The
TTG1 transcription factor plays an important role in the formation of plant trichomes. Based on the
R. rugosa transcriptome data, this study cloned a
R. rugosa TTG1 gene, named
RrTTG1, and carried out bioinformatics analysis and fluorescence quantitative analysis to explore the relationship between
TTG1 gene and
R. rugosa trichomes formation, in order to lay a good foundation to cultivate a thornless plant in the family
Rosaceae. In this experiment, six hybrid cultivars of
R. rugosa “Zizhi”,
R. rugosa “Xizi”,
R. rugosa “Tang fen”,
R. rugosa “Hun chun”,
R. rugosa “Zi long wo chi” and
R. rugosa “Tian e huang” were used as experimental materials, and the cDNA full length of this gene was obtained by RT-PCR and RACE, and the full length of the cDNA was 1348 bp. After bioinformatics analysis, it is predicted that its molecular formula is C
1723H
2661N
465O
529S
12, the molecular weight is 38.71 KB, and the isoelectric point is 5.00. Its instability index is 54.30, which belongs to unstable protein; and its hydrophilic amino acid distribution is relatively uniform, and the amount is larger than hydrophobic amino acid, which belongs to hydrophilic protein. Phylogenetic tree was constructed for the
TTG1 gene. Evolutionary analysis indicated that
RrTTG1 is closely related to the
TTG1 protein of
Rosaceae family, and has a close relationship with other families. The expression analysis showed that the expression of
RrTTG1 protein was negatively correlated with the trichome content of
R. rugosa stems and leaves. The expression levels of the three spiny varieties of
R. rugosa “Hun chun”,
R. rugosa “Xizi” and
R. rugosa “Zi long wo chi” were lower, and the expressions of the three less thorn varieties of
R. rugosa “Zizhi”,
R. rugosa “Tian e huang” and
R. rugosa “Tang fen” were higher. According to the above results, it was speculated that
RrTTG1 is involved in the synthesis of
R. rugosa trichomes and belongs to the negative regulation mechanism.
R. rugosa is a perennial evergreen or deciduous shrub of the genus Rosa in the family Rosaceae. It is rich in fragrant citronellol, eugenol and other aroma substances and a large number of vitamins, pigments, ecdysteroids and other substances. It can be used as a raw material for food, cosmetics, spices, pigments and medicines. And it has high economic value. At present, R. rugosa is getting more and more attention [1] [2] [3] . However, because the stem of the R. rugosa has many thorns, it has many inconveniences in the process of cultivation management and flower picking. If it can breed a few thorns or even thornless R. rugosa, it will greatly improve the work efficiency in the process of cultivation management and flower picking. The thorn of the R. rugosa belongs to the prickle, which is a special form of the epidermis. Plant trichomes are developed from epidermal cells and are a protective tissue covering the surface of plants. It is the outermost layer of plant contact with the environment. There are many different types of plant trichomes, and different species are different, even though the same species may exist in several different types [4] . In addition to prickles, the leaf hair and root hair of R. rugosa are also a type of trichomes.
In recent years, the research on the molecular genetic control mechanism of plant trichomes development has made great progress, but it has been concentrated on the model plant Arabidopsis for a long time, and the development model has been studied relatively thoroughly. Although some studies have been carried out on the morphological structure, histochemistry, developmental origin and genetic analysis of trichomes of other plants of Rosaceae [5] [6] [7] , the understanding of molecular genetics and control of trichomes development is not deep enough [8] . Therefore, this experiment is based on the molecular regulation mechanism of Arabidopsis trichomes development. R. rugosa “Zizhi”, R. rugosa “Xizi”, R. rugosa “Tang fen”, R. rugosa “Hun chun”, R. rugosa “Zi long wo chi” and R. rugosa “Tian e huang” were used as experimental materials to isolate the TTG1 gene associated with the formation of plant trichomes, aiming to lay the foundation for systematic study of the molecular mechanism of R. rugosa trichomes development. TTG1 is one of the important genes controlling trichomes development in Arabidopsis [9] , and its mutant ttg1 has a functional loss, which is manifested as almost complete loss of trichomes development; and its over expression in Arabidopsis wild type does not produce excessive trichomes [10] . In addition, the results of TTG1 gene in many other plants also indicate the importance for trichomes formation, including Cucumis sativus [11] , Brassica napus [12] , Saussurea hypsipeta [13] , Saussurea medusa [14] , Nicotiana tabacum [15] , Rosa roxbunghii [16] and so on.
