORTSCI.46.12.1655</mixed-citation></ref><ref id="scirp.92720-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Rogers, S.O. and Bendichl, A.J. (1985) Extraction of DNA from Milligram Amounts of Fresh, Herbarium and Mummified Plant Tissues. Plant Molecular Biology, 5, 69-76. https://doi.org/10.1007/BF00020088</mixed-citation></ref><ref id="scirp.92720-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Ahmed, I., Islam, M., Arshad, W., Mannan, A., Ahmad, W. and Mirza, B. (2009) High-Quality Plant DNA Extraction for PCR: An Easy Approach. Journal of Applied Genetics, 50, 105-107. https://doi.org/10.1007/BF03195661</mixed-citation></ref><ref id="scirp.92720-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Kong, K., Ntui, V.O., Makabe, S., Khan, R.S., Mii, M. and Nakamura, I. (2014) Transgenic Tobacco and Tomato Plants Expressing Wasabi Defensin Genes Driven by Root-Specific LjNRT2 and AtNRT2.1 Promoters Confer Resistance against Fusarium oxysporum. Plant Biotechnology, 31, 89-96.  
https://doi.org/10.5511/plantbiotechnology.13.1209a</mixed-citation></ref><ref id="scirp.92720-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Nakamura, I. (2010) Method of Identifying Eukaryotic Species. JP2010088398.</mixed-citation></ref><ref id="scirp.92720-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Ghang, S.B. (2017) Host Induced Gene Silencing, an Emerging Science to Engineer Crop Resistance against Harmful Plant Pathogens. Physiological and Molecular Plant Pathology, 100, 242-254. https://doi.org/10.1016/j.pmpp.2017.10.003</mixed-citation></ref><ref id="scirp.92720-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Tamilarasan, S. and Rajam, M.V. (2013) Engineering Crop Plants for Nematode Resistance through Host-Derived RNA Interference. Cell and Developmental Biology, 2, 114. https://doi.org/10.4172/2168-9296.1000114</mixed-citation></ref><ref id="scirp.92720-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Ntui, V.O., Kong, K., Khan, R.S., Igawa, T., Janavi, G.J., Rabindran, R., Nakamura, I. and Mii, M. (2015) Resistance to Sri Lankan Cassava Mosaic Virus (SLCMV) in Genetically Engineered Cassava cv. KU50 through RNA Silencing. PLoS ONE, 10, e0120551. https://doi.org/10.1371/journal.pone.0120551</mixed-citation></ref><ref id="scirp.92720-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Shivakumara, T.N., Chaudhary, S., Kamaraju, D., Dutta, T.K., Papolu, P.K., Banakar, P., Sreevathsa, R., Singh, B., Manjaiah, K.M. and Rao, U. (2017) Host-Induced Silencing of Two Pharyngeal Gland Genes Conferred Transcriptional Alteration of Cell Wall Modifying Enzymes of Meloidogyne incognita vis-à-vis Perturbed Nematode Infectivity in Eggplant. Frontiers in Plant Science, 8, 473.  
https://doi.org/10.3389/fpls.2017.00473</mixed-citation></ref><ref id="scirp.92720-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Dutta, T.K., Papolu, P.K., Banakar, P., Choudhary, D., Sirohi, A. and Rao, U. (2015) Tomato Transgenic Plants Expressing Hairpin Construct of a Nematode Protease Gene Conferred Enhanced Resistance to Root Knot Nematodes. Frontiers in Microbiology, 6, 260. https://doi.org/10.3389/fmicb.2015.00260</mixed-citation></ref></ref-list></back></article>