<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2019.93013</article-id><article-id pub-id-type="publisher-id">AiM-90927</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Characterization of the Bacillus subtilis Penicillin-Binding Protein PBP4
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Arnaud</surname><given-names>Vanden Broeck</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Eric</surname><given-names>Sauvage</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Bernard</surname><given-names>Joris</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Colette</surname><given-names>Duez</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Institut de Physique, Centre for Protein Engineering, University of Liège, Liège, Belgium</addr-line></aff><aff id="aff1"><addr-line>Institut de Chimie, Centre for Protein Engineering, University of Liège, Liège, Belgium</addr-line></aff><pub-date pub-type="epub"><day>04</day><month>03</month><year>2019</year></pub-date><volume>09</volume><issue>03</issue><fpage>164</fpage><lpage>176</lpage><history><date date-type="received"><day>23,</day>	<month>January</month>	<year>2019</year></date><date date-type="rev-recd"><day>2,</day>	<month>March</month>	<year>2019</year>	</date><date date-type="accepted"><day>5,</day>	<month>March</month>	<year>2019</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  <b>Purpose:</b> The PBP4* is a Penicillin Binding Protein belonging to the class C of AmpH type whose function remains poorly understood. This study aimed to evaluate the biophysical and enzymatic properties of the 
  Bacillus subtilis PBP4* to gain insights into its role in the context of bacterial cell wall recycling. 
  <b>Methods:</b> To characterize the PBP4*, the full-length PBP4* and its N-terminal penicillin-binding domain have been produced in 
  Escherichia coli and purified. 
  <b>Results:</b> A comparison of biophysical properties has shown that both recombinant proteins are monomeric in solution and retain the same thermal stability. On the other hand, the D-alanine methyl esterase activity detected with the full-length PBP4* is impeded by the cleavage of the 92 amino acid C-terminal domain. The esterase activity of the full-length PBP4* strates a clear D-stereospecificity. The PBP4* is also active on 
  B. subtilis cell walls bearing teichoic acids, compounds commonly substituted with D-alanine residues. 
  <b>Conclusions:</b> Our results are in agreement with the hypothesis that PBP4* could play a role in recycling cell wall components, as previously suggested.
 
</p></abstract><kwd-group><kwd>B. subtilis PBP4*</kwd><kwd> Class-C PBP</kwd><kwd> D-Stereospecific Esterase</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The genome of Bacillus subtilis contains many genes coding for Penicillin-Binding Proteins (PBPs) including pbpE which is translated into PBP4*, a protein of 451 amino acids (NCBI accession number: CCD10845). The PBP4* belongs to the class C of AmpH type and its function and cellular role remain poorly understood. This PBP is composed of a N-terminal domain which harbors the three highly conserved motifs characteristic of PBPs (S<sup>61</sup>LSK<sup>64</sup>, Y<sup>153</sup>SN<sup>155</sup> and H<sup>302</sup>SG<sup>304</sup>) and is related to the Ochrobactrum anthropi D-aminopeptidase. The 92 amino acid C-terminal domain (CTD) consists of a predicted lipocalin-like fold of unknown function. At downstream of pbpE, there is a second gene named racX since its product presents sequence similarity with aspartate or glutamate racemases. The two genes constitute an operon and are parts of the σ<sup>W</sup> regulon. Popham and Setlow [<xref ref-type="bibr" rid="scirp.90927-ref1">1</xref>] have purified multiple PBPs from B. subtilis membranes by penicillin affinity chromatography. The N-terminal sequence of an apparent 56 kDa protein was identified as the beginning of the pbpE ORF, indicating that its product, named PBP4*, is not processed. This observation is in agreement with the absence of a predicted signal peptide in the PBP4* sequence. The purification method indicates that the PBP4* is associated with the cytoplasmic membrane. The pbpE gene is weakly expressed during the phase of vegetative growth; however its expression is induced upon entrance into the phase of stationary growth [<xref ref-type="bibr" rid="scirp.90927-ref1">1</xref>] . Partial or complete deletion of the pbpE-racX operon neither resulted in a particular phenotype (at least in growth on rich or minimal media) nor in differences in heat resistance and germination rates of spores, invalidating the hypothesis that PBP4* is a sporulation-specific gene [<xref ref-type="bibr" rid="scirp.90927-ref2">2</xref>] . Using a chromogenic cephalosporin, Popham and Setlow have detected a weak β-lactamase activity in a B. subtilis wild-type preparation in contrast to that from the pbpE mutant strain [<xref ref-type="bibr" rid="scirp.90927-ref1">1</xref>] . The authors also conducted D-aminopeptidase activity assays with D-alanine-p-nitroanilide substrate but obtained negative results. They proposed a role for PBP4* and RacX in the recycling of peptidoglycan components, a process especially important under starvation conditions [<xref ref-type="bibr" rid="scirp.90927-ref1">1</xref>] .