<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AS</journal-id><journal-title-group><journal-title>Agricultural Sciences</journal-title></journal-title-group><issn pub-type="epub">2156-8553</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/as.2019.105052</article-id><article-id pub-id-type="publisher-id">AS-92636</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Earth&amp;Environmental Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Occurrence of Cassava Mosaic Begomovirus New Species and &lt;i&gt;Ageratum Leaf Curl Cameroon Virus&lt;/i&gt; on Pepper (&lt;i&gt;Capsicum annuum&lt;/i&gt; L.) in Togo
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Kodjovi</surname><given-names>Atassé Dansou-Kodjo</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Assion</surname><given-names>Sétu Mivedor</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Kossikouma</surname><given-names>Djodji Adjata</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jérôme</surname><given-names>Duclercq</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yawovi</surname><given-names>Mawuena Dieudonné Gumedzoe</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Laboratory of Plant Virology and Biotechnology (LVBV), Ecole Supérieure d’Agronomie (ESA), University of Lome, Lomé, Togo</addr-line></aff><aff id="aff2"><addr-line>Laboratory of Agroecology, Ecophysiology and Integrative Biology (AEB), Unit EDYSAN FRE 3498 CNRS/University of Picardie Jules Verne, Amiens, France</addr-line></aff><pub-date pub-type="epub"><day>09</day><month>05</month><year>2019</year></pub-date><volume>10</volume><issue>05</issue><fpage>671</fpage><lpage>682</lpage><history><date date-type="received"><day>1,</day>	<month>April</month>	<year>2019</year></date><date date-type="rev-recd"><day>24,</day>	<month>May</month>	<year>2019</year>	</date><date date-type="accepted"><day>27,</day>	<month>May</month>	<year>2019</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Cassava mosaic disease caused by the whitefly-transmitted begomoviruses (family 
  Geminiviridae) is a major threat to cassava (
  Manihot esculenta Crantz) production, which can be intercropped with other plants such as pepper (
  Capsicum annuum L.). The aim of this study is to identify cassava begomoviruses on other crops in cassava intercropping systems. Thus, foliar samples showing typical symptoms of virus diseases in cassava intercropping systems were collected from pepper and submitted to PCR analysis and direct sequencing. Three begomovirus species ACMV, EACMV and ALCCMV were identified and characterized in samples. Isolates of these species shared respectively 90% - 93%, 74% and 80% nucleotide identities with begomoviruses. These findings show that cassava begomoviruses can infect other crops and will help in understanding the epidemiology related to whitefly-transmitted begomoviruses in cassava intercropping systems.
 
</p></abstract><kwd-group><kwd>ACMV</kwd><kwd> ALCCMV</kwd><kwd> Begomovirus</kwd><kwd> EACMV</kwd><kwd> Pepper</kwd><kwd> Sequencing</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The most damaging and economically important diseases of crops, especially in tropical and subtropical regions are caused by the whitefly-transmitted begomoviruses. These viruses are included in the genus Begomovirus of the family Geminiviridae and are responsible for causing crop losses ranging from 30% to 100% [<xref ref-type="bibr" rid="scirp.92636-ref1">1</xref>] . Begomoviruses are single-stranded circular DNA viruses, which replicate in the nucleus of their host cells and are classified in monopartite or bipartite viruses depending on their genome organization [<xref ref-type="bibr" rid="scirp.92636-ref2">2</xref>] . They have emerged everywhere in the world where environmental conditions support large whitefly (Bemisia tabaci Genn.) populations and in Western Africa, emergence of begomoviruses is caused by genetically distinct species that have evolved locally [<xref ref-type="bibr" rid="scirp.92636-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.92636-ref4">4</xref>] .</p><p>Cassava mosaic disease (CMD) caused by whitefly-transmitted begomoviruses is the main factor of cassava (Manihot esculenta Crantz) decrease yields [<xref ref-type="bibr" rid="scirp.92636-ref5">5</xref>] . Eight cassava mosaic begomovirus species have been reported in Africa [<xref ref-type="bibr" rid="scirp.92636-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.92636-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.92636-ref8">8</xref>] of which three species affect cassava in Togo: ACMV (African cassava mosaic virus), EACMV (East African cassava mosaic virus) and ICMV (Indian cassava mosaic virus) [<xref ref-type="bibr" rid="scirp.92636-ref8">8</xref>] . Begomoviruses are also reported in pepper (Capsicum sp.) [<xref ref-type="bibr" rid="scirp.92636-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.92636-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.92636-ref10">10</xref>] which can be intercropped with cassava. Pepper is an important cash crop for smallholder farmers in developing countries. Among the five cultivated species of the genus Capsicum, Capsicum annuum (both hot and sweet pepper) is the most widely cultivated. In cassava production, pepper is often intercropped with it in Togo.