Leaves of tomato with infected symptoms of late blight disease were collected from different fields in Iringa and Arusha regions of Tanzania, and used to isolate the pathogen causing late blight disease. In the laboratory the tissues of tomato leaves sample were washed with 2% sodium hypochlorite and 70% ethanol then rinsed with sterilized distilled water for 5 to 10 minutes, followed by blotting of excess moisture with a sterile blotting paper. The clarified V-8 agar (to make 1 litre, V8 juice 200 ml, agar 20 g, and CaCO₃ 2 g in 800 ml of dH₂O) amended with Rifampicin and rye agar was used as isolation medium. The pH of the isolation medium was 5.76. The medium was autoclaved at 121˚C and 15 psi for 15 minutes, allowed to cool to about 45˚C thereafter it was amended with antibiotics (2.5% Pimaricin aqueous solution and 20 mg/L Rifampicin SV sodium salt). Rifampicin was dissolved in small volume of ethanol then mixed with distilled water. Antibiotics were filtered by using ultrafilters-microfilters (Sartorius, Minisart® steril 600 kPa max.) before being added to the growth medium. After amendments, 25 - 30 mL of the medium was poured to each of the Petri dishes and allowed to solidify in the laminar hood. Each sample was divided into 1 cm segments whereby 4 segments were placed equidistantly on each of five Petri dishes (9 mm diameter) containing V8 agar amended with antibiotics. The inoculated plates were incubated at 20˚C and observations were made on 3^rd day whereby white colonies (cotton-like mycelia) characterized by water-like droplets were observed. The isolated fungi, Phytophthora infestans was purified by sub-culturing them onto molten rye agar and incubated at room temperature. Polymerase Chain Reaction (PCR) method used in the identification of the P. infestans. The primers that target the Internal Transcribed Spacer (ITS) with 600 bp were used. PINF (CTCGCTACAATAGGAGGGTC) Forward and ITS5b (GGAAGTAAAAGTCGTAACAAGG) reverse primer was used for PCR-based identification of fungal isolates based on procedure by [18] . The PCR premix was made up of 8.5 µl of water, 0.5 µl of PINF forward, 0.5 µl of ITS5b reverse and 3 µl of DNA and, was added mixed in 1.5 ml eppendorf tube.

Five important medicinal plants were selected from different field in Tanzania which has antimicrobial and antifungal activity with guiding principle of different researchers worldwide [13] . The plants collected included Tephrosia vogelii, Plectranthus barbatus, Sphaeranthus suaveolens and Lantana Camara as described in Table 1. The parts of the plant collected are only leaves as shown in Figure 1. Plant leaves, collected were air-dried (25˚C - 27˚C) for 10 days.

Screening of plant extract was conducted in laboratory conditions. For this purpose, 10 g of different plant powder was macerated with 100 ml of distilling water.

The exudation of biochemicals was kept overnight and biomass was filtered by using of standard What man No. 1 filter paper. Inhibition of different extracts to the pathogen (Poison food technique) was also determined in lab conditions. Plant extract at 3 mL of each stock solution was added in V8 juice media pour sterilized petri plates. The disc of 5 mm diameter of different fungi 3 days old culture was placed at the centre of Petri plates. Three replicates were kept for each treatment and incubated at room temperature. After the three days inoculation, radial growth of mycelium was measured and compared with the results of control. The following formula of inhibition percentage was applied for each fungus in treatment.

Inhibition percentage = Colony diameter without extract − Colony diameter with extract Colonydiameter without extarct × 100 %

Crude extracts from plant samples were extracted using the modified method [22] [23] . Plant sample materials were blended and for each sample 1 kg of dried extract was dissolved in 1 Litre of methanol and ethyl acetate respectively in the ratio of (1:1 wt/vol, dry powder/solvent) followed by soaking for 48 hrs. Then, the concentrate transferred from round flask to universal bottle and passed to nitrogen to remove the extraction solvent and the extract were kept to cool place.

Screening of the crude plant extracts for antimicrobial properties was done following modified procedures described by [22] [23] . V8 juice medium was prepared and cooled. Plant extracts were then incorporated at a ratio of (1 mL extract: 30 mL medium) per petri dish that means 3 mL of the dissolved extract were added to of 90 mL of molten V8 juice media, mixed and then poured equally into three 10 cm³ petri dishes. After the media had set, 5 mm agar discs cut from 14 day old fungal pathogen cultures were placed at the centre of the plate and incubated at room temperature. Positive control had meia amended with Otiva as chemical fungicide and negative control plates had media not amended with plant extracts. Observations were made at 48 and 72 hours after planting and antifungal activity was determined after measuring the fungal colony radial growth using the following formula shown at 2.2.