</p><p>The expression of pbpE is enhanced in response of B. subtilis to different stresses. The extracytoplasmic RNA polymerase σ<sup>W</sup> factor activates genes involved in the antimicrobial resistance mechanisms, in the synthesis or secretion of bacteriocins and genes expressed in response to antibiotics that interfere with the biosynthesis and/or in proper functioning of the cell wall (e.g. vancomycin, cephalosporin and D-cycloserine). A role in detoxifying the cell has been proposed for the genes of the yceC operon, ybfO, ydjP, yfhM and pbpE [<xref ref-type="bibr" rid="scirp.90927-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.90927-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.90927-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.90927-ref6">6</xref>] . Experiments aiming to identify B. subtilis genes induced by a sudden increase in the external pH (from pH 6.3 to 8.9) revealed the induction of more than 80 genes including pbpE and racX [<xref ref-type="bibr" rid="scirp.90927-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.90927-ref8">8</xref>] . The PBP4* is also listed among the proteins induced by ammonium starvation, mainly during the transition to the phase of stationary growth [<xref ref-type="bibr" rid="scirp.90927-ref9">9</xref>] . Other studies [<xref ref-type="bibr" rid="scirp.90927-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.90927-ref11">11</xref>] have shown that pbpE was overexpressed in response to high salt stress, suggesting that PBP4* could play a role in the cell wall rearrangements that take place during the osmoadaptation of B. subtilis. Interestingly, a zymogram analysis demonstrated that PBP4* has a hydrolysis activity on cell walls [<xref ref-type="bibr" rid="scirp.90927-ref11">11</xref>] . Furthermore, a strain in which pbpE has been disrupted presents a salt-sensitive phenotype and an increased sensitivity to cell envelope active antibiotics (vancomycin, penicillin and bacitracin) [<xref ref-type="bibr" rid="scirp.90927-ref11">11</xref>] . However, neither precise structural modifications of the cell wall are elucidated nor is the specific contribution of PBP4* to these modifications.</p><p>B. subtilis overproducing PBP4* has a filamentous phenotype. In the absence of the FtsH metalloprotease, an upregulation of the whole σ<sup>W</sup> regulon is observed, as well as an enhanced transcription of pbpE, causing an accumulation of PBP4* in B. subtilis. The inactivation of both ftsH and pbpE restored the wild-type cell morphology, indicating that the accumulation of PBP4* is responsible for the filamentous phenotype [<xref ref-type="bibr" rid="scirp.90927-ref12">12</xref>] . The way this phenotype is induced by PBP4* remains unclear.</p><p>The localization of the Green Fluorescent Protein fused to PBP4* has been monitored [<xref ref-type="bibr" rid="scirp.90927-ref13">13</xref>] . During the phase of vegetative growth, GFP-PBP4* localized in a punctuated pattern along the bacterial rod, similar to those observed with most PBPs [<xref ref-type="bibr" rid="scirp.90927-ref14">14</xref>] .</p><p>To gain knowledge on the B. subtilis PBP4* role, we have purified the full-length protein and its N-terminal domain (PBP4*∆CTD) and performed biophysical and enzymatic characterizations.</p></sec><sec id="s2"><title>2. Material and Methods</title><sec id="s2_1"><title>2.1. Cloning Strategies and Plasmids</title><p>The pJet1.2/blunt vector (Thermo Scientific) was used to clone the fragments amplified by PCR and to verify their sequences (GIGA sequencing platform, University of Li&#232;ge, Belgium). The pET28-MHL plasmid (Addgene) was used as expression vector to produce the entire PBP4* or its N-terminal domain (PBP4* ΔCTD) in fusion with a N-terminal 18 amino acid peptide containing six histidine residues followed by a TEV protease cleavage site. In the pET28-MHL plasmid, the translation initiation codon is present in an NdeI restriction site (CATATG). Silent mutations were introduced in pbpE to suppress two internal NdeI restriction sites using the following strategy: three fragments of pbpE were amplified from the B. subtilis ATCC21332 genomic DNA with the Q5 High Fidelity DNA polymerase (Bioke). The first fragment (5’ portion of the gene) was obtained with the primers pbpE_frag1_fw and pbpE_frag1_mut1_rev. The second fragment corresponding to the central part of the gene was amplified with the primers pbpE_frag2_mut1_fw and pbpE_frag2_mut2_rev and the third fragment (3’ portion of the gene) was obtained with the oligonucleotides pbpE_frag3_mut2_fw and pbpE_frag3_rev. The external primers pbpE_frag1_fw and pbpE_frag3_rev contain an NdeI or XhoI restriction site respectively. The internal oligonucleotides form two pairs of primers with complementary sequences and a single modified nucleotide in the NdeI restriction sites. A final PCR using the mixture of the three fragments as templates and the primers pbpE_frag1_fw and pbpE_frag3_rev allowed to amplify the entire pbpE gene without internal NdeI restriction sites. The 1.4 kb PCR product was cloned into the pJet1.2/blunt vector and the insert sequence was completely verified. The modified pbpE gene was cloned into pET28-MHL yielding the pET28-MHL-pbpE plasmid. The PBP4* ΔCTD coding sequence (comprising the first 359 residues) was amplified from the pET28-MHL-pbpE plasmid with the pbpENterm-fw and pbpENterm-rev primers. After verification of its sequence, the fragment was cloned into the pET28-MHL vector yielding the pET28-pbpENterm plasmid. The sequences of the primers are reported in (<xref ref-type="table" rid="table1">Table 1</xref>).