<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2018.913200</article-id><article-id pub-id-type="publisher-id">AJPS-89447</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  DNA Barcoding and Identification of Medicinal Plants in the Kingdom of Bahrain
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Malabika</surname><given-names>Roy Pathak</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Abdulaziz</surname><given-names>A. M. Mohamed</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Muhammad</surname><given-names>Farooq</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Ministry of Works and Municipalities Affairs and Urban Planning, Manama, Kingdom of Bahrain</addr-line></aff><aff id="aff1"><addr-line>Department of Life Sciences, Arabian Gulf University, Manama, Kingdom of Bahrain</addr-line></aff><pub-date pub-type="epub"><day>05</day><month>12</month><year>2018</year></pub-date><volume>09</volume><issue>13</issue><fpage>2757</fpage><lpage>2774</lpage><history><date date-type="received"><day>5,</day>	<month>November</month>	<year>2018</year></date><date date-type="rev-recd"><day>23,</day>	<month>December</month>	<year>2018</year>	</date><date date-type="accepted"><day>26,</day>	<month>December</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution-NonCommercial International License (CC BY-NC).http://creativecommons.org/licenses/by-nc/4.0/</license-p></license></permissions><abstract><p>
 
 
  Authentication of medicinally important plants 
  is e
  ssential for increasingly demands of herbal remedies worldwide. DNA barcoding technology is currently gaining importance as a reliable tool for plant species identification, although one barcode gene is not enough in the exceptions. Short sequence diversity of standardized specific coding gene regions of 
  &lt;i&gt;
  rbcLa
  &lt;/i&gt;
   and 
  &lt;i&gt;
  matK
  &lt;/i&gt;
   of plastid genome together with noncoding ribosomal internal transcribed spacer 2 (ITS2) marker 
  is 
  used as barcode to compare and differentiate plant species. The success of obtaining sequences of the 29 analyzed plants distributed in 21 families using three different barcode genes 
  &lt;i&gt;
  rbcLa
  &lt;/i&gt;
  , 
  &lt;i&gt;
  matK
  &lt;/i&gt;
   and ITS2 were 97%, 79% and 75% respectively. Multiple sequence alignment confirmed the medicinal plants at species level by 89.28%, 86.32% and 60.86% obtained through 
  &lt;i&gt;
  rbcLa
  &lt;/i&gt;
  , ITS2 and 
  &lt;i&gt;
  matK
  &lt;/i&gt;
   barcodes sequences respectively. The genetic distance between sequence pairs (GD) and percentage identity (PI) 
  is 
  compared to analyze the plant identity at species level. The phylogenic trees constructed to show the relatedness and distance of the analyzed plants in the history of evolution by the analysis of richness of clades. The construction of DNA barcode library of desert medicinal plants is an introductory research arena in Kingdom of Bahrain in helping the routine identification of plants, 
  and 
  developing guidelines for detection of adulterants in herbal medicines as well as protection of biodiversity.
 
</p></abstract><kwd-group><kwd>DNA Barcode</kwd><kwd> Medicinal Plants</kwd><kwd> Phylogenetic Tree</kwd><kwd> Species Identification</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Medicinal plants are used since ancient time for the treatment and management of human and animal diseases. The use of medicinal plants in traditional medicine as well as in modern drugs discovery has well documented to maintain world health and to treat chronic diseases [<xref ref-type="bibr" rid="scirp.89447-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref3">3</xref>]. According to WHO, in an estimation around 25% modern drugs are derived from medicinal plants either directly or indirectly and between 70% - 95% of the populations of developing countries and 42% - 80% population of developed countries including the USA and Europe, using traditional medicines as primary health care in different name according to regions [<xref ref-type="bibr" rid="scirp.89447-ref4">4</xref>]. Drug discovery from medicinal plant leads to various target diseases including cancer, HIV/AIDS, Alzheimer’s, malaria, and pains etc. and around 60% of the antitumor and anticancer drugs have derived from natural products [<xref ref-type="bibr" rid="scirp.89447-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref6">6</xref>]. Although, drug discovery of medicinal plants explored only a small fraction of the huge diversity of plant metabolism, while most of the secondary bi-products have huge contributions in human society [<xref ref-type="bibr" rid="scirp.89447-ref7">7</xref>].