Based on the transcriptome of R. rugosa, we cloned a TTG1 gene associated with R. rugosa trichomes synthesis, named RrTTG1, and then analyzed its bioinformatics and constructed a phylogenetic tree to predict its function. The expression levels of RrTTG1 in different varieties and different tissue sites were identified by using qPCR technology. By figuring out how RrTTG1 works in the synthesis of R. rugosa trichomes, we could lay a solid foundation for the development of new varieties of Rosaceae family that are less or even thornless.
2. Materials and Methods
The experiment was conducted at the flower germplasm resource nursery of Shandong Agricultural University and the Flower Institute of Forestry College.
2.1. Plant Material
We chose healthy individuals with stable floral inheritance of R. rugosa “Zizhi”, R. rugosa “Xizi”, R. rugosa “Tang fen”, R. rugosa “Hun chun”, R. rugosa “Zi long wo chi” and R. rugosa “Tian e huang” as experiment material, which grown in the field of rose germplasm resource nursery. The above six varieties of roots, stems, leaves and flowers were collected for gene cloning and differential expression tests between the varieties. All samples were collected and frozen in liquid nitrogen immediately, then stored at −80˚C until used.
2.2. Methods2.2.1. RNA Extraction, cDNA Synthesis and Gene Cloning
The extraction of RNA from various tissue parts of R. rugosa was operated according to the instructions of EASYspin plant RNA rapid extraction kit, the integrity of RNA was detected by 1% agarose gel electrophoresis and its concentration and purity were tested by ultraviolet spectrophotometer. The cDNA was synthesized by RNA reverse transcription kit according to the description of abm reverse transcription kit.
Full-length amplification: The specific primers for complete ORF amplification “Table 1” were designed by DNAMAN software. The synthesized cDNA was used as template, and the reaction system was as follows: 2 × Gflex PCR Buffer 12.5 µL, the target gene upstream and downstream primers each 1 µL, template cDNA 1 µL, TKS Gflex DNA Polymerase 0.5 µL, sterilization ddH2O supplement to 25 µL; The PCR reaction conditions are as follows: 94˚C for 1 min; 98˚C for 10 s, 55˚C for 15 s, and 65˚C for 30 s for a total of 30 cycles. The PCR products was detected by 1% agarose gel electrophoresis, and the target product was reclaimed according to the description of Hipure Gel Pure DNA Mini Kit (Magen), then ligated with the carrier pMD18-T to transform Escherichia coli DH5α. Positive clones were selected and sequenced at Ruibiotech.
2.2.2. Bioinformatics Analysis
The ORF finder (NCBI) was used to search for an open reading frame, and the Conserved Domains database (NCBI) was used to analyze the conserved domains. ExPaSy-SOPMA was used to predict protein secondary structure. We used BLASTX (NCBI) to study the homology of the nucleotide sequence and conducted multiple sequence alignment by DNAMAN, and then constructed phylogenetic tree with other anthocyanin-promoting proteins by MEGA5.0 software. The phylogenetic tree was constructed according to the neighbor-joining method, and tested by bootstrap, which was repeated 1000 times.