</p></sec><sec id="s2_2"><title>2.2. Production of PBP4* and PBP4* ΔCTD</title><p>E. coli Nico21 (DE3) competent cells (New England Biolabs) were transformed with the pET28-MHL-pbpE or pET28-MHL-pbpENterm plasmids. Bacterial cells were grown in two litres of Terrific Broth medium at 37˚C until an OD<sub>600nm</sub> of 1.2 and induced with 1 mM IPTG. After 4 hours at 37˚C, the cells were collected by centrifugation at 7000 g for 20 min. The pellet was resuspended in 80 mL of 25 mM HEPES pH 7.5, 100 mM NaCl, 5 mM MgCl<sub>2</sub>, and 1 mM PMSF. After addition of 200 U benzonase (Novagen), the cells were broken in a high-pressure homogenizer (Emulsiflex C3, Avestin Europe GmbH) and debris and intact cells were eliminated by centrifugation at 25,000 g for 30 min. The His-tagged PBP4* or PBP4* ΔCTD were purified using the Profinia™ Affinity Chromatography Protein Purification System (Biorad). The equilibration, washing and elution buffers were supplemented with 5, 10 and 250 mM imidazole respectively. The purified proteins were eluted in desalting buffer (25 mM HEPES pH 7.5, NaCl 100 mM) with a yield of 63 mg of full-length PBP4* and 50 mg of PBP4* ΔCTD.</p></sec><sec id="s2_3"><title>2.3. Cleavage of the N-Terminal Sequence with the TEV Protease</title><p>In order to cleave the N-terminal extension containing the polyhistidine sequence, the purified PBP4* and PBP4* ΔCTD were incubated overnight at 4˚C with TEV protease (TEV-recombinant proteins mass ratio 1:50) in 25 mM HEPES pH 7.5, 100 mM NaCl. The cleavage efficiency was verified by SDS-PAGE analysis and the mixture loaded on Ni-NTA agarose to retain the N-terminal peptide. A mass spectrometry measurement (CART-LSM GIGA University of Li&#232;ge, Belgium) and the N-terminal sequencing by Edman degradation confirmed the complete</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Names and sequences of primers used for suppressing the pbpE internal NdeI restriction sites and for cloning the full-length PBP4* or PBP4* ΔCTD coding sequences into the pET28-MHL expression plasmid. The sequences in bold (CATATG and CTCGAG) correspond to a NdeI and XhoI restriction site respectively. The underlined nucleotides indicate the silent mutations introduced in internal NdeI restriction sites</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Sequence (5’ to 3’)</th></tr></thead><tr><td align="center" valign="middle" >pbpE_frag1_fw</td><td align="center" valign="middle" >GCGCATATGAAACAGAATAAAAGAAAGCATCTTCAGACA</td></tr><tr><td align="center" valign="middle" >pbpE_frag1_mut1_rev</td><td align="center" valign="middle" >GTACATCATACACATATCCATAAGCATAATGATCA</td></tr><tr><td align="center" valign="middle" >pbpE_frag2_mut1_fw</td><td align="center" valign="middle" >TGATCATTATGCTTATGGATATGTGTATGATGTAC</td></tr><tr><td align="center" valign="middle" >pbpE_frag2_mut2_rev</td><td align="center" valign="middle" >GGGACCTCATAAGGCTGGCCAAATA</td></tr><tr><td align="center" valign="middle" >pbpE_frag3_mut2_fw</td><td align="center" valign="middle" >TATTTGGCCAGCCTTATGAGGTCCC</td></tr><tr><td align="center" valign="middle" >pbpE_frag3_rev</td><td align="center" valign="middle" >ACAACTCGAGATTAATTTGTACGGACCGCTTCTTCTTCT</td></tr><tr><td align="center" valign="middle" >pbpENterm-fw</td><td align="center" valign="middle" >GCGCATATGAAACAGAATAAAAGAAAGCATCTTC</td></tr><tr><td align="center" valign="middle" >pbpENterm-rev</td><td align="center" valign="middle" >ACAACTCGAGATTAAGCAGGACGTTCCGGG</td></tr></tbody></table></table-wrap><p>elimination of the N-terminal extension leaving only two additional amino acids (Gly and His) before the native sequence of the purified proteins (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)).</p></sec><sec id="s2_4"><title>2.4. Thermal Denaturation Assay</title><p>Thermal denaturation analyses of PBP4* and its N-terminal domain (PBP4* ΔCTD) were performed by DSF (Differential Scanning Fluorimetry) using the Prometheus NT.48 (NanoTemper Technologies), a capillary-based instrument measuring microscale thermophoresis. The NanoDSF technology detects very small changes in the fluorescence of tryptophan and tyrosine present in the protein without needing any dye. Experiments were performed as following: protein samples were buffer exchanged against 25 mM HEPES pH 8.0, 100 mM NaCl using Micro Bio-Spin P6 columns (BioRad) and diluted at 30 &#181;M in the same buffer. Ten &#181;L of each sample were injected in a thin capillary (provided with the Prometheus NT48 system) and submitted to a 20˚C - 95˚C temperature gradient with a 1˚ min<sup>−1</sup> increase rate. The first derivatives of the sigmoid curves provide fusion temperatures (Tm) of the proteins, corresponding to the denaturation midpoint. Experiments were performed 3 times for both proteins.</p></sec><sec id="s2_5"><title>2.5. Dynamic Light Scattering</title><p>Dynamic light scattering (DLS) measurements were carried out in 25 mM HEPES pH 8.0, 100 mM NaCl using a DynaPro NanoStar<sup>TM</sup> (Wyatt Technologies, 100 mW He-Ne laser, λ<sub>0</sub> = 658 nm, θ = 90˚) spectrophotometer. DLS experiments were performed at 15˚C in disposable Uvette<sup>TM</sup> cells (Eppendorf) filled with 50 &#181;L of PBP4* or PBP4* ΔCTD protein solution at 0.5 or 1.5 mg mL<sup>−1</sup>. Measurements, corresponding to 10 readings of 5 seconds, were taken three times with a pause of 5 minutes between them to provide means and square deviations of the parameters. Scattering intensities were analyzed using the Dynamics software (Wyatt Technologies) to calculate the hydrodynamic diameters (Dh), the polydispersity indexes and to estimate the molecular weights.