</p><p>The Kingdom of Bahrain, geographically consists of several scattered islands in the middle of the Arabian Gulf, prevails semi-desert to desert environment with year wide average day temperature 36˚C (14˚C to 48˚C), scanty of average rainfall (39 to 128 mm per year) and holds several hundred species of flora. The number of vascular plant species reaches 357 of which most of these plants are adapted to the hot, arid and semi-arid environment [<xref ref-type="bibr" rid="scirp.89447-ref8">8</xref>]. Among them, 25% plants are used as a medicinal herb by Bahrainis or by others residents in the Arabian Peninsula or neighboring countries [<xref ref-type="bibr" rid="scirp.89447-ref9">9</xref>]. The usefulness of regional plants around 70% is of native while others introduced through Bedouin culture of the Arab region. The practice is still strong in the rural Arab regions in the treatment of minor ailments with these plants including ulcers, pneumonia, stomach disorders, rheumatism, diabetes, renal problems, and bronchitis [<xref ref-type="bibr" rid="scirp.89447-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref11">11</xref>]. Some of the medicinally important desert plants are multipurpose plants in the Kingdom of Bahrain and some of them are threatened and restricted in distribution due to rapid urbanization, climate change as well as unsustainable utilization of natural resources [<xref ref-type="bibr" rid="scirp.89447-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref13">13</xref>].</p><p>In the recent time, the correct identification of medicinal plants is prerequisite for their safe use in new drug discovery. The traditional identification of plants by taxonomist needs collection of proper morphological data during their growing season with reproductive organs such as flowers and fruits, which are often difficult, time consuming, and mostly unavailable during field survey [<xref ref-type="bibr" rid="scirp.89447-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref15">15</xref>]. Moreover, the traditional methods of using the medicinal plant to cure various diseases is common but due to lack of proper taxonomic identification, the herbal industry suffers for substitution and adulteration of medicinal herbs with closely related species [<xref ref-type="bibr" rid="scirp.89447-ref16">16</xref>]. Identification of biological samples using DNA barcoding is a novel method of species identification and study molecular evolution [<xref ref-type="bibr" rid="scirp.89447-ref15">15</xref>]. DNA barcoding is considered as a molecular and bioinformatics tool for species differentiation, identification and discovery of new species at molecular taxonomy level [<xref ref-type="bibr" rid="scirp.89447-ref17">17</xref>]. DNA barcodes are short, specific regions of DNA that can amplify and can be sequenced routinely using universal primers and the recovered standardized short sequence of DNA depicted as a unique identification marker for species [<xref ref-type="bibr" rid="scirp.89447-ref18">18</xref>]. Gradually, study and comparison of unknown plant barcode sequences with the sequences of the Global DNA reference libraries help to identify unknown plant samples as well as helpful to evaluate, understand, preserve and utilize biodiversity in a widely presented way [<xref ref-type="bibr" rid="scirp.89447-ref19">19</xref>].</p><p>The searching of DNA barcode in a wide range of flowering land plants is delicate as well as challenging enough in comparison to animal barcode region of mitochondrial gene COI, which is not effective in plants [<xref ref-type="bibr" rid="scirp.89447-ref20">20</xref>]. Hybridization, lack of sequence polymorphism, low nucleotide substitution rate and frequent integration of gene flow between sister species are the critical barriers in the selection of universal barcoding gene region in land plants [<xref ref-type="bibr" rid="scirp.89447-ref17">17</xref>]. Moreover, the desert plants adopted to endure in tough conditions of environment and soil; as a result, they possess different survival characteristics and molecular diversity [<xref ref-type="bibr" rid="scirp.89447-ref21">21</xref>]. The success in identification of plant species based on DNA barcode analysis depends on the comprehensive database analysis, otherwise missing and cryptic species cannot be identified, if identified there is a risk of the tested sample to a wrong species [<xref ref-type="bibr" rid="scirp.89447-ref22">22</xref>]. In addition, the presence of shared haplotype between closely related species (having identical DNA sequences) is facing limitations of the technique [<xref ref-type="bibr" rid="scirp.89447-ref18">18</xref>]. Barcoding of vascular plants was mostly focused on markers of chloroplast genes, several markers were tested and with time most commonly used combinations are rbcL, matK, trnH-psbA, with a nuclear internal transcribed spacer (ITS2) established [<xref ref-type="bibr" rid="scirp.89447-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref24">24</xref>].