Primers used to clone and analyze the expression of RrTTG1 and the vector construction in Rosa rugosa
Primer name
(5’→3’) Nucleotide sequence*
Purpose
Rr-TTG1-F
ATGGAGAACTCGACCCAAG
Full-length cDNA for Rr-TTG1
Rr-TTG1-R
TCAAACCTTCAACAGCTGC
Actin-F
CACTTAGCACCTTCCAGCAGATGT
qRT-PCR for Rr-TTG1 and Actin
Actin-R
CTACAACAGCAGACCTGAGTTCACT
Rr-TTG1-Q-F
ACTAGTATGGAGAACTCGACCCAAG
Rr-TTG1-Q-R
CACGTGTCAAACCTTCAACAGCTGC
Rr-TTG1-P-F
ACATCCTCGCCTCTTCCG
Expression vector construction for Rr-TTG1
Rr-TTG1-P-R
GGGCTCGATCTCGTTCCA
2.2.3. Expression Analysis of RrTTG1 in Different Varieties and Different Tissues
The cDNA synthesized from RNA in different tissues and different variety was used as template, and it was carried out following the instruction of SYBR®Premix ExTaqTM kit by CFX96TM Real-Time System RT-qPCR instrument. The suitable primers of RrTTG1 for RT-PCR were selected by standard curve method. The specific primers and internal reference primers (Actin) are shown in “Table 1”. The reaction system is: Mix10 ul, cDNA 1 µL, 0.4 µL each of upstream and downstream primer, adding sterilizing ddH2O up to 20 µL. The reaction procedure was: predenaturation at 95˚C for 30 s; 95˚C for 30 s, 60˚C for 30 s for a total of 39 cycles. The relative expression level was calculated by the method of 2−ΔΔCT. And the data analysis was graphed through Sigmaplot 10.0.
2.2.4. Construction of Expression Vector
Choosing SpeI and PmlI as restriction enzymes, designing primers with restriction enzyme sites and then cloning the full length. Then the RrTTG1 and expression vector pCAMBIA1304 were digested by restriction endonucleases SpeI and PmlI, and the target fragments were recycled and connected with solution I. Positive clones were selected and sequenced at Ruibiotech. The diagram of pCAMBIA1304 was shown in “Figure 1”.
3. Results and Analysis3.1. Cloning and Sequence Analysis of RrTTG1
The TTG1 gene was cloned from the petals of R. rugosa “Zizhi”, named RrTTG1. The full length of RrTTG1 gene was 1348 bp, and the open reading frame was 1038 bp “Figure 2”, encoding 346 amino acids.
Multiple sequence alignment analysis revealed “Figure 3” that the amino acid sequence encoded by RrTTG1 has four WD40 repeat units, which, like the AtTTG1 gene of the model plant Arabidopsis, indicates that RrTTG1 is a homologous gene belonging to WD 40 superfamily. And the domain is a short peptide containing about 40 amino acids, usually starting with Gly-His and ending with Try-Asp. In order to study the evolutionary relationship between RrTTG1 and TTG1 in other species, the phylogenetic tree was constructed and analyzed by BLAST alignment of 15 species with higher homology. The phylogenetic tree was constructed using MEGA 5.0 software, and the phylogenetic tree was tested using bootstrap for a total of 1000 repetitions “Figure 4”. The results showed that the TTG1 gene was closely related to the TTG1 protein of the Rosa chinensis, and it was clustered with seven TTG1 proteins of other Rosaceae family plants such as Fragaria vesca, Rubus chingii, Amygdalus persica, Malus domestica and Pyrus bretschneideri. Five kinds of TTG1 proteins such as Malva sinensis, Hevea brasiliensis, Morus alba, Ziziphus jujuba are clustered together, which is far away from R. rugosa; the TTG1 protein of Nicotiana tabacum and Solanum tuberosum is clustered, and the relationship with the RrTTG1 protein is the farthest.