</p></sec><sec id="s2_6"><title>2.6. Size-Exclusion Chromatography</title><p>Proteins were loaded on a Superdex S200 10/300 column (GE Healthcare) pre-equilibrated in 25 mM HEPES pH 8, 100 mM NaCl to determine their elution volumes and calculate their apparent masses based on a calibration curve (BioRad).</p></sec><sec id="s2_7"><title>2.7. Enzyme Assays</title><sec id="s2_7_1"><title>2.7.1. DD-Carboxypeptidase Activity</title><p>DD-carboxypeptidase activity was assayed with benzoyl-D-alanyl thioacetyl ester (S2d) as substrate [<xref ref-type="bibr" rid="scirp.90927-ref15">15</xref>] . A sample (150 &#181;L) containing 3 &#181;g PBP4*, 1 mM S2d and 1 mM DTNB in 50 mM HEPES pH 7 and a blank without enzyme were incubated at room temperature for 20 min. The absorbance values were monitored at 412 nm.</p></sec><sec id="s2_7_2"><title>2.7.2. Aminopeptidase Activity</title><p>Aminopeptidase activity was tested on L or D-amino acids fused to a para(p)nitroanilide (NA) group. L- and D-Ala-pNA, L- and D-Glu-pNA, L-Met-pNA, L- and D-Phe-pNA and L-Pro-pNA (Sigma-Aldrich) have been used. Samples (100 &#181;L) containing 500 &#181;M of putative substrate and 50 &#181;g PBP4* in 25 mM HEPES pH 7.5, 100 mM NaCl were incubated at 37˚C for 2 hours. A blank without enzyme allows to determine if the yellow colour is due to the aminopeptidase activity of PBP4*.</p></sec><sec id="s2_7_3"><title>2.7.3. Esterase Activity</title><p>Esterase activity was tested on D-Alanine methyl ester (D-Ala OMe) hydrochloride (Bachem) or DL-Alanine methyl ester hydrochloride (Sigma-Aldrich) as substrates. The assays were all performed at 24˚C in 50 mM HEPES pH 7.5, 5 mM MgCl<sub>2</sub>. In these conditions of temperature and pH, the spontaneous hydrolysis of the substrate is less than 2%. Samples (40 &#181;L) containing 1 - 7 mM D-Ala OMe and 4.65 &#181;M full-length PBP4* or the substrate alone were incubated for 15 - 30 min and then transferred on ice. The amounts of D-Alanine resulting from the enzymatic activity or from the substrate instability were measured using the D-Amino Acid Oxidase (DAAO) method [<xref ref-type="bibr" rid="scirp.90927-ref16">16</xref>] . Absorbance values of standards containing 0 - 30 nmoles D-Alanine yielded a straight line that allowed to calculate the esterase activity associated with PBP4*.</p><p>The initial rates (v<sub>0</sub>) were fitted to the Henri-Michaelis-Menten equation using a nonlinear regression analysis with the help of the GraphPad Prism 5.04 software. The kinetic constants were also determined with the Hanes plot in which the S/v<sub>0</sub> ratios are plotted versus the substrate [S] concentrations, which gave a straight line that allowed to calculate the K<sub>m</sub> and K<sub>m</sub>/V<sub>max</sub> ratio.</p></sec><sec id="s2_7_4"><title>2.7.4. Determination of the Substrate Stereospecificity of PBP4*</title><p>Samples (40 &#181;L) containing 4.65 &#181;M of full-length PBP4* and 20 mM of racemic DL-Ala OMe substrate or the substrate alone were prepared in duplicates, incubated for 30 min and then transferred on ice. After addition of a second reaction mixture containing either 50 U DAAO or 12 U LAAO (L-Amino Acid Oxidase from the Crotalus adamanteus venom, Sigma-Aldrich), the samples were incubated at 37˚C for 15 or 30 min respectively. Absorbance values of standards containing 0 - 40 nmoles L-Alanine fit to a straight line in the LAAO test.</p></sec><sec id="s2_7_5"><title>2.7.5. Enzyme Assay on Bacillus subtilis Cell Walls</title><p>Suspensions (2 &#215; 100 &#181;L at 10mg mL<sup>−1</sup>) of cell walls bearing teichoic acids were rinsed three times with 50 mM HEPES pH 7.5 and resuspended in the same buffer at the initial concentration. One sample constituted a blank while the other one was supplemented with 10 &#181;g PBP4*. Both samples were incubated at 24˚C for 16 hours. After centrifugation (at 14,000 g for 10 min) the possible release of D-alanine residues in the supernatants was quantified using the DAAO method.</p></sec></sec></sec><sec id="s3"><title>3. Results and Discussion</title><p>The B. subtilis PBP4* produced in E. coli as a recombinant protein of 453 residues or its N-terminal domain (PBP4* ΔCTD) lacking the 92 last residues (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)―lanes II and IV) were used in all experiments.</p><sec id="s3_1"><title>3.1. Physical Characterizations of the Full-Length PBP4* and Its N-Terminal Domain PBP4* ΔCTD</title><p>The thermal denaturation curves indicated that the T<sub>m</sub> temperatures of PBP4* and PBP4* ΔCTD are 59˚C &#177; 0.3˚C and 60˚C &#177; 0.2˚C respectively (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)).