</p><p>This study was initiated to identify cassava begomoviruses on other crops in cassava intercropping systems. Results of this study will help to better understand the disease epidemics, related to whitefly-transmitted begomoviruses as well as Bemisia tabaci biotypes behavior within these systems.</p></sec><sec id="s2"><title>2. Material and Methods</title><sec id="s2_1"><title>2.1. Foliar Sampling and DNA Extraction</title><p>Foliar samples from pepper plants intercropped with cassava showing typical symptoms of viral diseases (mosaic, distortion, leaf curling, yellowing and deformation) were collected through the five economic regions of Togo.</p><p>Total DNA was extracted from collected leaves using the DNA minipreparation method [<xref ref-type="bibr" rid="scirp.92636-ref11">11</xref>] .</p></sec><sec id="s2_2"><title>2.2. PCR Diagnosis</title><p>Detection of cassava mosaic begomoviruses (CMBs) in samples was performed by PCR amplification using three sets of specific primers targeting the coat protein (<xref ref-type="table" rid="table1">Table 1</xref>): JSP001/JSP002, JSP001/JSP003 and JSP012/JSP013 allow to identify respectively African cassava mosaic virus (ACMV), East African cassava mosaic virus (EACMV) and Indian cassava mosaic virus (ICMV) [<xref ref-type="bibr" rid="scirp.92636-ref12">12</xref>] . Another PCR was performed using begomoviruses coat protein specific primers AC1048/AV494 [<xref ref-type="bibr" rid="scirp.92636-ref13">13</xref>] to identify other begomoviruses apart from CMBs. PCR tests were done in the thermocycle “Mastercycle gradients Eppendorf (Hamburg, Germany). All PCR reactions were prepared in a 25 &#181;l reaction mixture containing: template DNA 2 &#181;l, dNTPs 0.5 &#181;l (200 &#181;M), primers 1.25 &#181;l (each), Taq polymerase 0.16 &#181;l (0.8 U), reaction buffer 2.5 &#181;l (1X), MgCl2 2.5 &#181;l (2.5 mM), BSA 0.5 &#181;L (0.4 &#181;g/&#181;L), and Sterile water 14.34 &#181;l.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >Sequence 5’……………………….…3’</th><th align="center" valign="middle" >Size (bp)</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle" >JSP001</td><td align="center" valign="middle" >ATGTCGAAGCGACCAGGAGAT</td><td align="center" valign="middle"  rowspan="5"  >770</td><td align="center" valign="middle"  rowspan="5"  >[<xref ref-type="bibr" rid="scirp.92636-ref12">12</xref>]</td></tr><tr><td align="center" valign="middle" >JSP002</td><td align="center" valign="middle" >TGTTTATTAATTGCCAATACT</td></tr><tr><td align="center" valign="middle" >JSP003</td><td align="center" valign="middle" >CCTTTATTAATTTGTCACTGC</td></tr><tr><td align="center" valign="middle" >JSP012</td><td align="center" valign="middle" >GTCCATATAGGTAARGTNATG</td></tr><tr><td align="center" valign="middle" >JSP013</td><td align="center" valign="middle" >CCTGCTCCTTGCTNGCYTART</td></tr><tr><td align="center" valign="middle" >AC 1048</td><td align="center" valign="middle" >GGRTTDGARGCATGHGTACATG</td><td align="center" valign="middle"  rowspan="2"  >560</td><td align="center" valign="middle"  rowspan="2"  >[<xref ref-type="bibr" rid="scirp.92636-ref13">13</xref>]</td></tr><tr><td align="center" valign="middle" >AV 494</td><td align="center" valign="middle" >GCCYATRTAYAGRAAGCCMAG</td></tr></tbody></table></table-wrap><p>D = A, G, T; H = A, C, T; K = G, T; M = A, C; N = A, C, G, T; R = A, G; W = A, T; Y = C, T.</p><p>The PCR thermal profile for CMBs was as followed: a 94˚C denaturation step of 2 min followed by 30 cycles of denaturing at 94˚C for 30 secs, annealing at (50˚C for ACMV and EACMV and 52˚C for ICMV) for 30 secs and extension at 72˚C for 1 min and then a final extension step at 72˚C for 10 min [<xref ref-type="bibr" rid="scirp.92636-ref12">12</xref>] . The PCR thermal profile with primers AC1048/AV494 was: a 94˚C denaturation step of 2 min followed by 35 cycles of denaturing at 94˚C for 1 min, annealing at 55˚C for 2 min and extension at 72˚C for 1 min and then a final extension step at 72˚C for 10 min [<xref ref-type="bibr" rid="scirp.92636-ref13">13</xref>] .</p><p>PCR amplified products were resolved by agarose gel electrophoresis and visualized under ultraviolet (UV) light using Gel Doc 2000 (Bio-Rad, Hercules, CA, USA). A 100 bp DNA molecular weight marker (Smart ladder small fragments Eurogentec) was run in each gel as a reference to estimate the size of the virus-specific DNA band in the PCR amplified products.