3.2. Bioinformatics Analysis of RrTTG1 Gene
There are 346 amino acids encoded by RrTTG1. The protein’s formula is C1723H2661N465O529S12 with a molecular weight of 38.71 KB and a theoretical pI: 500. Among the composition of the entire amino acid, acidic amino acids accounted for 13.01%, basic amino acids accounted for 11.27%, hydrophobic amino acids accounted for 44.80%, charged amino acids accounted for 21.38%, and polar amino acids accounted for 30.92%. Its instability index is 54.30, which is unstable protein. The hydrophilic amino acid distribution of RrTTG1 is relatively uniform and the amount is larger than that of hydrophobic amino acids. It is concluded that RrTTG1 protein is a hydrophilic protein. The secondary structure of RrTTG1 demonstrates that there are 38 α-helix, 182 random coil, 114 extended peptide chain, and 12 β-turn. The phosphorylation site prediction results reveals that there are 37 Ser phosphorylation sites, 28 Ala phosphorylation sites, and 28 Leu phosphorylation sites, so we can infer that it may participate in phosphorylation control.
3.3. Expression Analysis of RrTTG1 in Different Varieties and Different Tissues
To analyze the cultivar specificity and tissue specificity of RrTTG1 gene expression, the RrTTG1 gene was detected by quantitative RT-PCR in roots, stems and leaves of R. rugosa “Zizhi”, R. rugosa “Xizi”, R. rugosa “Tang fen”, R. rugosa “Hun chun”, R. rugosa “Zi long wo chi” and R. rugosa “Tian e huang”. The real-time fluorescence quantitative results of RrTTG1 indicated that the expression level of the leaves was the highest in the different tissues of R. rugosa “Zizhi” “Figure 5(a)” and R. rugosa “Tian e huang” “Figure 5(b)”, and the expression in the stem was the second, and the expression in the root was the lowest; The expression of RrTTG1 was highest in the leaves of R. rugosa “Xizi” “Figure 5(c)” and R. rugosa “Tang fen” “Figure 5(f)”, the second in the root, and the lowest in the stem; The expression of this gene was highest in the roots of different parts of R. rugosa “Zi long wo chi” “Figure 5(d)”, the expression in the stem was the second, and the expression in the leaves was the lowest. The expression of this gene in the different tissues of R. rugosa “Hun chun” “Figure 5(e)” was similar, the expression level in the stem was the highest, and the expression in the root and leaf was not much different. Comparing the expression levels of RrTTG1 gene in the roots “Figure 6” of six cultivars, it was found that the expression level of R. rugosa “Zi long wo chi” was the highest, followed by R. rugosa “Tian e huang”, and the expression of RrTTG1 in the other four varieties was very small; The expression levels of the gene in the stems “Figure 7” of six varieties showed that the expression level of R. rugosa “Tian e huang” was the highest, the expression level of R. rugosa “Zizhi” and R. rugosa “Tang fen” was the second, and the expression level of the other three varieties was lower. Comparing the expression levels of RrTTG1 gene in the leaves “Figure 8”of six varieties, the expression level of R. rugosa “Tang fen” was the highest, and the expression levels of R. rugosa “Tian e huang”, R. rugosa “Zizhi”, R. rugosa “Hun chun” and R. rugosa “Xizi” were similar. R. rugosa “Zi long wo chi” has the lowest expression level.
3.4. Construction of Plasmid for Transient Gene Expression Assay
The RrTTG1 and expression vector pCAMBIA1304 were digested by restriction endonucleases SpeI and PmlI, and the target fragments “Figure 9” were recycled and connected with solution I. Enzyme digestion analysis and DNA sequencing showed that the co-expressed protein expressing vectors were constructed successfully. Next, we are going to transfer the recombinant plasmid RrTTG1-pCAMBIA1304 to Arabidopsis thaliana to verify its function.
4. Discussion
In this study, the RrTTG1 gene was cloned from R. rugosa, and its structural characteristics were analyzed. It was found that the RrTTG1 protein coding sequence has four WD40 repeating units, which is a short peptide containing about 40 amino acids, often starting with glycine-histidine, ending with tryptophan-aspartate. WD40 protein is a large family with extensive cell biology and biochemical functions, such as involved in photoreceptor and conduction, cell division and cytoplasmic movement, flower development, flowering, cell movement, and programmed cell death [17] [18] [19] .