</p><p>Deletion of the C-terminal domain did not show a significant impact on the thermal stability of PBP4*. The results of Dynamic Light Scattering experiments performed on PBP4* and PBP4* ΔCTD have shown that both proteins are monomeric in solution, with estimated masses (kDa) of 54.5 &#177; 1.22 and 35.17 &#177; 1.17 respectively (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)). Compared to the PBP4* ΔCTD, the diffusion properties of the full-length PBP4* were slowed and relaxation of the autocorrelation was longer. The profiles of exclusion size chromatography of PBP4* and PBP4* ΔCTD were also those of monomeric proteins, with estimated masses (kDa) of 55.97 and 45.37 respectively (<xref ref-type="fig" rid="fig1">Figure 1</xref>(d)). All the results are summarized in (<xref ref-type="table" rid="table2">Table 2</xref>).</p></sec><sec id="s3_2"><title>3.2. Enzymatic Characterization of the Full Length PBP4*</title><sec id="s3_2_1"><title>3.2.1. DD-Carboxypeptidase Activity</title><p>The full-length PBP4* exhibits a specific activity of 0.12 &#181;mol∙min<sup>−1</sup>∙mg<sup>−1</sup> on the S2d substrate. In comparison, the B. subtilis PBP4a used in the same conditions as a control, hydrolysed S2d with a 60-fold higher specific activity [<xref ref-type="bibr" rid="scirp.90927-ref17">17</xref>] .</p></sec><sec id="s3_2_2"><title>3.2.2. Aminopeptidase Activity</title><p>All the tested compounds gave negative results even after an overnight incubation at 37˚C.</p></sec><sec id="s3_2_3"><title>3.2.3. Esterase Activity</title><p>The full-length PBP4* did efficiently cleave the D-Ala methyl ester and the kinetic parameters have been determined (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="fig" rid="fig3">Figure 3</xref>). The K<sub>m</sub> values calculated with the GraphPad Prism 5.04 software or using the Hanes plot were 2.24 and 2.5 mM respectively.</p><p>According to the method used for calculating the parameters, the enzyme turnover (k<sub>cat</sub>) given by the V/E<sub>0</sub> ratio (E<sub>0</sub> being the enzyme molarity in the assay) was comprised between 129 and 133 s<sup>−1</sup> yielding K<sub>cat</sub>/K<sub>m</sub> ratios of 58 and 53 mM<sup>−1</sup>∙s<sup>−1</sup> respectively. The V<sub>max</sub> values of the PBP4* with this substrate were comprised between 0.6 to 0.62 mM<sup>−1</sup>∙s<sup>−1</sup>. Surprisingly, the esterase activity of the N-terminal domain (PBP4* ΔCTD) was only 20% of that obtained with the full-length PBP4*, indicating that the C-terminal domain is important for the hydrolysis of D-Ala methyl ester.</p></sec><sec id="s3_2_4"><title>3.2.4. Determination of the Substrate Stereospecificity of PBP4*</title><p>To know if the full-length PBP4* hydrolyses only the substrate in the D conformation, the racemic DL-Ala OMe substrate was used at the final concentrations of 10 mM for each form (a concentration corresponding to 4-fold the K<sub>m</sub> value determined with the pure D-substrate) and the release of D- or L-alanine was quantified using the DAAO or LAAO enzymes. The small amounts of L-alanine measured in the blank or in the sample were equal and it appeared clearly that only the D conformation of the substrate was recognized and hydrolyzed. The PBP4* esterase activity is therefore D-stereospecific. Since teichoic acids attached to the peptidoglycan of Gram positive bacteria are partly substituted with</p><table-wrap-group id="2"><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Conditions and results of biophysical characterizations of the B. subtilis PBP4* and PBP4* ΔCTD</title></caption><table-wrap id="2_1"><table><tbody><thead><tr><th align="center" valign="middle" >Thermal Denaturation Assay</th><th align="center" valign="middle"  colspan="2"  ></th><th align="center" valign="middle" ></th></tr></thead><tr><td align="center" valign="middle" >Instrument</td><td align="center" valign="middle"  colspan="3"  >Prometheus NT48 (Nano Temper)</td></tr><tr><td align="center" valign="middle" >Employed software</td><td align="center" valign="middle"  colspan="3"  >PR. control (NanoTemper)</td></tr><tr><td align="center" valign="middle" >Wavelength (nm)</td><td align="center" valign="middle"  colspan="3"  >ratio 350 - 330</td></tr><tr><td align="center" valign="middle" >Temperature gradient (˚C)</td><td align="center" valign="middle"  colspan="3"  >20 - 95</td></tr><tr><td align="center" valign="middle" >Heating rate (˚C min<sup>−1</sup>)</td><td align="center" valign="middle"  colspan="3"  >1</td></tr><tr><td align="center" valign="middle" >Protein sample</td><td align="center" valign="middle" >PBP4*</td><td align="center" valign="middle"  colspan="2"  >PBP4* ΔCTD</td></tr><tr><td align="center" valign="middle" >Concentration (&#181;M)</td><td align="center" valign="middle" >30</td><td align="center" valign="middle"  colspan="2"  >30</td></tr><tr><td align="center" valign="middle" >Buffer condition</td><td align="center" valign="middle"  colspan="3"  >25 mM HEPES, 100 mM NaCl, pH 8.0</td></tr><tr><td align="center" valign="middle" >Volume (&#181;L)</td><td align="center" valign="middle" >10</td><td align="center" valign="middle"  colspan="2"  >10</td></tr><tr><td align="center" valign="middle" >Results</td><td align="center" valign="middle"  colspan="3"  ></td></tr><tr><td align="center" valign="middle" >Fusion temperature Tm (˚C)</td><td align="center" valign="middle" >59˚C &#177; 0.3˚C</td><td align="center" valign="middle"  colspan="2"  >60˚C &#177; 0.2˚C</td></tr><tr><td align="center" valign="middle" >Dynamic Light Scattering Assay</td><td align="center" valign="middle"  colspan="2"  ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Instrument</td><td align="center" valign="middle"  colspan="3"  >DynaPro NanoStarTM (Wyatt Technologies)</td></tr><tr><td align="center" valign="middle" >Employed software</td><td align="center" valign="middle"  colspan="3"  >Dynamics 7.1.9. (Wyatt Technology)</td></tr><tr><td align="center" valign="middle" >Laser</td><td align="center" valign="middle"  colspan="3"  >100 mW He-Ne</td></tr><tr><td align="center" valign="middle" >Wavelength (nm)</td><td align="center" valign="middle"  colspan="3"  >658</td></tr><tr><td align="center" valign="middle" >Angle (˚)</td><td align="center" valign="middle"  colspan="3"  >90</td></tr><tr><td align="center" valign="middle" >Exposure time (sec)</td><td align="center" valign="middle"  colspan="3"  >50 (10 frames &#215; 5 sec)</td></tr><tr><td align="center" valign="middle" >Protein sample</td><td align="center" valign="middle" >PBP4*</td><td align="center" valign="middle"  colspan="2"  >PBP4* ΔCTD</td></tr><tr><td align="center" valign="middle" >Concentration (&#181;M)</td><td align="center" valign="middle" >30</td><td align="center" valign="middle"  colspan="2"  >30</td></tr><tr><td align="center" valign="middle" >Buffer condition</td><td align="center" valign="middle"  colspan="3"  >25 mM HEPES, 100 mM NaCl, pH 8.0</td></tr><tr><td align="center" valign="middle" >Temperature (˚C)</td><td align="center" valign="middle" >10</td><td align="center" valign="middle"  colspan="2"  >10</td></tr><tr><td align="center" valign="middle" >Volume (&#181;L)</td><td align="center" valign="middle" >50</td><td align="center" valign="middle"  colspan="2"  >50</td></tr><tr><td align="center" valign="middle" >Results</td><td align="center" valign="middle" ></td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >Hydrodynamic diameter (nm)</td><td align="center" valign="middle" >6.57 &#177; 0.062</td><td align="center" valign="middle"  colspan="2"  >5.462 &#177; 0.084</td></tr><tr><td align="center" valign="middle" >Polydispersity index (PDI)</td><td align="center" valign="middle" >0.016 &#177; 0.004</td><td align="center" valign="middle"  colspan="2"  >0.009 &#177; 0.002</td></tr><tr><td align="center" valign="middle" >Estimated molecular weight (kDa)</td><td align="center" valign="middle" >54.5 &#177; 1.22</td><td align="center" valign="middle"  colspan="2"  >35.17 &#177; 1.17</td></tr><tr><td align="center" valign="middle" >Exclusion Chromatography</td><td align="center" valign="middle"  colspan="2"  ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Column</td><td align="center" valign="middle"  colspan="3"  >Superdex S200 10/30 GL (GE Healthcare)</td></tr><tr><td align="center" valign="middle" >Instrument</td><td align="center" valign="middle"  colspan="3"  >&#197;kta Purifier (GE Healthcare)</td></tr><tr><td align="center" valign="middle" >Employed software</td><td align="center" valign="middle"  colspan="3"  >Unicorn (GE Healthcare Life Sciences)</td></tr><tr><td align="center" valign="middle" >Wavelength (nm)</td><td align="center" valign="middle"  colspan="3"  >280</td></tr><tr><td align="center" valign="middle" >Flow (mL min<sup>−1</sup>)</td><td align="center" valign="middle"  colspan="3"  >0.5</td></tr><tr><td align="center" valign="middle" >Injection loop volume (&#181;L)</td><td align="center" valign="middle"  colspan="3"  >100</td></tr><tr><td align="center" valign="middle" >Protein sample</td><td align="center" valign="middle" >PBP4*</td><td align="center" valign="middle"  colspan="2"  >PBP4* ΔCTD</td></tr><tr><td align="center" valign="middle" >Injected mass (&#181;g)</td><td align="center" valign="middle" >100</td><td align="center" valign="middle"  colspan="2"  >100</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><table-wrap id="2_2"><table><tbody><thead><tr><th align="center" valign="middle" >Buffer condition</th><th align="center" valign="middle"  colspan="3"  >25 mM HEPES, 100 mM NaCl, pH 8.0</th></tr></thead><tr><td align="center" valign="middle" >Temperature (˚C)</td><td align="center" valign="middle" >4</td><td align="center" valign="middle"  colspan="2"  >4</td></tr><tr><td align="center" valign="middle" >Results</td><td align="center" valign="middle" ></td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >Elution volume (mL)</td><td align="center" valign="middle" >14.75</td><td align="center" valign="middle"  colspan="2"  >15.24</td></tr><tr><td align="center" valign="middle" >Estimated mass (kDa)</td><td align="center" valign="middle" >55.97</td><td align="center" valign="middle"  colspan="2"  >45.37</td></tr><tr><td align="center" valign="middle" >Mass Determination</td><td align="center" valign="middle"  colspan="2"  ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Protein sample</td><td align="center" valign="middle" >PBP4*</td><td align="center" valign="middle"  colspan="2"  >PBP4* ΔCTD</td></tr><tr><td align="center" valign="middle" >Calculated monomeric mass(kDa) (from the sequence, using Expasy software)</td><td align="center" valign="middle" >~51</td><td align="center" valign="middle"  colspan="2"  >~41</td></tr><tr><td align="center" valign="middle" >Mass (kDa) (from DLS)</td><td align="center" valign="middle" >54.5 &#177; 1.22</td><td align="center" valign="middle"  colspan="2"  >35.17 &#177; 1.17</td></tr><tr><td align="center" valign="middle" >Mass (kDa) (from size-exclusion chromatography)</td><td