</p></sec><sec id="s2_3"><title>2.3. DNA Sequencing and Phylogenetic Analysis</title><p>Illumina Nextera XT Index kit (Illumina Inc., San Diego, CA, USA) was used according to the manufacturer’s instructions to assign a code to each sample before the sequencing. Purity of the PCR products was verified with the Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA, USA) and the sequencing was performed at the UPJV Molecular Biology platform based on “Sequencing by Synthesis” technology. Illumina Miseq Reagent Kit V2 (Illumina Inc., San Diego, CA, USA) was used to perform this sequencing.</p><p>BLASTn program (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used for preliminary analysis [<xref ref-type="bibr" rid="scirp.92636-ref14">14</xref>] . Multiple sequence alignments were performed with ClustalX 2.1 [<xref ref-type="bibr" rid="scirp.92636-ref15">15</xref>] and pairwise nucleotide identities were calculated with SDT 1.2 software [<xref ref-type="bibr" rid="scirp.92636-ref16">16</xref>] .</p><p>Phylogenetic analysis was performed by Neighbor-Joining method using Darwin6. A thousand bootstrap replications, was used to evaluate the robustness of each individual branch. Tree was visualized and edited using Darwin6.</p><p>The nucleotide sequences of the following begomovirus (GenBank accession numbers are given) were included in the analysis: African cassava mosaic virus (AF259894.1, AY562423.1, EU685318.1, FM877473.1, HE979761.1, HG530111.1, KJ887779.1, KR476371.1, KR476372.1); East African cassava mosaic virus (AJ717553.1, HG530116.1); East African cassava mosaic Cameroon virus (AF112354.1, KJ887944.1); East African cassava mosaic Kenya virus (JF909078.1, KJ888087.1); East African cassava mosaic virus-Tanzania (Z82356.1); East African cassava mosaic virus-Uganda (KT780440.1); Ageratum leaf curl Cameroon virus (FR717144.1, FR873228.1, FR873230.1); Pepper yellow vein Mali virus (KY271076.1, FM876851.1, AM691555.1, AY502935.1) and Pepper golden mosaic virus (EF027236.1).</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Incidence Rate of Begomoviruses</title><p>A total of nineteen samples were collected (<xref ref-type="table" rid="table2">Table 2</xref>). Samples number was varied from one region to another, most of them were collected in Maritime and Plateaus regions, which are the main cassava production areas in Togo. In Kara region, during the collection, pepper was not found in association with cassava (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><p>PCR products with the expected size were amplified from collected samples with primers JSP001/JSP003 and AC1048/AV494 confirming the association of begomovirus with symptoms. This indicates in addition, that pepper is natural infected by East African cassava mosaic virus (EACMV). Based on PCR results with primers JSP001/JSP003 and AC1048/AV494, 10.53% and 26.31% of samples were respectively infected (<xref ref-type="table" rid="table2">Table 2</xref>). African cassava mosaic virus and Indian cassava mosaic virus were not identified in none sample respectively with primers sets JSP001/JSP002 and JSP012/JSP013.</p></sec><sec id="s3_2"><title>3.2. Sequence Analysis and Comparison</title><p>PCR products were submitted to direct sequencing. Three sequences obtained from these products were selected for phylogenetic and pairwise nucleotide analysis</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Incidence rate of begomoviruses</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Region</th><th align="center" valign="middle"  rowspan="2"  >Locality</th><th align="center" valign="middle"  rowspan="2"  >Sample number</th><th align="center" valign="middle"  colspan="4"  >Samples reaction to PCR</th></tr></thead><tr><td align="center" valign="middle" >JSP001/ JSP002</td><td align="center" valign="middle" >JSP001/ JSP003</td><td align="center" valign="middle" >JSP012/ JSP013</td><td align="center" valign="middle" >AC1048/ AV494</td></tr><tr><td align="center" valign="middle" >Maritime</td><td align="center" valign="middle" >Lome</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >Maritime</td><td align="center" valign="middle" >Alokoegbe</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Maritime</td><td align="center" valign="middle" >Gblainvie</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Maritime</td><td align="center" valign="middle" >Alokoegbe</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Maritime</td><td align="center" valign="middle" >Blama Kondji</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+ (Isolate B51)</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >Maritime</td><td align="center" valign="middle" >Blama Kondji</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Maritime</td><td align="center" valign="middle" >Game</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Plateaus</td><td align="center" valign="middle" >Tikoe/Agou Agotime</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Plateaus</td><td align="center" valign="middle" >Tikoe/Agou Agotime</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Plateaus</td><td