Through the NCBI homology alignment, the RrTTG1 amino acid sequence of R. rugosa has high homology with Fragaria vesca, Rubus chingii, Malus domestica, Nicotiana tabacum and other plants. In these plants, the function of TTG1 gene is different. In Malus domestica, MaTTG1 regulates the synthesis of anthocyanins [20] ; In Nicotiana tabacum, the NiTTG1 gene is involved in the regulation of plant trichomes development [15] . The function of the TTG1 gene is diverse, and whether it is important in the formation of R. rugosa trichomes. The biological function remains to be verified by further research.
In several developmental and biochemical pathways of plants, TTG1 is involved in the regulation of trichomes, development of seed coat and seed coat pigment, biosynthesis of flavonoids and anthocyanidins [21] . In the Arabidopsis thaliana ttg1 mutant, the epidermis of stems and leafs and the subepidermal layer are completely deficient in anthocyanins, the seed coat cannot form anthocyanins and the outer seed coats appear as transparent traits, and trichomes function is absent without epidermis or less epidermis. The ttg1 mutant can cause so many changes in physiological processes, suggesting that TTG1 is a gene ubiquitous in most regulatory pathways [10] .
Generally, there are prickles on the stems of R. rugosa. The field morphology observation shows that there are more epidermis on the leaves and stems of R. rugosa “Zi long wo chi”, R. rugosa “Xizi” and R. rugosa “Hun chun”. There were fewer epidermis on the leaves and stems of the three varieties of R. rugosa “Tian e huang”, R. rugosa “Zizhi” and R. rugosa “Tang fen”. This study found that RrTTG1 gene was expressed in different R. rugosa varieties and different tissues, and the content in the leaves and stems of R. rugosa “Zi long wo chi”, R. rugosa “Xizi” and R. rugosa “Hun chun”. were lower. The contents of leaves and stems of R. rugosa “Tian e huang”, R. rugosa “Zizhi” and R. rugosa “Tang fen” were higher. It is speculated that RrTTG1 gene may be associated with the formation of R. rugosa trichomes and may play a negative regulatory role in R. rugosa leaves and stems. In addition, the RrTTG1 gene has a large difference in the roots of six R. rugosa varieties. Except for the R. rugosa “Zi long wo chi”, only a small amount of RrTTG1 was detected in the other five varieties. Whether TTG1 is a key gene, and whether there are other genes that control the development of R. rugosa trichomes remains to be further verified.
5. Conclusion
In conclusion, in this study, we cloned the RrTTG1 gene in R. rugosa, obtained the full-length cDNA of 1348 bp, and analyzed it by bioinformatics. The molecular formula C1723H2661N465O529S12 was predicted, which was inferred to be unstable protein and Hydrophilic protein. Furthermore, it was concluded by fluorescence quantitative analysis that the RrTTG1 gene is involved in the regulation of the synthesis of R. rugosa epidermis, which is a negative regulation mechanism. This study is helpful for analyzing the formation mechanism of R. rugosa epidermis and provides some important information for breeding stingless Rosaceae family plants.
Conflicts of Interest
The authors declare no conflicts of interest regarding the publication of this paper.
