<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">ABB</journal-id><journal-title-group><journal-title>Advances in Bioscience and Biotechnology</journal-title></journal-title-group><issn pub-type="epub">2156-8456</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/abb.2019.104005</article-id><article-id pub-id-type="publisher-id">ABB-91766</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Total RNA Degradation &lt;i&gt;in Vitro&lt;/i&gt; and &lt;i&gt;in Vivo&lt;/i&gt; by Glutamate Dehydrogenase-Synthesized RNA Enzyme: Biotechnological Applications
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Godson</surname><given-names>O. Osuji</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Wenceslaus</surname><given-names>C. Madu</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Paul</surname><given-names>M. Johnson</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Imo State Polytechnic, Owerri, Nigeria</addr-line></aff><aff id="aff1"><addr-line>College of Agriculture and Human Sciences, Prairie View A&amp;amp;M University, Prairie View, TX, USA</addr-line></aff><pub-date pub-type="epub"><day>12</day><month>04</month><year>2019</year></pub-date><volume>10</volume><issue>04</issue><fpage>59</fpage><lpage>85</lpage><history><date date-type="received"><day>1,</day>	<month>March</month>	<year>2019</year></date><date date-type="rev-recd"><day>12,</day>	<month>April</month>	<year>2019</year>	</date><date date-type="accepted"><day>15,</day>	<month>April</month>	<year>2019</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Glutamate dehydrogenase regulates crop development, growth, and biomass yield through its synthesis of non-genetic code-based RNA. Understanding the mechanism of GDH-synthesized RNA enzyme would enhance the agri
  culture innovation capacity of the more than a billion urban gardeners,
   smallholder, and limited resources indigenous farmers. Different metabolic variants were prepared by treating peanut growing on healthy soil with stoichiometric mixes of mineral salt solutions. Peanut GDH charge isomers were purified to homogeneity by electrophoresis, and made to synthesize RNA enzyme. Peanut total RNA was 5’
  -
  end labeled with [
  γ
  -
  <sup>32</sup>
  P]ATP and made to react as substrate 
  in vitro
   with GDH-synthesized RNA from another metabolic variant of peanut. Agarose, and polyacrylamide gel electrophoresis of the reaction products showed that tRNA, rRNA, and most of the mRNAs were degraded to mononucleotides, but total RNAs that were not mixed with GDH-synthesized RNAs were not degraded. When the non-homologous sequence sections of the GDH-synthesized RNA were clipped out, the homologous sections failed to produce Northern bands with peanut total RNA. Therefore, 
  the non-homologous sequence sections served to identify, position, and align the GDH-synthesized RNA to its target total RNA site independent of genetic code; the degradation of total RNA being via non-canonical
   base alignments in the enzyme-substrate complex, followed by electromagnetic destruction of the total RNA, the less stable of the two kinds of RNA. This is the science-based corner stone that buttresses the crop production efforts of limited resources farmers because GDH-synthesized RNAs quickly degrade superfluous total RNA of the crop in response to the soil mineral nutrient deficiencies thereby minimizing wastage of metabolic energy in the synthesis of unnecessary protein enzymes while optimizing biomass metabolism, crop growth, and maximum crop yields. 
  In vitro
   hydrolysis of total RNA by GDH-synthesized RNA is the game changing, prototype, R&amp;D methods for cleansing sick total RNA from cells, tissues, and whole organisms.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Arachis hypogaea&lt;/i&gt;</kwd><kwd> Limited Resource Farmers</kwd><kwd> Stoichiometric Salt Mixes</kwd><kwd> GDH Isoenzyme Purification</kwd><kwd> Nongenetic Code-Based RNA</kwd><kwd> Electrophoresis</kwd><kwd> DNA:RNA Hybrids</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Crop glutamate dehydrogenase (GDH, EC 1.4.1.2) synthesizes RNA independent of template as it isomerizes in response to nucleophiles and electrophiles including intermediary metabolites, xenobiotics, pesticides, mineral nutrients, N-(Carboxymethyl) chitosan, methionine sulphoximine, auxins, toxic metal ions, and nucleotides [<xref ref-type="bibr" rid="scirp.91766-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref4">4</xref>]. The RNA synthetic activity of GDH and its coordination of biochemical pathways were initially described as signal integration and discrimination phenomena [<xref ref-type="bibr" rid="scirp.91766-ref4">4</xref>]. Later, comparison between the nucleotide sequences of numerous RNAs synthesized by GDH and crop yields on the one hand, and with their responses to stoichiometric mixes of mineral salt treatments on the other hand revealed the ribonuclease activities of the RNAs [<xref ref-type="bibr" rid="scirp.91766-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref6">6</xref>]. The enzymic property of GDH-synthesized RNA (non-genetic code-based RNA) is due in parts to the fact that it is more thermostable than total RNA [<xref ref-type="bibr" rid="scirp.91766-ref7">7</xref>]. The enzymic mechanism may involve non-canonical electrostatic base pairing chemical reactions [<xref ref-type="bibr" rid="scirp.91766-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref12">12</xref>]. Hereunder, we begin to present the machinery and mechanisms of total RNA degradation by GDH-synthesized RNA, and of the possible R&amp;D applications.</p><p>Transcriptomic analyses of plants that were exposed to differential mineral nutrient conditions revealed the identity of several metabolic pathways and many genes that were the targets of the actions of the mineral nutrients [<xref ref-type="bibr" rid="scirp.91766-ref13">13</xref>], but the chemical/molecular mechanisms of the differential responses were not presented. RNA degradation activities are prevalent in many genomes; most ubiquitous mechanisms being those of endonucleases, 5’ exonucleases, and 3’ exonucleases [<xref ref-type="bibr" rid="scirp.91766-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref15">15</xref>]. DNases and RNases are not controlled by agronomic abiotic stress factors. In the cytoplasm, double-stranded RNAs (miRNA, siRNA, shRNA etc.) are activated by RISH and RITS protein complexes to direct site-specific degradation of complementary RNAs [<xref ref-type="bibr" rid="scirp.91766-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref17">17</xref>]. Gene silencing by short RNA duplexes has been demonstrated to repress protein expression [<xref ref-type="bibr" rid="scirp.91766-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref19">19</xref>] in plants, mammals, and invertebrates. RNA interference phenomenon was first recognized as antiviral mechanism that protects organisms from RNA viruses [<xref ref-type="bibr" rid="scirp.91766-ref20">20</xref>]. But gene silencing by RNA interference mechanism is the degradation of genetic code-based RNA by genetic code-based RNA; therefore, it has limitations in its utility in smallholder crop production agriculture.</p><p>Glutamate dehydrogenase being sensitive to abiotic and biotic redox environments (drought, light, agronomic practice, extreme temperatures, extreme pH values, variable salinity, variable mineral nutrient compositions and concentrations, variable soil organic carbon contents, pathogen infection etc.), it dynamically links plant growth and development to soil health and mineral nutrient composition and concentration [<xref ref-type="bibr" rid="scirp.91766-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref22">22</xref>]. When soil health, mineral concentration and composition are adequate, crop’s GDH activity responds favorably, and crop yield doubles and optimizes [<xref ref-type="bibr" rid="scirp.91766-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref23">23</xref>]; but when the soil is degraded, then crop growth, development and productivity usually decline [<xref ref-type="bibr" rid="scirp.91766-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref27">27</xref>]. Healthy soil begets healthy crops, which in turn beget healthy human nutrition. Nutrient budgeting to assure optimal application of fertilizers to the soil has not provided acceptable guidelines for the analysis of agronomic uncertainties [<xref ref-type="bibr" rid="scirp.91766-ref28">28</xref>]. Integrated nutrient management for precision fertilization of soil is complicated for limited resource farmers to implement in the light of nutrient loss and resultant agroecosystem degradation.</p><p>Genetic code-based RNAs (rRNA, tRNA, and mRNA) catalyze the biosynthesis of proteins, the hallmarks that enable plants to grow, develop and accumulate biomass feed and food stuff. Differential availability of mRNAs charged with ribosomes is one of the factors that regulate the rate of protein biosynthesis [<xref ref-type="bibr" rid="scirp.91766-ref29">29</xref>]. Therefore, the regulation of the abundance of genetic code-based RNAs by GDH-synthesized RNA enzyme is very important for optimal agricultural productivity. Plants naturally grow in degraded soils with mineral nutrient limitations [<xref ref-type="bibr" rid="scirp.91766-ref30">30</xref>]. Close to 800 million people in the world or 78% of the world’s indigenous poor peoples―live in rural areas and rely on crop production on degraded soil to put food on their dining tables [<xref ref-type="bibr" rid="scirp.91766-ref31">31</xref>]. More than 500 million smallholder farmers manage the majority of the world’s agricultural land and produce most of the world’s food, phyto-medicines, and feed. Farming in the city backyard community gardens account for 15% of the world’s fresh, and nutritious food production (https://www.farmers.gov/media/blog/2018/11/06/farming-city). Farms of less than 1 hectare account for 72% of all farms. In contrast, only 1% of all farms in the world are larger than 50 hectares [<xref ref-type="bibr" rid="scirp.91766-ref32">32</xref>]. With urban population and hunger rising up to 50% [<xref ref-type="bibr" rid="scirp.91766-ref33">33</xref>], the summation of urban gardeners, city farmers, and 800 million rural farmers indicates that more than 1 billion people are cultivating the land to produce their fresh, healthy food, create jobs, and generate income. Limited resource farmers lack the financial power to purchase sufficient fertilizers, pesticides, irrigation technology (http://129.114.16.46/AgroNew/index.php), and agricultural machinery in support of their crop production efforts. Despite the fact that the world depends on subsistence, limited resource, and smallholder famers for sustainable consistent production of fresh, healthy food and feed crops, there has been no science-proven technology that buttresses and encourages the agricultural efforts of smallholder crop producers. However, understanding the machinery and chemical mechanism of the degradation of genetic code-based RNA by nongenetic code-based RNA (GDH-synthesized RNA) may encourage the construction of new strategies that leverage on GDH activity and thus enhance the agriculture innovation capacity of smallholder farmers.