align="center" valign="middle" >Koudravi</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Plateaus</td><td align="center" valign="middle" >Tokudjahoui</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Plateaus</td><td align="center" valign="middle" >Tokudjahoui</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >Plateaus</td><td align="center" valign="middle" >Houdje</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Plateaus</td><td align="center" valign="middle" >Kougnonhou</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >Plateaus</td><td align="center" valign="middle" >Amouka</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Plateaus</td><td align="center" valign="middle" >Kessibo/Dandjodji</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Savannah</td><td align="center" valign="middle" >Nabou (Biangou)</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Savannah</td><td align="center" valign="middle" >Kambere</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+ (Isolates G44a and G44b)</td></tr><tr><td align="center" valign="middle" >Central</td><td align="center" valign="middle" >Bowou Kope</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle"  colspan="3"  >Incidence (%)</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >10.53</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >26.31</td></tr></tbody></table></table-wrap><p>- = Sample reacted negatively to PCR; + = Samples reacted positively to PCR.</p><p>(<xref ref-type="table" rid="table2">Table 2</xref>). The criteria used to distinguish between different viruses are: 90% - 100% for isolates, 80% - 90% for strains and less than 80% for species demarcation [<xref ref-type="bibr" rid="scirp.92636-ref17">17</xref>] .</p><p>Sequence comparisons revealed that isolate B51 from primers JSP001/JSP003 specifics to East African cassava mosaic virus (EACMV), shared the highest sequence identity (74%) with EACMV AJ717553.1; but also, with African cassava mosaic virus (ACMV) KJ887779.1 and Pepper yellow vein Mali virus (PepYVMV) isolates AM691555.1, AY502935.1 and KY271076.1 (<xref ref-type="fig" rid="fig2">Figure 2</xref>). Thus, the new strain of EACMV found in pepper seemed to be related to ACMV and PepYVMV species. This finding is supported by the phylogenetic analysis which showed isolate B51 forming a distinguish group with isolate G44a. Both isolates were closely related to group of Ageratum leaf curl Cameroon virus (ALCCMV) (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p><p>Isolates G44a and G44b from primers AC1048/AV494 shared high level of nucleotides identity respectively with Ageratum leaf curl Cameroon virus (ALCCMV) isolate FR873230.1 (80%) and ACMV AF259894.1 (93%). Isolate</p><p>G44b also shared 90% identity with EAMCV references (HG530116.1 and KT780440.1) (<xref ref-type="fig" rid="fig2">Figure 2</xref>). These results show that isolate G44a is an Ageratum leaf curl Cameroon virus and isolate G44b would be a recombinant of African cassava mosaic virus and East African cassava mosaic virus. In the phylogenetic tree, isolate G44b formed a distinguish group (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>This study has demonstrated three unknown infections of begomovirus in pepper foliar samples including Ageratum leaf curl Cameroon virus (ALCCMV), a new strain of East African cassava mosaic virus (EACMV) and a recombinant of African cassava mosaic virus (ACMV) and EACMV.</p><p>Diagnosis of cassava mosaic begomoviruses (ACMV and EACMV) in pepper showed that these begomoviruses could infect other crop species than cassava. This is the first identification and characterization of begomoviruses responsible of cassava mosaic disease in another cultivated plant in Togo. The ability of begomoviruses to infect plants belonging to different taxonomic families has been studied. Indeed, Tomato yellow spot virus (ToYSV) can infect tomato (Solanaceae) and soybean (Fabaceae); likewise, Tomato leaf curl New Delhi virus (ToLCNDV) infects Solanaceae and Cucurbitaceae [<xref ref-type="bibr" rid="scirp.92636-ref18">18</xref>] .</p><p>It is known that genomic plasticity of begomoviruses allows them to adapt to new environments and hosts [<xref ref-type="bibr" rid="scirp.92636-ref19">19</xref>] and results found here suggest the presence of polyphagous biotypes in populations of Bemisia tabaci vector of these viruses which can colonize with efficiency cassava and pepper plants. In addition, climate changes directly affect insect behavior, fertility, development and survival or indirectly affect insect by changes in trophic relationships [<xref ref-type="bibr" rid="scirp.92636-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.92636-ref21">21</xref>] . Pepper samples were all collected in cassava intercropping systems, which means that in fields where cassava and pepper plants were both present. Hence, the polyphagous biotype could easily visit infected cassava plants and transmit cassava virus to pepper plants by feeding on them. [<xref ref-type="bibr" rid="scirp.92636-ref22">22</xref>] found that the emergence of new begomoviruses might be occurring in relationship with some factors like evolution of new virus variants, the appearance of efficient vectors, changes in intercropping systems, introduction of susceptible plant varieties, and changes in climatic conditions. Isolates G44a and G44b found here were both recombinants.