align="center" valign="middle" >55.97</td><td align="center" valign="middle"  colspan="2"  >45.37</td></tr><tr><td align="center" valign="middle" >Oligomeric state in solution</td><td align="center" valign="middle" >Monomeric</td><td align="center" valign="middle"  colspan="2"  >Monomeric</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap></table-wrap-group><p>glucose and D-alanine, it was tempting to search for an esterase activity of the full length PBP4* on these compounds. Indeed, the PBP4* is active on suspensions of B. subtilis cell walls bearing teichoic acids [<xref ref-type="bibr" rid="scirp.90927-ref18">18</xref>] and after subtraction of the amount of D-alanine measured in the blank, 6.2 nmoles of D-alanine were found to be released from 1 mg of cell walls in the conditions described in Material and Methods.</p></sec></sec></sec><sec id="s4"><title>4. Conclusion</title><p>The entire B. subtilis PBP4* has been produced in E. coli as a recombinant protein of 453 residues after successful cleavage of the N-terminal extension. To detect a possible influence of the C-terminal domain (comprising 92 residues) on the folding, stability or enzymatic activity of PBP4*, the recombinant N-terminal (PBP) domain of 361 residues was also produced (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)) and some properties of both proteins have been characterized and compared (<xref ref-type="table" rid="table2">Table 2</xref>). The thermal stability of the full length PBP4* protein was not significantly modified by the C-terminal domain deletion (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). The results of Dynamic Light Scattering experiments (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)) and the size-exclusion chromatography profiles of PBP4* and PBP4* ΔCTD (<xref ref-type="fig" rid="fig1">Figure 1</xref>(d)) indicated that both proteins are monomeric in solution, excluding a possible oligomerization of the protein harboring the C-terminal extension. For the first time, a clear esterase enzymatic activity has been detected with the full length PBP4* and the kinetic parameters have been determined (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="fig" rid="fig3">Figure 3</xref>). This activity was D-stereospecific and was significantly lower with the protein lacking the C-terminal domain. A possible role of the C-terminal extension could be its participation in the productive positioning of the substrate in the enzymatic cleft. Structural data should provide information about this hypothesis. The full length PBP4* was also active on B. subtilis cell walls containing teichoic acids but however this result does not mean that teichoic acids are physiological substrates for the native PBP4*. This protein has been shown to be associated with the cytoplasmic membrane [<xref ref-type="bibr" rid="scirp.90927-ref1">1</xref>] . To influence the amount of D-alanine-substituted teichoic acids and thus their net charge, the active site of PBP4* must be located on the outer face of the cytoplasmic membrane. How the PBP4* is embedded into the membrane remains to elucidate. Such an esterase activity is compatible with a role for the PBP4* in recycling cell wall components as previously proposed [<xref ref-type="bibr" rid="scirp.90927-ref1">1</xref>] .</p></sec><sec id="s5"><title>Acknowledgements</title><p>We are grateful to Nicole Otthiers for the N-terminal sequencing of PBP4*, to Astrid Zervosen for the enzymatic assay on the S2d substrate, to Philippe Margot for the gift of Bacillus subtilis cell walls and to Jean-Marie Fr&#232;re for critical reading.</p></sec><sec id="s6"><title>Funding</title><p>This work was supported by the Belgian Programm on Interuniversity Poles of Attraction by the Prime Minister’s Office, Science Policy Programming (IAP P7/44). The funders had no role in study design, data analyses, decision to publish or preparation of the manuscript. Colette Duez was Research Associate of the Fonds National de la Recherche scientifique FRS-FNRS, Brussels, Belgium.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>The authors declare that no competing interests exist.</p></sec><sec id="s8"><title>Cite this paper</title><p>Vanden Broeck, A., Sauvage, E., Joris, B. and Duez, C. (2019) Characterization of the Bacillus subtilis Penicillin-Binding Protein PBP4*. Advances in Microbiology, 9, 164-176. https://doi.org/10.4236/aim.2019.93013</p></sec></body><back><ref-list><title>References</title><ref id="scirp.90927-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Popham, D.L. and Setlow, P. (1993) Cloning, Nucleotide Sequence, and Regulation of the Bacillus subtilis pbpE Operon, Which Codes for Penicillin-Binding Protein 4* and an Apparent Amino Acid Racemase. Journal of bacteriology, 175, 2917-2925. https://doi.org/10.1128/jb.175.10.2917-2925.1993</mixed-citation></ref><ref id="scirp.90927-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Sowell, M.O. and Buchanan, C.E. (1983) Changes in Penicillin-Binding Proteins during Sporulation of Bacillus subtilis. Journal of Bacteriology, 153, 1331-1337.