</p><p>GDH is a machinery that differentially controls total RNA concentrations according to the biomass metabolic needs of the crop [<xref ref-type="bibr" rid="scirp.91766-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref22">22</xref>]. GDH is multi-isoenzymic. It is purified as polypeptides by chromatography [<xref ref-type="bibr" rid="scirp.91766-ref34">34</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref35">35</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref36">36</xref>] or as intact, active, undegraded isoenzymes by electrophoresis [<xref ref-type="bibr" rid="scirp.91766-ref37">37</xref>]; the template-independent RNA synthetic activity being the exclusive function of the active undegraded, non-denatured isoenzymes [<xref ref-type="bibr" rid="scirp.91766-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref22">22</xref>]. We had provided qualitative evidence for the degradation of genetic code-based RNA by GDH-synthesized RNA [<xref ref-type="bibr" rid="scirp.91766-ref7">7</xref>]. Hereunder we describe the degradation of total RNA in vitro and in vivo as the mechanisms by which GDH isoenzymes control growth, differentiation, and nutritious biomass accumulation in peanut cultivated in the abiotic stress environment of mineral nutrient-limited soil, which resembles and mimics the limited resources farmer’s farm plot.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Treatment of Peanuts with Stoichiometric Mixes of Mineral Salt Solutions</title><p>Peanut (Arachis hypogaea L. Cv. Virginia) seeds were planted in 120 &#215; 120 &#215; 30 cm (width &#215; length &#215; depth) boxes (raised beds), each filled with healthy soil prepared by mixing two bags (18 kg) of top soil (Landscapers Pride, New Waverly, Texas, USA) and three bags (2.8 cu ft.) of professional growing mix (Sungro Horticulture, Bellevue, Washington, USA). Each raised bed was set up on level ground in the field on weed-blocking plastic mat, in the University farm, Waller County, Texas, USA. About 30 seeds were planted in each of 50 raised beds in late May, 2014. From the 50 beds, 22 were selected in which the seed germination was 100%, and the peanut seedlings were growing vigorously at about the same rate. The first 2 beds were left as the untreated control. Treatments were made in replicate as described in <xref ref-type="table" rid="table1">Table 1</xref> [<xref ref-type="bibr" rid="scirp.91766-ref39">39</xref>]. The applied mineral salt compositions were based on stoichiometric combinations to mimick the binomial subunit polypeptide compositions of the GDH isoenzymes [<xref ref-type="bibr" rid="scirp.91766-ref38">38</xref>] and to interact with target molecules in peanut in molar ratios. All the boxes were watered equally every other day. Chitosan and mineral solutions (5 L per bed) were applied three times: first at 3 weeks after seed germination, second at flowering, and the last was at post-flowering. When the leaves turned yellow and dry (peanut maturity), pods were harvested, weighed per box and immediately shelled by hand, and the kernels (seeds) were stored at −30˚C. The replicate seed harvests were not combined but stored separately.</p></sec><sec id="s2_2"><title>2.2. Purification of GDH</title><p>GDH isoenzymes were extracted from peanut seeds (30 g) with 0.1 M Tris-HCl buffer containing RNase A [<xref ref-type="bibr" rid="scirp.91766-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref22">22</xref>]. The seeds were from the control or mineral salts-treated raised beds. After ammonium sulfate salting out step, and dialysis</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Some Stoichiometric mixes of mineral salts that produced metabolic variants of peanut through the activities of GDH-synthesized RNA enzyme. The peanuts growing in greenhouse raised beds were fertilized with the solutions of the stoichiometric mixes of mineral salts, and of N-carboxymethyl chitosan</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Treatments</th></tr></thead><tr><td align="center" valign="middle" >N (1 L 25 mM NH<sub>4</sub>Cl)</td></tr><tr><td align="center" valign="middle" >N + P + K + S (1 L 25 mM NH<sub>4</sub>Cl, 20 mM Na<sub>3</sub>PO<sub>4</sub>, 4 mM KCl, plus 50 mM Na<sub>2</sub>SO<sub>4</sub>)</td></tr><tr><td align="center" valign="middle" >K (1 L 4 mM KCl)</td></tr><tr><td align="center" valign="middle" >S (1 L 50 mM Na<sub>2</sub>SO<sub>4</sub>)</td></tr><tr><td align="center" valign="middle" >P + S (1 L 20 mM Na<sub>3</sub>PO<sub>4</sub>, plus 50 mM Na<sub>2</sub>SO<sub>4</sub>)</td></tr><tr><td align="center" valign="middle" >P (1 L 20 mM Na<sub>3</sub>PO<sub>4</sub>)</td></tr><tr><td align="center" valign="middle" >N + S (1 L 25 mM NH<sub>4</sub>Cl plus 50 mM Na<sub>2</sub>SO<sub>4</sub>)</td></tr><tr><td align="center" valign="middle" >N + P + K (1 L 25 mM NH<sub>4</sub>Cl, 20 mM Na<sub>3</sub>PO<sub>4</sub>, plus 4 mM KCl)</td></tr><tr><td align="center" valign="middle" >P + K (1 L 20 mM Na<sub>3</sub>PO<sub>4</sub>, plus 4 mM KCl)</td></tr><tr><td align="center" valign="middle" >Control (untreated)</td></tr><tr><td align="center" valign="middle" >0.1% N-Carboxymethyl Chitosan solution.</td></tr></tbody></table></table-wrap><p>to remove the ammonium sulfate, the crude extract was subjected to Rotofor (Bio-Rad) isoelectric focusing [<xref ref-type="bibr" rid="scirp.91766-ref3">3</xref>]. The pI values of the fractions were determined, followed by dialysis to remove the ampholyte (Bio-Rad’s Bio-Lyte 3/10). The Rotofor fractions (0.2 mL) were loaded onto duplicate native 7.5% polyacrylamide gels and electrophoresed (Bio-Rad protean II xi cell). After native gel electrophoresis, one gel was stained with the phenazine methosulfate-glutamate-NAD<sup>+</sup>-tetrazolium bromide solution [<xref ref-type="bibr" rid="scirp.91766-ref40">40</xref>] in order to locate the positions of the GDH isoenzymes. GDH isoenzyme distribution pattern in the gel landscape was photo-documented. Using the stained gel as guide/template on a lightbox, the location of the GDH isoenzymes was excised from the duplicate electrophoresed gel [<xref ref-type="bibr" rid="scirp.91766-ref37">37</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref41">41</xref>]. The GDH isoenzymes were electro-eluted in 0.05M Trizma solution from the excised piece of gel using Bio-Rad whole gel eluter at sub-zero degree temperature in a freezer [<xref ref-type="bibr" rid="scirp.91766-ref41">41</xref>]. The fractions from the whole gel eluter were not combined. The cryoelectrophoresis was done many times in order to purify enough isoenzymes for the synthesis of RNA. All the batches of purified GDH charge isomers per treated peanut had identical distribution of GDH subunit polypeptides.</p></sec><sec id="s2_3"><title>2.3. Synthesis of RNA Enzyme</title><p>RNA synthetic activity of the GDH isoenzymes [<xref ref-type="bibr" rid="scirp.91766-ref18">18</xref>] was assayed in the amination substrate solutions of 0.1 M Tris-HCl buffer (pH 8.0) containing the four NTPs (0.6 mM each), CaCl<sub>2</sub> (3.5 mM), NH<sub>4</sub>Cl (0.875 mM), α-ketoglutarate (10.0 mM), NADH (0.225 mM), 5 Units RNase inhibitor, 1 Unit of DNase-1, and 5 &#181;g of actinomycin D. Reaction was started by adding 0.2 mL of whole gel-eluted GDH charge isomers containing 9 - 20 &#181;g protein per mL. Final volume of the reaction was brought to 0.4 mL with 0.1 M Tris-HCl buffer pH 8.0. Reactions were incubated at 16˚C overnight and stopped by phenol-chloroform (pH 5.5) removal of the proteins [<xref ref-type="bibr" rid="scirp.91766-ref42">42</xref>]. The RNA (enzyme) was precipitated with ethanol, and dissolved in minimum volume of molecular biology quality water; and stored at −20˚C before use. RNA enzyme yield and quality were determined by photometry and by agarose gel electrophoresis using RNA molecular weight markers and peanut total RNA as standards. The agarose gel was stained with ethidium bromide, and the RNA yield/distribution pattern was photo-documented. Assays were carried out in duplicate (from the duplicate seeds harvested) to verify the reproducibility of the results. The GDH isoenzyme patterns for the duplicate seed harvest per experimental treatment of peanut were similar. Replicate seed yields that gave similar/identical GDH patterns per experimental treatment were then combined for other downstream analyses. GDH purification and GDH synthesis of RNA were completed within 3 weeks after peanut seeds were harvested.</p></sec><sec id="s2_4"><title>2.4. Total RNA</title><p>Total RNA was extracted from peanut seeds (15 g) harvested from the control or mineral salt-treated boxes using the acidic phenol/chloroform (pH 4.5) method [<xref ref-type="bibr" rid="scirp.91766-ref42">42</xref>].</p></sec><sec id="s2_5"><title>2.5. End-Labeling of Total RNA as Substrate</title><p>Peanut total RNA (~5 &#181;g) was dephosphorylated with calf intestinal alkaline phosphatase; and labeled with 1 &#181;L of [ɣ<sup>32</sup>-P] ATP (700 Ci/mmol) (ICN Biochemicals, OH, USA) using I &#181;L of T4 polynucleotide kinase (Kinase-Max kit, Ambion, Austin, TX, USA) (10 units/&#181;L) and 2 &#181;L 10X Kinase buffer added to the reaction cocktail to bring the total volume to 20 &#181;l. Reaction was incubated at 37˚C for 1 h, and stopped by adding EDTA to make the reaction 1 mM, then heated to 95˚C for 3 min. The labeled RNA was not further purified.</p></sec><sec id="s2_6"><title>2.6. In Vitro Hydrolysis of Total RNA by GDH-Synthesized RNAs</title><p>The RNAs (enzymes) synthesized by the GDH charge isomers were arranged into 7 groups (very acid, acid, mildly acid, neutral, mildly alkaline, alkaline, and very alkaline) in the ascending order of their pI values. Labeled total RNA (substrate) (2.5 &#181;g) of a different treatment of peanut was added to 20 &#181;g of GDH-synthesized RNA (enzyme) from another treatment of peanut, and the total volume was brought to 49 &#181;L with 0.1 M Tris-HCl buffer solution pH 8. Ribonucleoside triphosphate (riboNTP) mix (0.6 mM each riboNTP) 1 &#181;L was added to the reaction cocktail on ice. Each of the 7 groups of GDH-synthesized RNA enzyme per experimental peanut was used for the hydrolysis. The reaction was thermo-cycled as described before [<xref ref-type="bibr" rid="scirp.91766-ref7">7</xref>] : pre-heat (96˚C, 30 sec), then 40 cycles (unless otherwise stated) of cool (5˚C, 1 min), and warm (37˚C, 2 min). At the end of thermo-cycling, the reaction was held at 5˚C. Two controls without GDH-synthesized RNA were prepared, each contained 2.5 &#181;g of labeled total RNA and 1 &#181;L of the riboNTP mix in a final volume made up to 50 &#181;L with 0.1 M Tris-HCl buffer solution pH 8.0. One of the controls was thermo-cycled with the experimental reactions, the other was not thermo-cycled but it was left on ice.