Aftre 5 mm diameter of the pathogen being placed to the centre of the petri dishes containing media and plant extracts the observation as made for 48 hours and 72 hours. There was no significance difference in incubation time on inhibiting the growth of the pathogen (Table 2).

The result from Table 2 showed that there was a significance different (P ≤ 0.001) among the plant extracts on the growth of P. infestans. However, all plants showed antifungal activity against Phytophthora infestans. From the tests of plant extracts, Plectranthus barbatus (94 ± 1.0) and Lantana camara (91 ± 2.4) were the best of all plant treatments and these were statistical similar to the positive control (97 ± 0.0) Table 2. This was followed by Sphaeranthus suaveolens (80 ± 3.4). In this study, Tephrosia vogelii extract showed poor results in inhibiting

Each value is a mean ± standard error of three replicates, *** = significant at P ≤ 0.001 and ns = not significant. Means within the same column followed by the same letter(s) are not not significantly different at (P = 0.05) from each other using Fishers Least Significant Different (LSD) test.

the mycelial growth of P. infestans (16 ± 3.5) as compared with other plant extracts. The negative control did not inhibit (0 ± 0.0) the mycelial growth of P. infestans.

Interactive effectiveness of the solvent and the plant extracts on inhibition of mycelial growth of the P. infestans was observed to be significantly different (P ≤ 0.001). It was revealed that, the combination of solvent and plant extracts strongly inhibited the growth of mycelia of P. infestans (Figure 2, Figure 3). In methanolic plant extracts to all of the three plants P. barbatus, L. camara and S. suaveolens inhibited the mycelial growth of the pathogen from 80% and above except T. vogelii which inhibited the growth of the pathogen below 18% as shown in Figure 4. In ethyl acetate plant extraction, the inhibition percentage of

was observed to be statistically similar with that of methanolic extract except that the inhibition by S. suaveolens was lowered to 70%.

The interactive effect of incubation time and plant extracts was observed and it was found to be significantly different (P ≤ 0.001). The combination of the incubation time and plant extracts strongly inhibited the growth of mycelia of the P. infestans. Our results revealed that, the three plant extracts, Plectranthus barbatus, Lantana camara and Sphaeranthus suaveolens were the best on inhibiting the mycelial growth of P. infestans and statistically similar between 48 hours and 72 hours. However, the performance of T. vogelii in inhibiting the growth of the P. infestans significantly decreased at 72 hours as compared with 48 hours as shown in Figure 4.

The nature of chemical solvent used in extracting the active compounds from the plants may dictate the quality of extracts yielded [24] [25] [26] [27] . In this study, methanol and ethyl acetateas polar and nonpolar solvent were used in extracting and preparing the crude extracts from the tested plants. Results from Table 2 reveals that, the methanolic plant extract was the best and significantly inhibited the mycelial growth of P. infestans. Similar to our results, the methanol leaf extract of L. camara reported to have better inhibition to tested fungal activities [28] . Also, [19] also reported that crude extracts of P. barbatus had the lowest MIC values against the test microbes compared to the other this is because the methanol was not used as the extracting solvent. From our study, methanol crude extract was effective in controlling the activities of P. infestans as compared with ethyl acetate extracts. This means that methanol was effective in the extraction of active polar compounds from the plant which were more effective than the nonpolar compounds extracted by ethyl acetate [29] .

The results of the study showed that all plant extract have active compounds with inhibitory effects to the growth of P. infestans as compared with the negative control. Different plant parts are known to produce secondary metabolites such as phenolic/flavonoids and terpenes/monoterpenes which inhibit pathogen growth [30] [31] [32] .

Our findings revealed that the Plectranthus barbatus, Lantana camara, and S. suaveolens crude extracts inhibited the mycelial growth of the P. infestans and these were statistically similar with the commercial chemical fungicide. Such results are very promising and may be used in the future to develop potential candidate pesticide in controlling P. infestans in tomato and potato. Reseach evidence has shown the presence of different active compounds with antifungal and antibacteril properties in Plectranthus barbatus [19] , Lantana camara [33] and Sphaeranthus species [20] .

T. vogelii extract from this study was poor in inhibiting the mycelial growth of P. infestans. Despite of the poor inhibition of the T. vogelii on P. infestans from this study, other studies have reported the great potential in controling insect pests in the field and storage [28] .

The interactive effects between the extraction solvents and plant crude extracts showed that ethyl acetate significantly lowered the inhibition ability of S. suaveolens. Furthermore, the interactive effects between incubation time and plant extracts revealed that, the performance of T. vogelii in inhibiting the growth of P infestans was significantly decreased at 72 hours of incubation. Further studies must be conducted to establish the mechanism of the interactive effects observed in our findings.