</p><p>A general consensus exists that Bemisia tabaci is a complex of morphologically indistinguishable populations with different biological biotypes. The cassava biotype of Bemisia tabaci is known to colonize only cassava and wild eggplant whereas the sweet potato biotype colonizes various plant and weed species but not cassava [<xref ref-type="bibr" rid="scirp.92636-ref23">23</xref>] . But recent work showed that, the sweet potato biotype of Bemisia tabaci can colonize cassava. In fact, different species of Bemisia tabaci were reported to have cassava and other crops together as host plants [<xref ref-type="bibr" rid="scirp.92636-ref24">24</xref>] . In particular, SSA3 species was found on cassava, cotton, eggplant, groundnut and tomato [<xref ref-type="bibr" rid="scirp.92636-ref25">25</xref>] . In the same way, MED-Q1 adults, larvae, and nymphs were collected on cassava [<xref ref-type="bibr" rid="scirp.92636-ref26">26</xref>] . The capacity of biotype B to adapt gradually to cassava was studied by [<xref ref-type="bibr" rid="scirp.92636-ref27">27</xref>] . These authors found that the biotype B of the insect adaptation started on Phaseolus vulgaris, followed on Euphorbiaceae plants until finally reaching a commercial cassava variety.</p><p>In cassava intercropping systems, these intermediate hosts or plants belonging to the same family are used as secondary crops associated with cassava and weeds can belong to Fabaceae and Euphorbiaceae families. [<xref ref-type="bibr" rid="scirp.92636-ref28">28</xref>] showed that ACMV and EACMV infect naturally other plant species than cassava namely Senna occidentalis (L.), Leucaena leucocephala (Lam.), Combretum confertum (Benth.) and Manihot glaziovii (M&#252;ll.Arg). Apart from wild cassava (M. glaziovii), [<xref ref-type="bibr" rid="scirp.92636-ref29">29</xref>] also identified EACMV on Albizia zygia (DC.), Senna obtusifolia (L.), Pupalia lappacea (L) and Strophanthus hispidus (DC.). Furthermore, Uganda variant EACMV-UG has been detected in a Jatropha curcas (L.) [<xref ref-type="bibr" rid="scirp.92636-ref30">30</xref>] . However, it is important to note that none of these authors had identified EACMV (East African cassava mosaic virus), in another crop outside cassava.</p><p>Ageratum leaf curl Cameroon virus was first identified on Ageratum conyzo&#239;des (L.) in Cameroon [<xref ref-type="bibr" rid="scirp.92636-ref31">31</xref>] and reported in Togo on tomato [<xref ref-type="bibr" rid="scirp.92636-ref32">32</xref>] . The identification of this begomovirus on pepper now approved that this begomovirus can infect more than one host including weeds as well as cultivated plants.</p><p>Occurrence of new begomovirus species on pepper could lead in case of mixed infections with already known begomoviruses infecting this crop to recombinant actions [<xref ref-type="bibr" rid="scirp.92636-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.92636-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.92636-ref33">33</xref>] . This situation might result in increasing begomovirus emergence in cassava intercropping systems.</p></sec><sec id="s5"><title>5. Conclusion</title><p>This study showed that cassava mosaic begomoviruses could infect other cultivated plants than cassava and suggested a change in Bemisia tabaci population or in its feed habit. Further investigations will bring more information about cassava mosaic begomoviruses and pepper relationships.</p></sec><sec id="s6"><title>Acknowledgements</title><p>This work was supported by International Foundation of Science (IFS) research grant C/5596-1 to K.A. Dansou-Kodjo; and by West African Virus Epidemiology for Togo (WAVE-UL) project.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s8"><title>Cite this paper</title><p>Dansou-Kodjo, K.A., Mivedor, A.S., Adjata, K.D., Duclercq, J. and Gumedzoe, Y.M.D. (2019) Occurrence of Cassava Mosaic Begomovirus New Species and Ageratum Leaf Curl Cameroon Virus on Pepper (Capsicum annuum L.) in Togo. Agricultural Sciences, 10, 671-682. https://doi.org/10.4236/as.2019.105052</p></sec></body><back><ref-list><title>References</title><ref id="scirp.92636-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Pita, J.S., Fondong, V.N., Sangare, A., Otim-Nape, G.W., Ogwal, S. and Fauquet, C.M. (2001) Recombination, Pseudo Recombination and Synergism of Geminiviruses Are Determinant Keys to the Epidemic of Severe Cassava Mosaic Disease in Uganda. Journal of General Virology, 82, 655-665.  