</p><p>Two approaches were developed for fractionating the degradation products. The first was by agarose gel electrophoresis, and the second was by polyacrylamide gel electrophoresis. Any non-degraded total RNA, degraded total RNA, and excess unreacted <sup>32</sup>P-ATP were revealed by a brief (30 - 45 min, 70 volts, TAE buffer) agarose gel (3.0%) electrophoresis of 5 &#181;L of each hydrolysis reaction solution. The electrophoresed agarose gel was electro-trans-blotted (Bio-Rad semi-dry sub-cell) onto BrightStar Plus Nylon membrane (Applied Biosystems, Foster City, CA, USA) as described before [<xref ref-type="bibr" rid="scirp.91766-ref23">23</xref>], and the membrane was autoradiographed.</p><p>Any undegraded total RNA, and degraded total RNA were converting to RNA:DNA hybrids followed by polyacrylamide gel electrophoresis. To the hydrolyzed RNA solution (15.0 &#181;L), the following Display Systems Biotech, Vista, CA reagents were added: anchored primer (5’ T<sub>n</sub>V 12.5 &#181;M) 2.0 &#181;L, 10X cDNA buffer 1 (2.5 &#181;L), dNTP mix (5 mM each) 5.0 &#181;L, displayTHERMO-RT (100 U/&#181;L) 1.0 &#181;L. The reaction was incubated for 2 h at 42˚C. Then the tube was placed on ice. Polyacrylamide gel (10%) was made from 29:1 acrylamide:bisacrylamide mixture in 1XTBE and 7 M urea [<xref ref-type="bibr" rid="scirp.91766-ref43">43</xref>]. The first strand reaction products (10 &#181;L) was loaded in 1X glycerol loading buffer [<xref ref-type="bibr" rid="scirp.91766-ref43">43</xref>] and electrophoresed in a vertical Bio-Rad Protean II ix cell, at room temperature, 1&#215; TBE buffer and at constant 20 mA for 45 min. The electrophoresed gel was dried (Bio-Rad gel dryer), and the gel was autoradiographed.</p></sec><sec id="s2_7"><title>2.7. Preparation of cDNA of GDH-Synthesized RNA</title><p>cDNAs were synthesized with 2 &#181;g of each product RNA synthesized by the whole gel-eluted GDH charge isomers using random hexamer primer. Restriction fragment PCR amplification; adapter ligation; sequencing gel fractionation; and purification of cDNA fragments [<xref ref-type="bibr" rid="scirp.91766-ref38">38</xref>] were conducted according to the methods of Display Systems Biotech, Vista, CA, USA. Selected cDNA fragments were subcloned into pCR4-TOPO vector and transformed into TOP10 One Shot Chemically Competent Escherichia coli (Invitrogen, Carlsbad, CA), followed by overnight growth on selective plates. Up to ten positive transformant colonies were picked per plate and cultured overnight in LB medium containing 50 &#181;g/mL of kanamycin. Plasmid DNA was purified with a plasmid kit (Novagen, Madison, WI). The insert cDNA was sequenced with T3 and T7 primers by Genemed Synthesis, Inc. (South San Francisco, CA, USA), and Functional Biosciences, Inc. (Madison, WI, USA). To identify the GDH-synthesized RNAs that were homologous to genetic code-based RNAs (mRNAs, tRNAs, and rRNAs) the cDNA sequences were used as queries to search the NCBI nucleotide-nucleotide (excluding ESTs) BLAST (blastn), and non-redundant protein translation (blastx) databases. Complementary DNAs that displayed the highest alignment scores with genetic code-based RNAs of the correct molecular weights were selected as Northern probes.</p></sec><sec id="s2_8"><title>2.8. Labeling the cDNA as Northern Probe</title><p>The cDNAs that were used as Northern probes were those homologous to mRNAs encoding the enzymes of primary metabolism (starch synthase, cytochrome P450 reductase, acetyl coenzyme A carboxylase, flavonoid biosynthetic enzyme etc) and of the rRNAs of peanut [<xref ref-type="bibr" rid="scirp.91766-ref38">38</xref>]. For the labeling of the cDNA probes, cDNA inserts were amplified by PCR from the corresponding plasmids (15 ng) using M13 forward and M13 reverse primers (2 &#181;M each), [<sup>32</sup>P]-dATP (6000 Ci/mmol, 20 mCi/mL), dCTP/dGTP/TTP mix 50 mM, (2 &#181;L), and Taq polymerase (1U), in a final volume of 50 &#181;L. Amplification was according to Display Systems Biotech (Vista, CA, USA) ‘touch-down’ PCR procedure (denature: 94˚C, 1 min. For the first 10 cycles: 94˚C, 30 sec; anneal: 60˚C, 30 sec for the first cycle, then reduced the temperature 0.5˚C each cycle until an annealing temperature of 55˚C was reached after 10 cycles; extension: 72˚C, 1 min. Continued another 25 cycles with 94˚C, 30 sec; 55˚C, 30 sec; 72˚C, 1 min; final extension 72˚C, 5 min).</p></sec><sec id="s2_9"><title>2.9. Chemical Synthesis and Labeling of Oligonucleotide Probes</title><p>The homologous section of each GDH-synthesized RNA was clipped out of the non-homologous 3’-, and 5’-termini, and the complementary strand of the oligonucleotide was chemically synthesized by Sigma Life Science, The Woodlands, Texas, USA. The oligonucleotide (1.0 pmol) was labeled with 1 &#181;L of [γ<sup>32</sup> P] ATP (7000 Ci/mmol) (ICN Biochemicals, OH, USA) using I &#181;L of T4 polynucleotide kinase (Kinase-Max kit, Ambion, Austin, TX, USA) (10 units/&#181;L) and 2 &#181;L 10&#215; Kinase buffer added to the reaction cocktail to bring the total volume to 20 &#181;l with molecular biology quality water. Reaction was incubated at 37˚C for 1 h, and stopped by adding EDTA to make the reaction 1 mM, then heated to 95˚C for 3 min. Excess unreacted [<sup>32</sup>P] ATP was removed by chromatography of the reacted solution through Ambion NucAway spin column.</p></sec><sec id="s2_10"><title>2.10. Northern Blots</title><p>Equal amounts (15 &#181;g) of total RNA from the control and mineral salt-treated peanuts were loaded, briefly electrophoresed on 2% agarose gels, stained with ethidium bromide, and photographed to verify RNA quality. RNA was electro-transferred from the electrophoresed gel onto Brightstar-Plus nylon membrane (Applied Biosystems, Foster City, CA, USA) as described before [<xref ref-type="bibr" rid="scirp.91766-ref44">44</xref>].</p><p>Nylon membranes with immobilized RNA were prehybridized with ULTRAhyb buffer and hybridized with <sup>32</sup>P-labeled cDNA inserts or the corresponding Sigma-synthesized oligonucleotides as probes overnight at 68˚C as described before [<xref ref-type="bibr" rid="scirp.91766-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref44">44</xref>] Solutions of labeled cDNA were first heated in boiling water bath for 10 min before adding to the prehybridized membrane. After hybridization, the membranes were washed (20 min, 68˚C) with NorthernMax (Applied Biosystems, Foster City, CA, USA) low stringency wash solution followed by NorthernMax high stringency wash solution (15 min, 60˚C). The membrane was autoradiographed by exposure to X-ray film within intensifying screens at −80˚C. Northern band intensities were digitalized using UN-SCAN-IT gel digitalizing software (Silk Scientific, Inc., Orem, Utah).</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. In Vitro Degradation of the Total RNA of KCl-Treated Peanut by GDH-Synthesized RNA of P + K-Treated Peanut</title><p>The RNA enzymes synthesized by all the GDH charge isomers (a) very acid (pI 4.5 &#177; 0.2); (b) acid (pI 5.0 &#177; 0.2); (c) mildly acid (pI 6.0 &#177; 0.4); (d) neutral (pI 7.0 &#177; 0.4); (e) mildly alkaline (pI 8.0 &#177; 0.3); (f) alkaline (pI 8.4 &#177; 0.2); (g) very alkaline (pI 8.6 &#177; 0.1) of the P + K-treated peanut hydrolyzed all the low molecular weight constituents (tRNA, 5S, 16S and 28S rRNAs, and many mRNAs) of the total RNA (substrate) of KCl-treated peanut to virtually mononucleotides compared with the total RNA samples that were not treated with the GDH-synthesized RNAs (<xref ref-type="fig" rid="fig1">Figure 1</xref>(A)). This is the only RNA enzyme that degrades total RNA in vitro. The RNAs synthesized by the acid charge isomers of GDH were more efficient than the others in the degradation of total RNA judging from the scanty undegraded total RNA at the origin of the agarose gel well. When RNA is relieved of coding function, it becomes a fully-fledged enzyme [<xref ref-type="bibr" rid="scirp.91766-ref7">7</xref>].</p><p>Much of the full length RNA:DNA hybrids of total RNA (substrate) were also stuck at the origin (<xref ref-type="fig" rid="fig2">Figure 2</xref>(A)); whilst the degradation intermediates (bands 2, 3, 4, 5, and 6) were also captured by the polyacrylamide gel (<xref ref-type="fig" rid="fig2">Figure 2</xref>(A)). With the undegraded total RNA as the base line (<xref ref-type="fig" rid="fig2">Figure 2</xref>(A)), digital quantitation of the degradation products of the total RNA showed that the RNA enzyme synthesized by the acid GDH isomers was about two to five folds more active than the enzyme synthesized by the neutral charge isomers of GDH. However, the RNA enzymes synthesized by the neutral (pI 7.0 &#177; 0.4), mildly alkaline (pI 8.0 &#177; 0.1), and alkaline (pI 8.4 &#177; 0.2) charge isomers of GDH also degraded total RNA to different extents. Agarose gels did not capture the intermediate degradation products (<xref ref-type="fig" rid="fig1">Figure 1</xref>). GDH-synthesized RNA is the only enzyme that degrades total RNA in vitro. The presence of intermediate degradation bands of total RNA suggested that an enzyme-substrate complex was formed in the degradation reaction.</p></sec><sec id="s3_2"><title>3.2. In Vitro Degradation of Total RNA of Control Peanut by GDH-Synthesized RNA of P + K-Treated Peanut</title><p>The RNA enzymes synthesized by (a) very acid (pI 4.5 &#177; 0.2); (b) acid (pI 5.0 &#177; 0.2); (c) mildly acid (pI 6.0 &#177; 0.3); (e) mildly alkaline (pI 8.0 &#177; 0.3); (f) alkaline (pI 8.4 &#177; 0.2); (g) very alkaline (pI 8.6 &#177; 0.2) charge isomers of the GDH of the P + K-treated peanut hydrolyzed all the low molecular weight constituents (tRNA, 5S, 16S and 28S rRNAs, and some mRNAs) of the total RNA (substrate) of control peanut to virtually mononucleotides compared with the total RNA samples that were not treated with the GDH-synthesized RNAs (<xref ref-type="fig" rid="fig1">Figure 1</xref>(B)). The most active RNA enzymes were those synthesized by the very acid and acid charge isomers. This is the only RNA enzyme that degrades total RNA in vitro. The RNA enzymes synthesized by the mildly acid (pI 6.0 &#177; 0.4), and neutral (pI 7.0 &#177; 0.4) charge isomers of GDH were less active in the degradation of total RNA judging from the similarity of their undegraded total RNA with those of</p><p>the total RNA controls.