</mixed-citation></ref><ref id="scirp.90927-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Cao, M., Kobel, A., Morshedi, M.M. and Wu, M.F. (2002) Defining the Bacillus subtilis σW Regulon: A Comparative Analysis of Promoter Consensus Search, Run-Off Transcription/Macroarray Analysis (ROMA), and Transcriptional Profiling Approaches. Journal of Molecular Biology, 316, 443-457. https://doi.org/10.1006/jmbi.2001.5372</mixed-citation></ref><ref id="scirp.90927-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Cao, M., Wang, T., Ye, R. and Helmann, J.D. (2002) Antibiotics That Inhibit Cell Wall Biosynthesis Induce Expression of the Bacillus subtilis σW and σM Regulons. Molecular Microbiology, 45, 1267-1276. https://doi.org/10.1046/j.1365-2958.2002.03050.x</mixed-citation></ref><ref id="scirp.90927-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Butcher, B.G. and Helmann, J.D. (2006) Identification of Bacillus subtilis σW-Dependent Genes That Provide Intrinsic Resistance to Antimicrobial Compounds Produced by Bacilli. Molecular Microbiology, 60, 765-782. https://doi.org/10.1111/j.1365-2958.2006.05131.x</mixed-citation></ref><ref id="scirp.90927-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Jordan, S., Hutchings, M.I. and Mascher, T. (2008) Cell Envelope Stress Response in Gram-Positive Bacteria. FEMS Microbiology Reviews, 32, 107-146. https://doi.org/10.1111/j.1574-6976.2007.00091.x</mixed-citation></ref><ref id="scirp.90927-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Wiegert, T., Homuth, G., Versteeg, S. and Schumann, W. (2001) Alkaline Shock Induces the Bacillus subtilis σW Regulon. Molecular Microbiology, 41, 59-71. https://doi.org/10.1046/j.1365-2958.2001.02489.x</mixed-citation></ref><ref id="scirp.90927-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Heinrich, J. and Wiegert, T. (2006) YpdC Determines Site-1 Degradation in Regulated Intramembrane Proteolysis of the RsiW Anti-Sigma Factor of Bacillus subtilis. Molecular Microbiology, 62, 566-579. https://doi.org/10.1111/j.1365-2958.2006.05391.x</mixed-citation></ref><ref id="scirp.90927-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Tam, L.T., Antelmann, H., Eymann, C., Albrecht, D., Bernhardt, J. and Hecker, M. (2006) Proteome Signatures for Stress and Starvation in Bacillus subtilis as Revealed by a 2-D Gel Image Color Coding Approach. Proteomics, 6, 4565-4585. https://doi.org/10.1002/pmic.200600100</mixed-citation></ref><ref id="scirp.90927-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Hahne, H., M&amp;#228;der, U., Otto, A., Bonn, F., Steil, L., Bremer, E., Hecker, M. and Becher, D. (2010) A Comprehensive Proteomics and Transcriptomics Analysis of Bacillus subtilis Salt Stress Adaptation. Journal of Bacteriology, 192, 870-882. https://doi.org/10.1128/JB.01106-09</mixed-citation></ref><ref id="scirp.90927-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Palomino, M.M., Sanchez-Rivas, C. and Ruzal, S.M. (2009) High Salt Stress in Bacillus subtilis: Involvement of PBP4* as a Peptidoglycan Hydrolase. Research in Microbiology, 160, 117-124. https://doi.org/10.1016/j.resmic.2008.10.011</mixed-citation></ref><ref id="scirp.90927-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Zellmeier, S., Zuber, U., Schumann, W. and Wiegert, T. (2003) The Absence of FtsH Metalloprotease Activity Causes Overexpression of the σW-Controlled pbpE Gene, Resulting in Filamentous Growth of Bacillus subtilis. Journal of Bacteriology, 185, 973-982. https://doi.org/10.1128/JB.185.3.973-982.2003</mixed-citation></ref><ref id="scirp.90927-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Scheffers, D.-J. (2005) Dynamic Localization of Penicillin-Binding Proteins during Spore Development in Bacillus subtilis. Microbiology, 151, 999-1012. https://doi.org/10.1099/mic.0.27692-0</mixed-citation></ref><ref id="scirp.90927-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Scheffers, D.-J., Jones, L.J. and Errington, J. (2003) Several Distinct Localization Patterns for Penicillin-Binding Proteins in Bacillus subtilis. Molecular Microbiology, 51, 749-764. https://doi.org/10.1046/j.1365-2958.2003.03854.x</mixed-citation></ref><ref id="scirp.90927-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Adam, M., Damblon, C., Jamin, M., Zorzi, W., Dusart, V., Galleni, M., El Kharroubi, A., Piras, G., Spratt, B.G. and Keck, W. (1991) Acyltransferase Activities of the High-Molecular-Mass Essential Penicillin-Binding Proteins. Biochemical Journal, 279, 601-604. https://doi.org/10.1042/bj2790601</mixed-citation></ref><ref id="scirp.90927-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Frère, J.-M., Leyh-Bouille, M., Ghuysen, J.-M., Nieto, M. and Perkins, H.R. (1976) Exocellular DD-Carboxypeptidases-Transpeptidases from Streptomyces. Methods in Enzymology, 45, 610-636. https://doi.org/10.1016/S0076-6879(76)45054-1</mixed-citation></ref><ref id="scirp.90927-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Duez, C., Vanhove, M., Gallet, X., Bouillenne, F., Docquier, J.-D., Brans, A. and Frère, J.-M. (2001) Purification and Characterization of PBP4a, a New Low-Mo- lecular-Weight Penicillin-Binding Protein from Bacillus subtilis. Journal of Bacteriology, 183, 1595-1599. https://doi.org/10.1128/JB.183.5.1595-1599.2001</mixed-citation></ref><ref id="scirp.90927-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Margot, P. and Karamata, D. (1996) The wprA Gene of Bacillus subtilis 168, Expressed during Exponential Growth, Encodes a Cell-Wall-Associated Protease. Microbiology, 142, 3437-3444. https://doi.org/10.1099/13500872-142-12-3437</mixed-citation></ref></ref-list></back></article>