https://doi.org/10.1099/0022-1317-82-3-655</mixed-citation></ref><ref id="scirp.92636-ref2"><label>2</label><mixed-citation publication-type="book" xlink:type="simple">Stanley, J., Bisaro, D.M., Briddon, R.W., Brown, J.K., Fauquet, C.M., Harrison, B.D., Rybicki, E.P. and Stenger, D.C. (2005) Geminiviridae. In: Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U. and Ball, L.A., Eds., Virus Taxonomy, 8th Report of the International Committee on Taxonomy of Viruses, Elsevier Academic Press, London, 301-326.</mixed-citation></ref><ref id="scirp.92636-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Mansoor, S., Briddon, R.W., Zafar, Y. and Stanley, J. (2003) Geminivirus Disease Complexes: An Emerging Threat. Trends in Plant Science, 8, 128-134.  
https://doi.org/10.1016/S1360-1385(03)00007-4</mixed-citation></ref><ref id="scirp.92636-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Zhou, Y.C., Noussourou, M., Kon, T., Rojas, M.R., Jiang, H., Chen, L.F., Gamby, K., Foster, R. and Gilbertson, R.L. (2008) Evidence of Local Evolution of Tomato Infecting Begomovirus Species in West Africa: Characterization of Tomato Leaf Curl Mali Virus and Tomato Yellow Leaf Crumple Virus from Mali. Archives of Virology, 153, 693-706. https://doi.org/10.1007/s00705-008-0042-9</mixed-citation></ref><ref id="scirp.92636-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Alabi, O.J., Kumar, P.L. and Naidu, R.A. (2011) Cassava Mosaic Disease: A Curse to Food Security in Sub-Saharan Africa. APSnet Feature.</mixed-citation></ref><ref id="scirp.92636-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Fauquet, C.M., Briddon, R.W., Brown, J.K., Moriones, E., Stanley, J., Zerbini, M. and Zhou, X. (2008) Geminivirus Strain Demarcation and Nomenclature. Archives of Virology, 153, 783-821. https://doi.org/10.1007/s00705-008-0037-6</mixed-citation></ref><ref id="scirp.92636-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Adjata, K.D., Muller, E., Peterschmitt, M., Aziadekey, M. and Gumedzoe, Y.M.D. (2010) Incidence of Cassava Viral Diseases ANS First Identification of East African Cassava Mosaic Virus and Indian Cassava Mosaic Virus by PCR in Cassava (Manihot Exculenta Crantz) Fields in Togo. American Journal of plant Physiology, 5, 94-101. https://doi.org/10.3923/ajpp.2008.73.80</mixed-citation></ref><ref id="scirp.92636-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Patil, B.L. and Fauquet, C.M. (2009) Review: Cassava Mosaic Geminiviruses: Actual Knowledge and Perspectives. Molecular Plant Pathology, 10, 685-701.  
https://doi.org/10.1111/j.1364-3703.2009.00559.x</mixed-citation></ref><ref id="scirp.92636-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Séka, K., Ouattara, A., Assiri, K.P., Kra, K.D., Hoareau, M., Lefeuvre, P., Atta Diallo, H. and Lett, J.M. (2017) First Report of Pepper Yellow Vein Mali Virus Associated with Pepper Yellow Vein Disease in Cote d’Ivoire. New Disease Reports, 35, 11.  
https://doi.org/10.5197/j.2044-0588.2017.035.011</mixed-citation></ref><ref id="scirp.92636-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Tiendrébéogo, F., Traoré, V.S.E., Barro, N., Traoré, A.S., Konaté, G. and Traoré, O. (2008) Characterization of Pepper Yellow Vein Mali Virus in Capsicum sp. in Burkina Faso. Plant Pathology Journal, 7, 155-161.  