</p><p>Much of the full length RNA: DNA hybrids of total RNA (substrate) were also stuck at the origin of the polyacrylamide gel, but all the GDH-synthesized isomeric RNA enzymes (very acid (pI 4.5 &#177; 0.2), acid (pI 5.0 &#177; 0.2), mildly acid (pI 6.0 &#177; 0.4), neutral (pI 7.0 &#177; 0.4), mildly alkaline (pI 8.0 &#177; 0.1), alkaline (pI 8.4 &#177; 0.3), and very alkaline (pI 8.6 &#177; 0.1) degraded the total RNA to different extents (<xref ref-type="fig" rid="fig2">Figure 2</xref>(B)). In addition to the fast migrating bands (excess <sup>32</sup>P-ATP, and low molecular weight oligonucleotides) near the bottom of the gel, there were smears of intermediate degradation products. Polyacrylamide gel electrophoresis (<xref ref-type="fig" rid="fig2">Figure 2</xref>(B)) of the RNA:DNA hybrids captured more of the intermediate degradation products than agarose gel electrophoresis of the total RNA (<xref ref-type="fig" rid="fig1">Figure 1</xref>(B)). The presence of intermediate degradation smears of total RNA was evidence for enzyme-substrate complexes in the degradation mechanism.</p><p>In the degradation of total RNA by GDH-synthesized RNA, the thermo-cycled control RNA was similar to the uncycled control RNA, and both were different from the degraded RNA patterns (<xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig2">Figure 2</xref>). Therefore, total RNA was not degraded by the thermo-cycling. Total RNA (substrate) was labeled at the 5’ end. Therefore the degradation products that were visible were those at the 5’ termini of total RNA moieties; those at the 3’ termini being invincible to autoradiography. This differential detection simplified the visualization of the degradation products (<xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig2">Figure 2</xref>). Agarose gel and polyacrylamide gel electrophoresis showed that the preponderance of the degradation products co-electrophoresed with the excess labeled ATP, thus suggesting that most of the target RNA molecules were degraded to 5’-mononucleotides. The smear of degradation products captured on polyacrylamide gel (<xref ref-type="fig" rid="fig2">Figure 2</xref>) however showed that many of them were high molecular weight oligonucleotides. Labeled total RNA and its degradation fragments were converted to RNA:DNA hybrid (<xref ref-type="fig" rid="fig2">Figure 2</xref>) because RNA:DNA hybrids are known to migrate as compact bands under polyacrylamide gel electrophoresis [<xref ref-type="bibr" rid="scirp.91766-ref45">45</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref46">46</xref>].</p></sec><sec id="s3_3"><title>3.3. In Vivo Degradation of Total RNA by GDH-Synthesized RNA</title><p>Northern bands were obtained with phosphate translocator, flavonoid biosynthesis, granule-bound starch synthase, and 16S rRNA probes (<xref ref-type="table" rid="table2">Table 2</xref>) that were synthesized by GDH [<xref ref-type="bibr" rid="scirp.91766-ref37">37</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref44">44</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref47">47</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref48">48</xref>] for all the experimental peanuts (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Each probe was cDNA-labeled through PCR incorporation of [α-<sup>32</sup>P]-dATP [<xref ref-type="bibr" rid="scirp.91766-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref23">23</xref>]. Each labeled cDNA probe produced at least a pair of Northern bands (Figures 3(B)-(E) typical of the structural characteristics of GDH-synthesized RNA to integrate and discriminate metabolic pathways [<xref ref-type="bibr" rid="scirp.91766-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref21">21</xref>]. The mRNA (<xref ref-type="fig" rid="fig3">Figure 3</xref>(B)) encoding inorganic phosphate translocator (about 1700 bases long) [<xref ref-type="bibr" rid="scirp.91766-ref47">47</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref48">48</xref>] was degraded in vivo by GDH-synthesized RNA enzyme in the control peanut, and in peanuts treated with P + S, P, N + S, N + P + K, and P + K stoichiometric mixes of mineral salt solutions (<xref ref-type="fig" rid="fig3">Figure 3</xref>(B)). The bands (about 1500 - 3000 bases long) in the lanes for N-, N + P + K + S-, K-, and S-treated peanuts were composite incompletely resolved multiplicity of bands</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> cDNAs of some of the GDH-synthesized RNAs used as probes. The homologous section is bolded, the left flank is underlined, and the right flank is double underlined</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Inorganic phosphate translocator BAB16885.1</th></tr></thead><tr><td align="center" valign="middle" >CTGGATNGCAGTTCGGCCGTTAAGGTTGGTCTTTGTTTAAGTTCCTTGTGGAAAGCCCTGGGCTCATATTTTTGGGAACTCGCAGTGGATACTGGGCGACTAGAGTGTGGTAGAGGGTAGCGGAATTCCTGGTGTAGCAGTGAAATGCGTAGAGATCAGGAGGAACATCCATGGCGAAGGCAGCTACCTGGACCAACACTGACACTGAGGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGCGAACTGGATGTTGGGTGCAATTTGGCACGCAGTATCGAAGCTAACGCGTTAAGTTCGCCGCCTGGGGAGTACGGTCGCAAGACTGAAACGCAAAGGAATTGACGGGTAAT</td></tr><tr><td align="center" valign="middle" >Flavonoid biosynthesis gene gb|EF165349.1|</td></tr><tr><td align="center" valign="middle" >CGGCATTGATAGCGATGAGTCCTGACCGACAACGGCATTGATAGCGATGAGTCCTGACCGACAACGGCATTGATAGCGATGAGTCCTGACCGACAACGGCATTGATAGCGATGAGTCCTGACCGCAAGGCATTGATAGCGATGAGTCCTGA</td></tr><tr><td align="center" valign="middle" >Starch synthase IIa: gb|ACL98483.1|</td></tr><tr><td align="center" valign="middle" >GTTACGATTCGCCCTTATGAGTCCTGACCGAGAACCGCGTTGATGGGGATGAGTCCGGACCGCCAACGGCATTGATAACGATGAGTCTGGACGGAGCTTACTCTTTATAATGATGAGTCCTGACCGACAACGGGTTTGATAGCTATGATTCCTGACCGACTGCGGCATTGATAGCGATGAGTCTGGATGGGATATGCAGACTACCAGAACCTGATTGGCGACT</td></tr><tr><td align="center" valign="middle" >16 S ribosomal RNA gene EU982406.1; EU982414.1</td></tr><tr><td align="center" valign="middle" >TTAACGCGTTAGCTTCGATACTGCGTGCCAAATTGCACCCAACATCCAGTTCGCATCGTTTAGGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAGTGTCAGTGTTGGTCCAGGTAGCTGCCTTCGCCATGGATGTTCCTCCTGATCTCTACGCATTTCACTGCTACACCAGGAATTCCGCTACCCTCTACCACACTCTAGTCGCCCAGTATCCACTGCAGTTCCCAGGTTGAGCCCAGGGCTTTCACAACGGACTTAAACGACCACCTACGCACGCTTTACGCCCAGTAATTCCGAGTAACGCTTGCACCCTTCGTATTACCGCGGCTGCTGA</td></tr></tbody></table></table-wrap><p>that included that of 1700 bases long for phosphate translocator mRNA. Phosphate translocator regulates the counter exchange of inorganic phosphate and triose phosphates between the chloroplast and cytoplasm, thereby controlling the flux of intermediates through the peanut citric acid cycle [<xref ref-type="bibr" rid="scirp.91766-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref39">39</xref>]. In the control peanut, and those treated with P + S, P, N + S, N + P + K, and P + K stoichiometric mixes of mineral salt solutions where the mRNA encoding phosphate translocator was degraded, the chloroplastic triose phosphates were converted to starch, and exported as maltose to the cytoplasm for utilization in cellulose biosynthesis biomass accumulation. Accordingly, all the peanuts where the phosphate translocator mRNA was degraded produced substantially more pod yields (9418 - 9822 kg per hectare) than those where the phosphate translocator mRNA was not degraded (6391 - 7266 kg per hectare) in agreement with earlier observations [<xref ref-type="bibr" rid="scirp.91766-ref49">49</xref>]. Peanut treated with N + P + K + S stoichiometric mineral salt mix produced a higher seed yield (12,513 per hectare) because the phosphate translocator mRNA was not degraded (<xref ref-type="fig" rid="fig3">Figure 3</xref>(B)) and granule-bound starch synthase mRNA was only partially degraded (<xref ref-type="fig" rid="fig3">Figure 3</xref>(D)) thus both biomass accumulation and glycolysis proceeded normally. This is the biochemistry-proven technology that buttresses and encourages the agricultural efforts of smallholder crop producers who cultivate their crops on healthy soil and harvest</p><p>healthy crop yields despite the fact that they apply limited amounts of fertilizer to the crops. The integration and discrimination of triose phosphate translocation and the starch synthase pathways (<xref ref-type="fig" rid="fig3">Figure 3</xref>(B) and <xref ref-type="fig" rid="fig3">Figure 3</xref>(D)) in the chloroplast by GDH-synthesized RNA enzyme leading to optimized biomass yields [<xref ref-type="bibr" rid="scirp.91766-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref39">39</xref>] is the corner stone of the agriculture innovation capacity of the more than 1 billion smallholder/limited resources crop farmers. The mRNAs encoding the flavonoid biosynthesis genes (about 9000 bases long) were not degraded (<xref ref-type="fig" rid="fig3">Figure 3</xref>(C)) in agreement with earlier observations [<xref ref-type="bibr" rid="scirp.91766-ref49">49</xref>] that horticultural peanuts treated with stoichiometric mixes of mineral salts have more flavor than commercially produced peanuts. The 16S rRNA bands (1800 bases long) were differentially degraded (<xref ref-type="fig" rid="fig3">Figure 3</xref>(E)) in the peanuts treated with S, P + S, P, and P + K. stoichiometric mineral salt mixes. Therefore, what was observed in the in vitro degradation of total RNA (<xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig2">Figure 2</xref>) agreed with the in vivo degradation of mRNAs and rRNA (Figures 3(B)-(E)) in that in both cases total RNA was degraded.</p></sec><sec id="s3_4"><title>3.4. Mechanism of Total RNA Degradation by GDH Isoenzymes</title><p>All the GDH-synthesized Northern probes (<xref ref-type="table" rid="table2">Table 2</xref>) recognized their target mRNAs or rRNA not on the basis of the genetic code-based structures of total RNA but on homologous sequence alignments. When the non-homologous RNA sequences that flanked the homologous sequences were clipped out (<xref ref-type="table" rid="table2">Table 2</xref> and <xref ref-type="table" rid="table3">Table 3</xref>), and the complementary oligonucleotides were used as Northern probes, there was no recognition of the total RNA targets and there were no Northern bands. Therefore, the total RNA degradation function of GDH-synthesized RNA is independent of the genetic code.</p><p>The chemically synthesized probes (<xref ref-type="table" rid="table3">Table 3</xref>) that corresponded to the GDH-synthesized probes did not give any Northern bands thereby revealing the chemical mechanism of the degradation of total RNA. The role of the flanking sequences is therefore to direct, guide, and align the homologous sequence in the GDH-synthesized RNA to the target site in the homologous total RNA sequence.