Cite this paper
Wang, Y., Zhao, M.Y., Xu, Z.D., Zhao, L.Y. and Han, X. (2019) Cloning and Expression Analysis of TTG1 Gene Related to Rosa rugosa Trichomes Formation. American Journal of Plant Sciences, 10, 265-275. https://doi.org/10.4236/ajps.2019.102020
NOTESReferencesJin J.H. ,et al. (2000)Comprehensive Development of Rosa rugosa Chinese Wild Plant Resource 6, 21-25.Ma, J. (2002) Rosa rugosa and Its Development Prospects. Rural Science and Technology Development, 2, 12.Zhao, X.F. and Wu, R.Sh. (2004) Comprehensive Utilization of Rosa rugosa and Its Development Prospects. Preservation and Processing, 4, 30-31.Payne, T., Clement, J., Arnold, D. and Lloyd, A. (1999) Heterologous Myb Genes Distinct from GL1 Enhance Trichome Production When Overexpressed in Nicotiana Tabacum. Development, 126, 671-682.Crespel, L., Chirollet, M., Durel, C.E., et al. (2002) Mapping of Qualitative and Quantitative Phenotypic Traits in Rosa Using AFLP Markers. Theoretical and Applied Genetics, 105, 1207-1214. https://doi.org/10.1007/s00122-002-1102-2Asano, G., Kubo, R. and Tanimoto, S. (2008) Growth, Structure and Lignin Localization in Rose Prickle. Bulletin of the Faculty of Agriculture, 93, 117-125.Kellogg, A.A., Branaman, T.J., Jones, N.M., et al. (2011) Morphological Studies of Developing Rubus Prickles Suggest That They Are Modified Glandular Trichomes. Botany, 89, 217-226. https://doi.org/10.1139/b11-008Li, H., Liu, F.L., Xi, L., et al. (2012) Tissue Structure and Chemical Composition of Rosa Chinensis Prickles. Journal of Horticulture, 39, 1321-1329.Szymanski, D.B., Lloyd, A.M. and Marks, M.D. (2000) Progress in the Moleculargenetic Analysis of Trichome Initiation and Morphogenesis in Arabidopsis. Trends in Plant Science, 5, 214-219. https://doi.org/10.1016/S1360-1385(00)01597-1Walker, A.R., Davision, P.A., Biolognesi-Winfield, A.C., et al. (1999) The TRANSPARENT TESTA GLABRA1 Locus, Which Regulates Trichome differentiation and Anthocyanin Biosynthesis in Arabidopsis, Encodes aWD40 Repeat Protein. Plant Cell, 11, 1337-1350. https://doi.org/10.1105/tpc.11.7.1337Li, Q. (2013) Localization, Homologous Cloning and Functional Study of Epidermal Hairy Genes in Cucumber. Shandong Agricultural University, Tian’an.Liu, K.G., Qi, Sh.H., Duan, Sh.W., et al. (2017) Functional Analysis of BnTTG1-1 Gene in Brassica Napus. Plant Journal, 52, 713-722.Shi, G.M. (2018) Cloning and Functional Analysis of Epidermal Hair Development Related Gene ShTTG1 in Saussurea hypsipeta. Qinghai University, Xi’ning.Hu, X.M. (2017) Genetic Transformation of SmTTG1 Gene Related to Epidermal Hair Development of Saussurea medusa. Qinghai University, Xi’ning.Zhang H.Y. ,et al. (2016)Nicotiana tabacum Important Genes 13: Nicotiana tabacum Gland Hair Development and Development Related Genes Chinese Nicotiana tabacum Science 37, 97-100.Zeng, J.W., Ma, W.T. and An, H.M. (2018) Cloning and Bioinformatics Analysis of WD40 Transcription Factor RroTTG1 Gene from Rosa roxbunghii. Molecular Plant Breeding, 1-10.Neer, E.J., Schmidt, C.J., Nambudripad, R., et al. (1994) The Ancient Regulatory Protein Family of WD-Repeat Proteins. Nature, 371, 297-300. https://doi.org/10.1038/371297a0Smith, T.F., Gaitatzes, C., Saxena, K., et al. (1999) The WD Repeat: A Common Architecture for Diverse Function. Trends in Biochemical Sciences, 24, 181-185. https://doi.org/10.1016/S0968-0004(99)01384-5Koornneef M. ,et al. (1990)Mutations Affecting The Testa Colour in Arabidopsis Arabidopsis Information Service 27, 1-4.An, X.H. (2013) Study on the Mechanism of Regulation of Anthocyanin Synthesis by Malus domestica MdTTG1, MdMYB9 and MdMYB11 Genes. Shandong Agricultural University, Tian’an.Ramsay, N.A. and Glover, B.J. (2005) MYB-bHLH-WD40 Protein Complex and the Evolution of Cellular Diversity. Trends in Plant Science, 10, 63-70. https://doi.org/10.1016/j.tplants.2004.12.011