https://doi.org/10.3923/ppj.2008.155.161</mixed-citation></ref><ref id="scirp.92636-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Dellaporta, S.L., Wood, J. and Hicks, H.B. (1983) A Plant DNA Minipreparation: Version II. Plant Molecular Biology Reporter, 14, 19-21.  
https://doi.org/10.1007/BF02712670</mixed-citation></ref><ref id="scirp.92636-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Fondong, V.N., Pita, J.S., Rey, M.E.C., DeKochko, A., Beachy, R.N. and Fauquet, C.M. (2000) Evidence of Synergism between African Cassava Mosaic Virus and a New Double Recombinant Geminivirus Infecting Cassava in Cameroon. Journal of general Virology, 81, 287-297. https://doi.org/10.1099/0022-1317-81-1-287</mixed-citation></ref><ref id="scirp.92636-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Wyatt, S.D. and Brown, J.K. (1996). Detection of Subgroup III Geminivirus Isolates in Leaf Extracts by Degenerate Primers and Polymerase Chain Reaction. Phytopathology, 86, 1288-1293. https://doi.org/10.1094/Phyto-86-1288</mixed-citation></ref><ref id="scirp.92636-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Altschul, S.F., Madden, T.L., Sch&amp;#228;ffer, A.A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs. Nucleic Acids Research, 25, 3389-402.  
https://doi.org/10.1093/nar/25.17.3389</mixed-citation></ref><ref id="scirp.92636-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J. and Higgins, D.G. (2007) Clustal W and Clustal X Version 2.0. Bioinformatics, 23, 2947-2948. https://doi.org/10.1093/bioinformatics/btm404</mixed-citation></ref><ref id="scirp.92636-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Muhire, B.M., Varsani, A. and Martin, D.P. (2014) SDT: A Virus Classification Tool Based on Pairwise Sequence Alignment and Identity Calculation. PLoS ONE, 9, e108277. https://doi.org/10.1371/journal.pone.0108277</mixed-citation></ref><ref id="scirp.92636-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Padidam, M., Beachy, R.N. and Fauquet, C.M. (1995) Classification and Identification of Geminiviruses Using Sequence Comparisons. Journal of General Virology, 76, 249-263. https://doi.org/10.1099/0022-1317-76-2-249</mixed-citation></ref><ref id="scirp.92636-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Fortes, I.M., Sánchez-Campos, S., Fiallo-Olivé, E., Díaz-Pendón, J.A., Navas-Castillo, J. and Moriones, E. (2016) A Novel Strain of Tomato Leaf Curl New Delhi Virus Has Spread to the Mediterranean Basin. Viruses, 8, 307.  
https://doi.org/10.3390/v8110307</mixed-citation></ref><ref id="scirp.92636-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Navas-Castillo, J., Fiallo-Olive, E. and Sanchez-Campos, S. (2011) Emerging Virus Diseases Transmitted by Whiteflies. Annual Review of Phytopathology, 49, 219-248.  
https://doi.org/10.1146/annurev-phyto-072910-095235</mixed-citation></ref><ref id="scirp.92636-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Garrett, K.A., Dendy, S.P., Frank, E.E., Rouse, M.N. and Travers, S.E. (2006) Climate Change Effects on Plant Disease: Genomes to Ecosystems. The Annual Review of Phytopathology, 44, 489-509.  
https://doi.org/10.1146/annurev.phyto.44.070505.143420</mixed-citation></ref><ref id="scirp.92636-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Curnutte, L.B., Simmons, A.M. and Abd-Rabou, S. (2014) Climate Change and Bemisia tabaci (Hemiptera: Aleyrodidae): Impacts of Temperature and Carbon Dioxide on Life History. Annals of the Entomological Society of America, 107, 933-943.  
https://doi.org/10.1603/AN13143</mixed-citation></ref><ref id="scirp.92636-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Varma, A. and Malathi, V.G. (2003) Emerging Geminivirus Problems: A Serious Threat to Crop Production. Annals of Applied Biology, 142, 145-164.  
https://doi.org/10.1111/j.1744-7348.2003.tb00240.x</mixed-citation></ref><ref id="scirp.92636-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Burban, C., Fishpool, L.D.C., Fauquet, C., Fargette, D. and Thouvenel, J.C. (1992) Host Associated Biotypes within West African Populations of the Whitefly Bemisia tabaci (Genn.), (Hom., Aleyrodidae). Journal of Applied Entomology, 113, 416-423.  