</p><p>The G + C contents [<xref ref-type="bibr" rid="scirp.91766-ref7">7</xref>] of GDH-synthesized RNA (non-genetic code-based RNA) are different from those of total RNA (genetic code-based RNA). On the</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Some chemically synthesized oligonucleotide probes</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Oligo probe for mRNA encoding inorganic phosphate translocator:</th></tr></thead><tr><td align="center" valign="middle" >CTCCCCACGCTTTCGTGCCTCAGTGTCAGTGTTGGTCCAGGTAGCTGCCTCGCCATGGATGTTCCTCCTGATCTCTACGCATTTCACTGCTACACCAGGAATTCCGCTACCCTCTACCAACCACTCTAGTCGCCAGTAT</td></tr><tr><td align="center" valign="middle" >Oligo probe for mRNA encoding flavonoid biosynthesis gene:</td></tr><tr><td align="center" valign="middle" >CGGTCGGACTCATGTCGGTCAGGACTCATGTCGGTCAGGACTCATGTCGGTCAGGACTCA</td></tr><tr><td align="center" valign="middle" >Oligo probe for mRNA encoding starch synthase IIa:</td></tr><tr><td align="center" valign="middle" >ACTCATCGCTATCAATGCCGCAGTCGGTCA</td></tr><tr><td align="center" valign="middle" >Oligo probe for 16 S rRNA</td></tr><tr><td align="center" valign="middle" >CGCGGTAATACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTCGTTTAAGTCCGTTGTGAAAGCCCTGGGCTCAACCTGGGAACTGCAGTGGATACTGGGCGACTAGAGTGTGGTAGAGGGTAGCGGAATTCCTGGTGTAGCAGTGAAATGCGTAGAGATCAGGAGGAACATCCATGGCGAAGGCAGCTACTGGACCAACACTGACACTGAGGCACGAAAGCGTGGGGAGCA AACAGGATTAGATACCCTGGTAGTCCACGCCCTAAA</td></tr></tbody></table></table-wrap><p>basis of their different G + C contents, the electro-magnetic properties of total RNA are different from those of GDH-synthesized RNA. The GDH-synthesized RNA probe that is homologous to the mRNA encoding phosphate translocator is repeated two times in the range from nucleotide residue 151 - 347 of the mRNA. The GDH-synthesized probe that is homologous to the mRNA encoding starch synthase is repeated four times in the range from nucleotide residue 110 - 651 of the mRNA. The GDH-synthesized probe that is homologous to 16S rRNA matches once with 16S rRNA in the nucleotide range from residue 418 - 696. The GDH-synthesized RNA probe that is homologous to the mRNA encoding flavonoid biosynthesis enzymes is repeated six times in the range from nucleotide residue 18 - 157 of the mRNA. The matches and multiple repeats of the GDH-synthesized RNA within the zone of homology of the genetic code-based RNA probably facilitate homologous alignment reaction between the two types of RNA, and so make the machinery and chemistry of degradation completely different from the double-stranded RNA-mediated co-suppression post-transcriptional gene silencing that also embodies the participation of protein enzyme complexes [<xref ref-type="bibr" rid="scirp.91766-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref50">50</xref>].</p><p>When the GDH-synthesized RNA aligns to the homologous target genetic code-based RNA (<xref ref-type="fig" rid="fig4">Figure 4</xref>), the resulting electro-magnetic collision (electrostatic repulsion) between them leads to the degradation of the homologous genetic code-based RNA, which is the lesser stable of the two kinds of RNA (<xref ref-type="fig" rid="fig4">Figure 4</xref>). Removal of the structural constraint imposed by genetic code transformed RNA to a fully-fledged RNA enzyme that is independent of genetic code for its biological function. Genetic code-based nucleic acids are thermally less stable [<xref ref-type="bibr" rid="scirp.91766-ref7">7</xref>] than non-genetic code-based nucleic acids. GDH-synthesized RNA enzyme is above the genetic code.</p><p>Failure of the chemically synthesized oligonucleotide to hybridize to the target total RNA sequence is evidence that base pairing hydrogen bonding is not the chemical mechanism of alignment and degradation of total RNA by GDH-synthesized</p><p>RNA. The alignment of GDH-synthesized RNA to the target genetic code-based RNA is by homologous sequence interaction, involving non-canonical base-pair formation between the two kinds of RNA. Non-Watson Crick base pairs of the types AA, UU, GG, CC, AU, GU etc that are involved in homologous sequence alignment also include van der Waals, electrostatic, and solvation terms that are known to stabilize RNA structural motifs and their helix arrangements [<xref ref-type="bibr" rid="scirp.91766-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref12">12</xref>]. However, the non-canonical base-pair formation in homologous RNA alignment is weaker than Watson Crick complementary hydrogen bonds, thus explaining the choice of low temperatures that were applied in the in vitro degradation of total RNA by GDH-synthesized RNA. Therefore, degradation of total RNA by non-genetic code-based RNA (GDH-synthesized RNA) confirms the nucleic acid chemistry [<xref ref-type="bibr" rid="scirp.91766-ref51">51</xref>]. Furthermore, double-stranded RNAs (miRNA, siRNA, shRNA etc), RISH and RITS protein complexes that dominate RNA interference mechanisms [<xref ref-type="bibr" rid="scirp.91766-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref17">17</xref>] were not involved in the GDH-synthesized RNA machinery (<xref ref-type="fig" rid="fig4">Figure 4</xref>). Homology-dependent gene silencing has been described [<xref ref-type="bibr" rid="scirp.91766-ref52">52</xref>] but it focused on transgenes without explaining the chemical mechanism of silencing. The fact that total RNA degradation fragments formed RNA:DNA hybrids (<xref ref-type="fig" rid="fig2">Figure 2</xref>) suggested that the degradation mechanism was neither depurination nor depyrimidination of total RNA.</p></sec><sec id="s3_5"><title>3.5. Biochemistry-Proven Technology That Supports Smallholder Farmers</title><p>The differential degradation of mRNAs, tRNAs, and rRNAs (Figures 1-4) shed light on the biochemical mechanism by which crops survive when they are cultivated by limited resource farmers. Sanchez-Calderon [<xref ref-type="bibr" rid="scirp.91766-ref53">53</xref>], and Pang et al. [<xref ref-type="bibr" rid="scirp.91766-ref54">54</xref>] observed that deficiencies in soil mineral nutrients increased the accumulation of leaf and seed biomass in agreement with Osuji et al., [<xref ref-type="bibr" rid="scirp.91766-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref41">41</xref>] who had reported the GDH enhancement of biomass yield in maize and soybean treated with stoichiometric mixes of mineral salt solutions. Smallholder, limited resource, and indigenous farmers lack the financial power to purchase enough of expensive fertilizers, pesticides, and agricultural machinery in support of their crop production efforts, but some of the time they still harvest lots of food and feed stuff to nourish and to generate income for their families. Most of their farm lands are degraded and infertile. Many studies in plant physiology had focused on the transcriptional and biomass changes associated with mineral nutrient imbalance [<xref ref-type="bibr" rid="scirp.91766-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref55">55</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref56">56</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref57">57</xref>]; but the authors assumed and speculated that the transcriptional changes optimized translational processes for the increased biomass yield. The biochemical mechanisms that created the differential abundance of the mRNAs, proteins, and enzyme activities were not discussed. There is need to enhance the science-based agriculture innovation capacity of smallholder indigenous farmers.</p><p>Therefore, the mechanism is that when plants are subjected to soil mineral nutrient deficiencies by limited resource farmer, the plant’s GDH-synthesized RNA enzymes quickly degrade superfluous mRNA, tRNAs, and rRNAs (Figures 1-4) thereby minimizing the wastage of metabolic energy in the synthesis of unnecessary proteins, but optimizing the synthesis of needed amino acids, proteins and enzymes that assure development, nutritious biomass phytochemical accumulation (for plant protection), and survival of the crop. These are the biochemically proven reactions that support the agriculture innovation capacity of smallholder farmers. The mechanisms also underlie the biotechnology by which indigenous limited resource farmers, ethno-botanists, traditional herbalists, and practitioners of alternative medicines in Africa and Asia generate metabolic variants of ancient medicinal plants and spices that are enriched in specific varieties of pharmacologically active phytochemicals that support human health, without genetic engineering or plant breeding alteration of the plants. Amino acid biosynthesis [<xref ref-type="bibr" rid="scirp.91766-ref5">5</xref>] and translation are the most energy consuming processes in the cell [<xref ref-type="bibr" rid="scirp.91766-ref58">58</xref>]. Biomass metabolism requires protein synthesis and production of ribosomal subunits, tRNAs, and translational factors that are rigidly controlled at transcriptional and post-transcriptional levels [<xref ref-type="bibr" rid="scirp.91766-ref59">59</xref>]. The swift degradation of superfluous total RNA by GDH-synthesized RNA enzyme (Figures 1-4) in response to biotic and abiotic stressors, growth and differentiation cues of the crop results in much more immediate cellular adjustment through direct regulation of protein accumulation. The other mechanisms [<xref ref-type="bibr" rid="scirp.91766-ref13">13</xref>] - [<xref ref-type="bibr" rid="scirp.91766-ref20">20</xref>] that also control total RNA activities are housekeeping processes that are not sensitive to the crop’s metabolic environment. When we subjected peanut to K + N stoichiometric mineral salt treatment (mineral nutrient deficiency/imbalance), the peanut produced a mega pod yield of 12,780 kg per hectare [<xref ref-type="bibr" rid="scirp.91766-ref49">49</xref>] compared with the USA peanut producer yield of 3184 - 5936 kg per hectare [<xref ref-type="bibr" rid="scirp.91766-ref60">60</xref>] achieved with traditional time consuming, and laborious crop rotation and application of inactive fertilizers. This extraordinary &gt; 200% increase in crop yield is the R&amp;D application of GDH-synthesized RNA enzyme crop yield doubling biotechnology for the enhancement/optimization of food crop yields [<xref ref-type="bibr" rid="scirp.91766-ref23">23</xref>]. Peanut production is a worldwide gold mine in agriculture because peanut oil earns about U$1470 per ton in the world market, more than double of soybean oil [<xref ref-type="bibr" rid="scirp.91766-ref61">61</xref>]. GDH-synthesized RNA enzyme crop yield-doubling biotechnology has the promise to minimize not only hunger but also the cost of agricultural production by limited resource, smallholder farmers, and city community gardeners.</p></sec><sec id="s3_6"><title>3.6. Purification of GDH Isoenzymes</title><p>As the enzyme that synthesizes non-genetic code-based RNA, the GDH isoenzymes are naturally attached to some RNA. Therefore, it is required to treat tissues with RNase A during GDH isoenzyme purification in order to hydrolyze all the RNA. All the methods that purified GDH by chromatography did not remove the bounded RNA from the GDH isoenzymes [<xref ref-type="bibr" rid="scirp.91766-ref34">34</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref35">35</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref36">36</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref62">62</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref63">63</xref>]. The differences in the molecular distributions of GDH isoenzymes on native polyacrylamide gel landscape when RNAs are bounded to them and when the RNAs have been removed are astounding because more acidic isoenzymes are released after RNase treatment of GDH (<xref ref-type="fig" rid="fig5">Figure 5</xref>). The isoenzymes became up to ten</p><p>folds more aminating after they were liberated from the bounded RNA judging from the digitalized intensities of the isoenzyme bands (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p><p>GDH is multi-isoenzymic, therefore it is required in enzymology to purify the intact isoenzymes rather than the subunit polypeptides. The electrophoretic purification by free solution isoelectric focusing concentrates the isoenzymes into a few chambers of the Bio-Rad’s Rotofor cell; the native polyacrylamide gel electrophoresis of the Rotofor fractions removes all RNAs and other proteins because of the high molecular weight of GDH isoenzymes [<xref ref-type="bibr" rid="scirp.91766-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref41">41</xref>]; gentle cryoelectrophoresis of the slab of native polyacrylamide gel elutes the isoenzymes thus assuring homogenous isoenzyme preparations that are not dissociated and fragmented to subunit polypeptides. This multi-dimensional electrophoretic procedure has been applied to purify not only Arachis hypogeae GDH isoenzymes but also human cells (Professor Aubrey Thompson Laboratory), and Zea mays [<xref ref-type="bibr" rid="scirp.91766-ref64">64</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref65">65</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref66">66</xref>] GDH isoenzymes. In all cases, the homogenous GDH isoenzymes were applied to prepare polyclonal antibodies which neatly detected GDH isoenzymes and subunit polypeptides on Western blots [<xref ref-type="bibr" rid="scirp.91766-ref2">2</xref>].</p><p>The GDH isoenzymes purified from control untreated peanut, KCl-treated, and P + K-treated peanut were unique and different from each other, but they displayed the standard binomial distribution patterns of isoenzymes on native polyacrylamide gel (<xref ref-type="fig" rid="fig5">Figure 5</xref>, <xref ref-type="fig" rid="fig6">Figure 6</xref>). Similarly, the RNAs synthesized by the charge isomers of the GDHs of control peanut, KCl-treated peanut, and P + K-treated peanut (<xref ref-type="fig" rid="fig7">Figure 7</xref>) were typical of those synthesized by peanut GDH [<xref ref-type="bibr" rid="scirp.91766-ref23">23</xref>]. The total RNA extracted from all the experimental peanuts (<xref ref-type="fig" rid="fig3">Figure 3</xref>(A)) were free from RNase contamination because the rRNA bands were vividly present in consistent ratios.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>GDH-synthesized RNA enzyme: Above and beyond the genetic code. Degradation of the total RNA of KCl-treated peanut by the GDH-synthesized RNA of control peanut showed that KCl-treated, P + K-treated, and control peanuts were different metabolic variants of Arachis hypogeae, GDH-synthesized RNA being a simple analytical tool for demonstrating phenotypic difference. The differential activity towards tRNAs, 5S rRNA, 16S rRNA, and 26S rRNA could also be applied to depopulate rRNAs and tRNAs in the R&amp;D analysis of genomic</p><p>RNA. Currently, only Roche KAPA RiboErase kit presents a molecular biology method for the removal of rRNAs from some mammalian total RNA preparation. RNA synthesized by the different charge isomers (very acid, acid, mildly acid, neutral, mildly alkaline, alkaline, very alkaline) of GDH were differentially active in the degradation of total RNA (<xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig2">Figure 2</xref>) because the GDH hexameric subunit compositions are different [<xref ref-type="bibr" rid="scirp.91766-ref47">47</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref48">48</xref>], and accordingly the primary structures of the RNA enzymes they synthesized were different [<xref ref-type="bibr" rid="scirp.91766-ref7">7</xref>]. The degradation of total RNA (<xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig2">Figure 2</xref>) demonstrated that GDH-synthesized RNA enzyme, similar to GDH is a group of isomeric enzymes with different specificities towards total RNA sequences. The differential activity of the isomeric RNA enzymes towards total RNA constituents (Figures 1-4), is the biochemical mechanism by which GDH functions in vivo to integrate and discriminate environmental redox signals [<xref ref-type="bibr" rid="scirp.91766-ref4">4</xref>]. Rotofor isoelectric fractionation of GDH to isoenzymes was very important for the visual demonstration of the differential degradative activities of the isomeric RNA enzymes towards total RNA.</p><p>For the degradation of total RNA by GDH-synthesized RNA, total RNA (substrate) was labeled at the 5’ end. Therefore, the degradation products that were visible were those at the 5’ termini of total RNA moieties; those at the 3’ termini being invincible to autoradiography. Native polyacrylamide gel electrophoresis showed that the preponderance of the degradation products co-electrophoresed with the excess labeled ATP, thus suggesting that most of the target RNA molecules were degraded to 5’-mononucleotides. The smear of degradation products captured on polyacrylamide gel (<xref ref-type="fig" rid="fig2">Figure 2</xref>) suggested that the GDH-synthesized RNA possessed endonuclease activity that progressed towards the 5’ end of the substrate RNA molecule. This specificity could be exploited to further illuminate mRNA, rRNA, tRNA sequence organization. It is known that mRNA undergoes decay by two pathways [<xref ref-type="bibr" rid="scirp.91766-ref14">14</xref>]. Instantaneous degradation of superfluous total RNA by GDH-synthesized RNA (Figures 1-7) offers another R&amp;D approach for investigating RNA structural organization in relation to the mechanisms of total RNA decay. Agarose gel electrophoresis (<xref ref-type="fig" rid="fig1">Figure 1</xref>) showed that the low molecular weight (26S rRNA, 16S rRNA, 5S rRNA, and tRNA) moieties of total RNA were the easiest targets of degradation by GDH-synthesized RNA enzyme. Ribosomal RNAs and tRNAs are among the major genetic code-based RNAs that regulate translation processes [<xref ref-type="bibr" rid="scirp.91766-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref67">67</xref>]. GDH isomerization regulates plant growth and differentiation [<xref ref-type="bibr" rid="scirp.91766-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.91766-ref41">41</xref>]. Therefore, by differential degradation of mRNAs, and rRNAs, GDH-synthesized RNA enzyme holds a firm grip on translation (protein biosynthesis).</p><p>In vitro degradation of total RNA by GDH-synthesized RNA enzyme (<xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig2">Figure 2</xref>) is a phenomenal prototype demonstration of R&amp;D methods for cleansing sick total RNAs from cells, tissues, organs, whole organism because the enzyme is above and beyond the genetic code.</p></sec><sec id="s5"><title>Acknowledgements</title><p>Many thanks to Professor Aubrey Thompson Laboratory, UTMB, Galveston, Texas for encouraging the research project. Appreciation to Drs. Weerasooriya, Ampim, and Carson for conversations on the R&amp;D applications. The peanut research project is funded by USDA-NIFA through CBR grants and the Evans Allen Fund made to Prairie View A&amp;M University.</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare no conflict of financial interest on the project.</p></sec><sec id="s7"><title>Cite this paper</title><p>Osuji, G.O., Madu, W.C. and Johnson, P.M. (2019) Total RNA Degradation in Vitro and in Vivo by Glutamate Dehydrogenase-Synthesized RNA Enzyme: Biotechnological Applications. Ad- vances in Bioscience and Biotechnology, 10, 59-85. https://doi.org/10.4236/abb.2019.104005</p></sec></body><back><ref-list><title>References</title><ref id="scirp.91766-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O., Madu, W.C., Braithwaite, C., Beyene, A., Roberts, P.S., Bulgin, A. and Wright, V. (2003) Nucleotide-Dependent Isomerization of Glutamate Dehydrogenase in Relation to Total RNA Contents of Peanut. Biologia Plantarum, 47, 195-202.  
https://doi.org/10.1023/B:BIOP.0000022251.40891.ae</mixed-citation></ref><ref id="scirp.91766-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O. and Madu, W.C. (1997) Regulation of Sweetpotato Growth and Differentiation by Glutamate Dehydrogenase. Canadian Journal of Botany, 75, 1070-1078. https://doi.org/10.1139/b97-118</mixed-citation></ref><ref id="scirp.91766-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O. and Madu, W.C. (1995) Ammonium Ion-Dependent Isomerization of Glutamate Dehydrogenase in Relation to Glutamate Synthesis in Maize. Phytochemistry, 39, 595-503. https://doi.org/10.1016/0031-9422(94)00976-Z</mixed-citation></ref><ref id="scirp.91766-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O. and Braithwaite, C. (1999) Signaling by Glutamate Dehydrogenase in Response to Pesticide Treatment and Nitrogen Fertilization of Peanut (Arachis hypogaea L.). Journal of Agricultural and Food Chemistry, 47, 3332-3344.  
https://doi.org/10.1021/jf9805303</mixed-citation></ref><ref id="scirp.91766-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O., Duffus, E., Johnson, P., Woldesenbet, S., Weerasooriya, A., et al. (2015) Enhancement of the Essential Amino Acid Composition of Food Crop Proteins through Biotechnology. American Journal of Plant Sciences, 6, 3091-3108.  
https://doi.org/10.4236/ajps.2015.619302</mixed-citation></ref><ref id="scirp.91766-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O. and Madu, W.C. (1996) Ammonium Ion Salvage by Glutamate Dehydrogenase during Defence Response in Maize. Phytochemistry, 42, 1491-1498.  