https://doi.org/10.1111/j.1439-0418.1992.tb00682.x</mixed-citation></ref><ref id="scirp.92636-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Tajebe, L.S., Boni, S.B., Guastella, D., Cavalieri, V., Lund, O.S., Rugumamu, C.P., Rapisarda, C. and Legg, J.P. (2015) Abundance, Diversity and Geographic Distribution of Cassava Mosaic Disease Pandemic-Associated Bemisia tabaci in Tanzania. Journal of Applied Entomology, 139, 627-637. https://doi.org/10.1111/jen.12197</mixed-citation></ref><ref id="scirp.92636-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Tocko-Marabena, B.K., Silla, S., Simiand, C., Zinga, I., Legg, J., Reynaud, B. and Delatte, H. (2017) Genetic Diversity of Bemisia tabaci Species Colonizing Cassava in Central African Republic Characterized by Analysis of Cytochrome c Oxidase Subunit I. PLoS ONE, 12, e0182749. https://doi.org/10.1371/journal.pone.0182749</mixed-citation></ref><ref id="scirp.92636-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Romba, R., Gnankine, O., Drabo, S.F., Tiendrebeogo, F., Henri, H., Mouton, L. and Vavre, F. (2017) Abundance of Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) and Its Parasitoids on Vegetables and Cassava Plants in Burkina Faso (West Africa). Ecology and Evolution, 8, 6091-6103. https://doi.org/10.1002/ece3.4078</mixed-citation></ref><ref id="scirp.92636-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Carabalia, A., Bellottia, A.C., Montoya-Lermab, J. and Cuellara, M.E. (2005) Adaptation of Bemisia tabaci Biotype B (Gennadius) to Cassava, Manihot esculenta (Crantz). Crop Protection, 24, 643-649.  
https://doi.org/10.1016/j.cropro.2004.11.008</mixed-citation></ref><ref id="scirp.92636-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Alabi, O.J., Ogbe, F.O., Bandyopadhyay, R., Kumar, P.L., Dixon, A.G.O., Hughes, J.d’A. and Naidu, R.A. (2008) Alternate Hosts of African Cassava Mosaic Virus and East African Cassava Mosaic Cameroon Virus in Nigeria. Archives of Virology, 153, 1743-1747. https://doi.org/10.1007/s00705-008-0169-8</mixed-citation></ref><ref id="scirp.92636-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Adjata, K.D., Woegan, A.Y., Mivedor, A.S., Muller, E., Peterschmitt, M., Sanda, K. and Gumedzoe, Y.M.D. (2014) Wild Plants as Sources of the Permanency of Viruses Infecting Cultivated Plants: Case of Cassava Begomoviruses in Togo. American Journal of Biochemistry and Molecular Biology, 4, 136-142.  
https://doi.org/10.3923/ajbmb.2014.136.142</mixed-citation></ref><ref id="scirp.92636-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Ramkat, R., Calari, A., Maghuly, F. and Laimer, M. (2011) Occurrence of African Cassava Mosaic Virus (ACMV) and East African Cassava Mosaic Virus—Uganda (EACMV-UG) in Jatropha curcas. BMC Proceedings, 5, 93.  
https://doi.org/10.1186/1753-6561-5-S7-P93</mixed-citation></ref><ref id="scirp.92636-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Leke, W.N., Brown, J.K., Ligthart, M.E., Sattar, M.N., Njualem, D.K. and Kvarnheden, A. (2012) Ageratum Conyzoides: A Host to a Unique Begomovirus Disease Complex in Cameroon. Virus Research, 163, 229-237.  
https://doi.org/10.1016/j.virusres.2011.09.039</mixed-citation></ref><ref id="scirp.92636-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Mivedor, A.S., Dansou-Kodjo, K.A., Adjata, K.D., Duclercq, J. and Gumedzoe, Y.M.D. (2017) Molecular Characterization of Genetic Diversity of Tomato (Solanum lycopersicum L.) Begomovirus in Togo. Journal of General and Molecular Virology, 7, 1-9. https://doi.org/10.5897/JGMV2017.0070</mixed-citation></ref><ref id="scirp.92636-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Maruthi, M.N., Seal, S., Colvin, J., Briddon, R.W. and Bull, S.E. (2004) East African Cassava Mosaic Zanzibar Virus—A Recombinant Begomovirus Species with a Mild Phenotype. Archives of Virology, 149, 2365-2377.  
https://doi.org/10.1007/s00705-004-0380-1</mixed-citation></ref></ref-list></back></article>