https://doi.org/10.1016/0031-9422(96)00169-0</mixed-citation></ref><ref id="scirp.91766-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O. and Johnson, P.M. (2018) Structural Properties of the RNA Synthesized by Glutamate Dehydrogenase for the Degradation of Total RNA. Advances in Enzyme Research, 6, 29-52. https://doi.org/10.4236/aer.2018.63004</mixed-citation></ref><ref id="scirp.91766-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Watkins, A.M., Geniesse, C., Kladwang, W., Zakrevsky, P., Jaeger, L. and Das, R. (2018) Blind Prediction of Noncanonical RNA Structure at Atomic Accuracy. Science Advances, 4, eaar5316. https://doi.org/10.1126/sciadv.aar5316</mixed-citation></ref><ref id="scirp.91766-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Halder, S. and Bhattacharyya, D. (2013) RNA Structure and Dynamics: A Base Pairing Perspective. Progress in Biophysics and Molecular Biology, 113, 264-283.  
https://doi.org/10.1016/j.pbiomolbio.2013.07.003</mixed-citation></ref><ref id="scirp.91766-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Chandrasekhar, K. and Malath, R. (2003) Non-Watson Crick Base Pairs Might Stabilize RNA Structural Motifs in Ribozymes—A Comparative Study of Group-I Intron Structures. Journal of Bioscience, 28, 547-555.  
https://doi.org/10.1007/BF02703330</mixed-citation></ref><ref id="scirp.91766-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Holbrook, S.R., Cheong, C., Tinoco, I. and Kim, S. (1991) Crystal Structure of an RNA Double Helix Incorporating a Track of Non-Watson-Crick Base Pairs. Nature, 353, 579-581. https://doi.org/10.1038/353579a0</mixed-citation></ref><ref id="scirp.91766-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Doc-Bregeon, A.C., Chevrier, B., Podjaryn, A., Johnson, J., De Bear, J.S., Gough, G.R., Gilham, P.T. and Moras, D. (1989) Crystallographic Structure of an RNA Helix: [U(UA)6A]2. Journal of Molecular Biology, 209, 459-474.  
https://doi.org/10.1016/0022-2836(89)90010-7</mixed-citation></ref><ref id="scirp.91766-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Gupta, S., Yadav, B. S., Raj, U., Freilich, S. and Varadwaj, P.K. (2017) Transcriptomic Analysis of Soil Grown T. aestivum cv. Root to Reveal the Changes in Expression of Genes in Response to Multiple Nutrient Deficiency. Frontiers in Plant Sciences, 22, 1025.</mixed-citation></ref><ref id="scirp.91766-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Haimovich, G., Medina, D.A., Causse, S.Z., Garber, M., Milan-Zambrano, G., et al. (2013) Gene Expression Is Circular: Factors for mRNA Degradation Also Foster mRNA Synthesis. Cell, 153, 1000-1011. https://doi.org/10.1016/j.cell.2013.05.012</mixed-citation></ref><ref id="scirp.91766-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Houseley, J. and Tollervey, D. (2009) The Many Pathways of RNA Degradation. Cell, 136, 763-776. https://doi.org/10.1016/j.cell.2009.01.019</mixed-citation></ref><ref id="scirp.91766-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Eulalio, A., Huntzinger, E. and Izaurralde, E. (2008) Getting to the Root of miRNA-Mediated Gene Silencing. Cell, 132, 9-14.  
https://doi.org/10.1016/j.cell.2007.12.024</mixed-citation></ref><ref id="scirp.91766-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Tuschl, T., Zamore, P.D., Lehmann, R., Bartel, D.P. and Sharp, P.A. (1999) Targeted mRNA Degradation by Double-Stranded RNA in Vitro. Genes and Development, 13, 3191-3197. https://doi.org/10.1101/gad.13.24.3191</mixed-citation></ref><ref id="scirp.91766-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Meister, G. and Tuschl, T. (2004) Mechanisms of Gene Silencing by Double-Stranded RNA. Nature, 431, 343-349. https://doi.org/10.1038/nature02873</mixed-citation></ref><ref id="scirp.91766-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Biggar, K.K. and Storey, K.B. (2011) The Emerging Roles of microRNAs in the Molecular Responses of Metabolic Rate Depression. Journal of Molecular Cell Biology, 3, 167-175. https://doi.org/10.1093/jmcb/mjq045</mixed-citation></ref><ref id="scirp.91766-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Waterhouse, P.M., Wang, M.B. and Lough, T. (2001) Gene Silencing as an Adaptive Defence Against Viruses. Nature, 411, 834-842. https://doi.org/10.1038/35081168</mixed-citation></ref><ref id="scirp.91766-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O., Brown, T.K., South, S.M., Duncan, J.C., Johnson, D. and Hyllam, S. (2012) Molecular Adaptation of Peanut Metabolic Pathways to Wide Variations of Mineral Ion Composition and Concentration. American Journal of Plant Sciences, 3, 33-50. https://doi.org/10.4236/ajps.2012.31003</mixed-citation></ref><ref id="scirp.91766-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O., Reyes, J.C. and Mangaroo, A.S. (1998) Glutamate Dehydrogenase Isomerization: A Simple Method for Diagnosing Nitrogen, Phosphorus, and Potassium Sufficiency in Maize (Zea mays L.). Journal of Agricultural and Food Chemistry, 46, 2395-2401. https://doi.org/10.1021/jf971065x</mixed-citation></ref><ref id="scirp.91766-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O., Brown, T.K., South, S.M., Duncan, J.C. and Johnson, D. (2011) Doubling of Crop Yield through Permutation of Metabolic Pathways. Advances in Biosciences and Biotechnology, 2, 364-379. http://www.SciRP.org/journals/abb/</mixed-citation></ref><ref id="scirp.91766-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Agren, G.I., Watterstedt, J.A.M. and Billberger, M.F.K. (2012) Nutrient Limitation on Terrestrial Plant Growth—Modeling the Interactions between Nitrogen and Phosphorus. New Phytologist, 194, 953-960.  
https://doi.org/10.1111/j.1469-8137.2012.04116.x</mixed-citation></ref><ref id="scirp.91766-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Prinzenberg, A.E., Barbier, H., Salt, D.E., Stich, B. and Reymond, M. (2010) Relationships between Growth, Growth Response to Nutrient Supply, and Ion Content Using a Recombinant Inbred Line Population in Arabidopsis. Plant Physiology, 154, 1361-1371. https://doi.org/10.1104/pp.110.161398</mixed-citation></ref><ref id="scirp.91766-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Wu, G., Zhang, C., Chu, L. and Shao, H. (2017) Responses of Higher Plants to Abiotic Stresses and Agricultural Sustainable Development. Journal of Plant Interactions, 2, 135-147. https://doi.org/10.1080/17429140701586357</mixed-citation></ref><ref id="scirp.91766-ref27"><label>27</label><mixed-citation publication-type="book" xlink:type="simple">Chapin, F.S. and Van Cleve, K. (1991) Approaches to Studying Nutrient Uptake, Use and Loss in Plants. In: Pearcy, R.W., Ehleringer, J.R., Mooney, H.A. and Rundel, P.W., Eds., Plant Physiological Ecology: Field Methods and Instrumentation, Chapman and Hall, New York, 185-207.</mixed-citation></ref><ref id="scirp.91766-ref28"><label>28</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Osvalde</surname><given-names> A. </given-names></name>,<etal>et al</etal>. (<year>2011</year>)<article-title>Optimization of Plant Mineral Nutrition Revisited: The Roles of Plant Requirements, Nutrient Interactions, and Soil Properties in Fertilization Management</article-title><source> Environmental and Experimental Biology</source><volume> 9</volume>,<fpage> 1</fpage>-<lpage>8</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.91766-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Liu, Y., Beyer, A. and Aebersold, R. (2016) On the Dependency of Cellular Protein Levels on mRNA Abundance. Cell, 165, 535-550.  
https://doi.org/10.1016/j.cell.2016.03.014</mixed-citation></ref><ref id="scirp.91766-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Guimaraes-Dias, F., Neves-Borges, A.C., Viana, A.A.B., Mesquita, R.O., Romano, E., Grossi-de-Sa, M., Nepomuceno, A.L. and Alves-Ferreira, M. (2012) Expression Analyses in Response to Drought Stress in Soybeans: Shedding Light on the Regulation of Metabolic Pathway Genes. Genetics and Molecular Biology, 35, 222-232.</mixed-citation></ref><ref id="scirp.91766-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">UN World Population in Prospects: The 2006 Revision.</mixed-citation></ref><ref id="scirp.91766-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Food and Agriculture Organization (2014) The State of Food and Agriculture 2014 in Brief.</mixed-citation></ref><ref id="scirp.91766-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">The World Bank (2013) Urban Population.</mixed-citation></ref><ref id="scirp.91766-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Flygare, S., Griffin, T., Larsson, P. and Mosbach, K. (1983) Affinity Precipitation of Dehydrogenases. Analytical Biochemistry, 133, 409-416.  
https://doi.org/10.1016/0003-2697(83)90102-1</mixed-citation></ref><ref id="scirp.91766-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">McCarthy, A.D., Walker, J.M. and Tipton, K.F. (1980) Purification of Glutamate Dehydrogenase from ox Brain and Liver. Evidence That Commercially Available Preparations of the Enzyme from ox Liver Have Suffered Proteolytic Cleavage. Biochemical Journal, 191, 605-611. https://doi.org/10.1042/bj1910605</mixed-citation></ref><ref id="scirp.91766-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Godinot, C., Julliard, J. H. and Gautheron, D.C. (1974) A Rapid and Efficient New Method of Purification of Glutamate Dehydrogenase by Affinity Chromatography on GTP-Sepharose. Analytical Biochemistry, 61, 264-270.  
https://doi.org/10.1016/0003-2697(74)90353-4</mixed-citation></ref><ref id="scirp.91766-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O., Konan, J. and M’Mbijjewe, G. (2004) RNA Synthetic Activity of Glutamate Dehydrogenase. Applied Biochemistry Biotechnology, 119, 209-228.  
https://doi.org/10.1007/s12010-004-0003-z</mixed-citation></ref><ref id="scirp.91766-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O., Brown, T.K. and South, S.M. (2010) Optimized Fat and Cellulosic Biomass Accumulation in Peanut through Biotechnology. International Journal of Biotechnology and Biochemistry, 6, 455-476.</mixed-citation></ref><ref id="scirp.91766-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O, Brown, T.K., South, S.M., Johnson, D. and Hyllam, S. (2012) Molecular Modeling of Metabolism for Allergen-Free Low Linoleic Acid Peanuts. Applied Biochemistry and Biotechnology, 168, 805-823.  
https://doi.org/10.1007/s12010-012-9821-6</mixed-citation></ref><ref id="scirp.91766-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O., Cuero, R.G. and Washington, A.C. (1991) Effects of α-Ketoglutarate on the Activities of the Glutamate Synthase, Glutamate Dehydrogenase, and Aspartate Transaminase of Sweet potato, Yam Tuber, and Cream Pea. Journal of Agricultural and Food Chemistry, 39, 1590-1596. https://doi.org/10.1021/jf00009a010</mixed-citation></ref><ref id="scirp.91766-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O., Braithwaite, C., Fordjour, K., Madu, W.C., Beyene, A., Roberts, P.S. and Wright, V. (2003) Purification of Glutamate Dehydrogenase Isoenzymes and Characterization of Their Substrate Specificities. Preparative Biochemistry and Biotechnology, 33, 13-28. https://doi.org/10.1081/PB-120018366</mixed-citation></ref><ref id="scirp.91766-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Grierson, D., Slater, J. and Tucker, G.A. (1985) The Appearance of Polygalacturonase mRNA in Tomatoes: One of a Series of Changes in Gene Expression during Development and ripening. Planta, 163, 263-271.  
https://doi.org/10.1007/BF00393517</mixed-citation></ref><ref id="scirp.91766-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Sambrook, J. and Russel, D.W. (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.</mixed-citation></ref><ref id="scirp.91766-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O., Brown, T.K. and South, S.M. (2009) Nucleotide-Dependent Reprogramming of mRNAs Encoding Acetyl Coenzyme a Carboxylase and Lipoxygenase in Relation to the Fat Contents of Peanut. Journal of Botany, 2009, Article ID: 278324.</mixed-citation></ref><ref id="scirp.91766-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">Grabczyk, E., Mancuso, M. and Sammarco, M.C. (2007) A Persistent RNA&amp;#183DNA Hybrid Formed by Transcription of the Friedreich Ataxia Triplet in Live Bacteria, and by RNAP in Vitro. Nucleic Acids Research, 35, 5351-5359.  
https://doi.org/10.1093/nar/gkm589</mixed-citation></ref><ref id="scirp.91766-ref46"><label>46</label><mixed-citation publication-type="other" xlink:type="simple">Gunnarsson, G.H., Gudmundsson, B., Thormar, H.G., Alfredsson, A. and Jonsson, J.J. (2006) Two-Dimensional Stradededness-Dependent Electrophoresis: A Method to Characterize Single-Stranded DNA, Double-Stranded DNA, and RNA-DNA Hybrids in Complex Samples. Analytical Biochemistry, 350, 120-127.  
https://doi.org/10.1016/j.ab.2005.12.013</mixed-citation></ref><ref id="scirp.91766-ref47"><label>47</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O. and Brown, T. (2007) Environment-Wide Reprogramming of mRNAs Encoding Phosphate Translocator and Glucosyltransferase in Relation to Cellulosic Biomass Accumulation in Peanut. The ICFAI Journal of Biotechnology, 1, 35-47.</mixed-citation></ref><ref id="scirp.91766-ref48"><label>48</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O. and Brown, T. (2007) Role of the RNAs Synthesized by Glutamate Dehydrogenase in the Coordinate Regulation of Metabolic Processes. The ICFAI Journal of Biotechnology, 1, 37-48.</mixed-citation></ref><ref id="scirp.91766-ref49"><label>49</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O., Johnson, P., Duffus, E., Woldesenbet, S. and Kirven, J.M. (2017) Horticultural Production of Ultra High Resveratrol Peanut. Agricultural Science, 8, 1173-1194.</mixed-citation></ref><ref id="scirp.91766-ref50"><label>50</label><mixed-citation publication-type="other" xlink:type="simple">Das, S., Marwal, A., Choudhary, D.K., Gupta, V.K. and Gaur, R.K. (2011) Mechanism of RNA Interference (RNAi): Current Concepts. International Proceedings of Chemical, Biological and Environmental Engineering, 9, 240-245.</mixed-citation></ref><ref id="scirp.91766-ref51"><label>51</label><mixed-citation publication-type="other" xlink:type="simple">Davidson, J.N. (2012) The Biochemistry of Nucleic Acids. 7th Edition, Academic Press, London.</mixed-citation></ref><ref id="scirp.91766-ref52"><label>52</label><mixed-citation publication-type="other" xlink:type="simple">Meyer, P. and Saedler, H. (1996) Homology-Dependent Gene Silencing in Plants. Annual Review of Plant Physiology and Plant Molecular Biology, 47, 23-48.  
https://doi.org/10.1146/annurev.arplant.47.1.23</mixed-citation></ref><ref id="scirp.91766-ref53"><label>53</label><mixed-citation publication-type="other" xlink:type="simple">Sanchez-Calderon, L., Lopez-Bucio, J., Chacon-Lopez, A., Gutierrez-Ortega, A., Hernandez-Abreu, E. and Herrera-Estrella, L. (2006) Characterization of a low phosphorus insensitive Mutants Reveal a Crosstalk between Low Phosphorus-Induced Determinate Root Development and the Activation of Genes Involved in the Adaptation of Arabidopsis to Phosphorus Deficiency. Plant Physiology, 140, 879-889.  
https://doi.org/10.1104/pp.105.073825</mixed-citation></ref><ref id="scirp.91766-ref54"><label>54</label><mixed-citation publication-type="other" xlink:type="simple">Pang, J., Tibbett, M., Denton, M.D., Lambers, H., Siddique, K.H.M., Bolland, M.D.A., Revell, C.K. and Ryan, M.H. (2010) Variation in Seedling Growth of 11 Perennial Legume Sin Response to Phosphorus Supply. Plant and Soil, 238, 133-143.  
https://doi.org/10.1007/s11104-009-0088-9</mixed-citation></ref><ref id="scirp.91766-ref55"><label>55</label><mixed-citation publication-type="other" xlink:type="simple">Hermans, C., Hammond, J.P., White, P.J. and Verbruggen, N. (2006) How Do Plants Respond to Nutrient Shortage by Biomass Allocation? Trends in Plant Science, 11, 610-617. https://doi.org/10.1016/j.tplants.2006.10.007</mixed-citation></ref><ref id="scirp.91766-ref56"><label>56</label><mixed-citation publication-type="other" xlink:type="simple">Hirai, M.Y., Yano, M., Goodenowe, D.B., Kanaya, S., Kimura, T., Awazuhara, M., Fujiwara, T. and Saito, K. (2004) Integration of Transcriptomics and Metabolomics for Understanding of Global Responses to Nutritional Stresses in Aribidopsis thaliana. Proceedings of the National Academy of Sciences of the United States of America, 101, 10205-10210. https://doi.org/10.1073/pnas.0403218101</mixed-citation></ref><ref id="scirp.91766-ref57"><label>57</label><mixed-citation publication-type="other" xlink:type="simple">De Groot, C.C., Van Den Boogaard, R., Marcells, L.F.M., Harbinson, J. and Lambers, H. (2003) Contrasting Effects of N and P Deprivation on the Regulation of Photosynthesis in Tomato Plants in Relation to Feedback Limitation. Journal of Experimental Botany, 54, 1957-1967. https://doi.org/10.1093/jxb/erg193</mixed-citation></ref><ref id="scirp.91766-ref58"><label>58</label><mixed-citation publication-type="other" xlink:type="simple">Andreev, D.E., Dmitriev, S.E., Loughran, G., Terenin, I.M., Baranov, P.V. and Shatsky, I.N. (2018) Translational Control of mRNAs Encoding Translational Initiation Factore. Gene, 651, 174-182. https://doi.org/10.1016/j.gene.2018.02.013</mixed-citation></ref><ref id="scirp.91766-ref59"><label>59</label><mixed-citation publication-type="other" xlink:type="simple">Hershey, J.W., Sonenberg, N. and Mathews, M.B. (2019) Principles of Translational Control: An Overview. Cold Spring Harbor Perspectives in Biology, 4, a011528.  
https://doi.org/10.1101/cshperspect.a011528</mixed-citation></ref><ref id="scirp.91766-ref60"><label>60</label><mixed-citation publication-type="other" xlink:type="simple">Southeast Farm Press (2018) Peanut Production 101: Rotation Key to Bigger Yields. https://www.southeastfarmpress.com/peanuts-production-101-rotation-key-bigger-yields</mixed-citation></ref><ref id="scirp.91766-ref61"><label>61</label><mixed-citation publication-type="other" xlink:type="simple">USDA (2018) Oilseeds: World Markets and Trends. Foreign Agricultural Service Office of Global Analysis, 39.</mixed-citation></ref><ref id="scirp.91766-ref62"><label>62</label><mixed-citation publication-type="other" xlink:type="simple">Lee, W., Shin, S., Cho, S.S. and Park, J. (1999) Purification and Characterization of Glutamate Dehydrogenase as Another Isoprotein Binding to the Membrane of Rough Endoplasmic Reticulum. Journal of Cellular Biochemistry, 76, 244-253.  
https://doi.org/10.1002/(SICI)1097-4644(20000201)76:2&lt;244::AID-JCB8&gt;3.0.CO;2-K</mixed-citation></ref><ref id="scirp.91766-ref63"><label>63</label><mixed-citation publication-type="other" xlink:type="simple">Brodelius, P.E. and Kaplan, N.O. (1979) Studies on Bovine Liver Glutamate Dehydrogenase by Analytical Affinity Chromatography and Immobilized AMP Analogs. Archives Biochemistry and Biophysics, 194, 449-456.  
https://doi.org/10.1016/0003-9861(79)90639-8</mixed-citation></ref><ref id="scirp.91766-ref64"><label>64</label><mixed-citation publication-type="other" xlink:type="simple">Osuji, G.O., Mangaroo, A.S. and Roberts, P.S. (2001) In Vitro Isomerization of Glutamate Dehydrogenase in Relation to Phytosequestration of Lead. SAAS Bulletin: Biochemistry and Biotechnology, 14, 60-72.</mixed-citation></ref><ref id="scirp.91766-ref65"><label>65</label><mixed-citation publication-type="other" xlink:type="simple">Cooke, P.D.A. (2001) The Sensitivity of Glutamate Dehydrogenase to the Presence of the Herbicide Gramoxone (Paraquat) in Caprine Diets. MS Degree Thesis, Animal Science Department, Prairie View A&amp;M University, Prairie View, Texas, USA.</mixed-citation></ref><ref id="scirp.91766-ref66"><label>66</label><mixed-citation publication-type="other" xlink:type="simple">King, N.I. (2000) The Change of Caprine Glutamate Dehydrogenase in Response to Atrazine Adulterated Diet. MS Degree Thesis, Animal Science Department, Prairie View A&amp;M University, Prairie View, TX, USA.</mixed-citation></ref><ref id="scirp.91766-ref67"><label>67</label><mixed-citation publication-type="other" xlink:type="simple">Muhs, M., Yamamoto, H., Ismer, J., Takaku, H., Nashimoto, M., et al. (2011) Structural Basis for the Binding of IRES RNAs to the Head of the Ribosomal 40S Subunit. Nucleic Acids Research, 39, 5264-5275. https://doi.org/10.1093/nar/gkr114</mixed-citation></ref></ref-list></back></article>