</p><p>The survival characteristics of the desert medicinal plants due to the harsh arid environment as well as the archipelago nature (natural as well as artificial) of the Kingdom of Bahrain restricted plant distribution over the time of urbanization [<xref ref-type="bibr" rid="scirp.89447-ref10">10</xref>]. Until recently, there is no report to work on DNA barcode of any plants in Kingdom of Bahrain for identification or any other purpose. We collected 29 medicinally important plant species of Kingdom of Bahrain from different location. The sampling purpose is the molecular identification of collected 29 medicinally important plant using DNA based barcode study. Here, our primary goal is development, comparison and selection of the best DNA barcode marker of the desert medicinal plants in the Kingdom of Bahrain using universally accepted marker genes rbcLa, matK and ITS2. Moreover, we want to evaluate the taxonomic authentication of species by the barcode sequence analysis. The comparison of barcode DNA sequences of the local medicinally important plant at the genus or species level is based on basic local alignment search tool (BLAST) and global multiple sequence alignment (MSA) using GenBank accessions. The evaluation of sequences of the three different markers for the identification of the desert medicinal plant is helpful to choose the effective marker for future study. We also studied the barcode gap of the analyzed plants at interspecific to investigate phylogenetic relationship. DNA barcode library of desert medicinal plants in the Kingdom of Bahrain is an introductory and important research arena in Kingdom of Bahrain. Additionally, the DNA barcode sequences of desert medicinal plants in the global sequence library (GenBank) would be useful for plant identification nationally as well as globally.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Study Area</title><p>Collection of local medicinal plants of Kingdom of Bahrain covered eight different regions as shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>.</p></sec><sec id="s2_2"><title>2.2. Plant Collection, Voucher Preparation and Identification</title><p>Plant samples were collected during their vegetative and reproductive growth stage in the two successive year 2016-2017 (January 2016 to April 2016, December 2016-April 2017) by several field trips in the different area, as the most of the annual desert plants, start growing after winter rainfall and perennial plants enter reproductive phase. Following the methodology of Barcode of Life Database (BOLD), whole plants with root system (if small) and part of the plant with branches, leaves, flowers showing maximum morphological characteristics useful for identification were collected for voucher preparation and plant identification. Plants were collected with all detail information of locality, plant habitat, road number, GPS coordinate, elevation level, field photograph, collector name, date, time etc.</p><p>Plant vouchers were prepared with the proper sample ID after collection. Plant parts cleaned, and dried using spacers between layers of blotting papers and finally pasted on the Herbarium sheet with proper labelling. Field/Herbarium photograph taken and uploaded in the BOLD specimen submission portal and the records of each plant with pictures are traceable online in Plant Taxomony portal in BOLD system (http://www.boldsystems.org). Plants identified and botanical names assigned based on reference books of Flora of Bahrain by ourselves. In some cases, we resolved the identification problem by consulting with taxonomists. Plants identified using standard identification method by comparing plant habitat, nodal characteristics of stem, leaf shape, leaf type, leaf arrangement, floral type, floral appearance, flower shape (sepal and petal), fruit characteristics etc.</p></sec><sec id="s2_3"><title>2.3. Tissue Sample Preparation</title><p>Young leaves from the collected plant samples used for sample tissue preparation. Clean leaves properly dried either room temperature (thin and small) or heat dried at 37˚C (in case of succulents and thick leaves of desert plants). The leaves stored in sealable plastic packs and kept at room temperature [<xref ref-type="bibr" rid="scirp.89447-ref25">25</xref>].</p></sec><sec id="s2_4"><title>2.4. Tissue Sub-Sample Preparation</title><p>As DNA was extracted using the plate based method, plant tissue sample of particular ID, around 2 - 3 pieces of plant leaves (0.5 cm) were subsampled in 96-well tube strips placed in plant box following the specific guideline of BOLD systems.</p></sec><sec id="s2_5"><title>2.5. DNA Extraction</title><p>DNA extraction, PCR and sequencing work performed at Canadian Center for DNA Barcoding (CCDB), Canada using their standardized protocols. DNA extracted following the Glass fiber plate DNA extraction protocol, using a small amount of dry leaf samples [<xref ref-type="bibr" rid="scirp.89447-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref27">27</xref>]. The leaf tissues were homogenized into fine powder using Tissue Lyser (Qiagen, USA) with rotated rack adopter at 28 Hz for 30 seconds by two times. DNA was extracted using 2X CTAB (250 &#181;l) buffer and by incubating at 65˚C for 90 min. Cell lysates (50 &#181;l) were transferred into 96-well Eppendrpf plate and Plant Binding Buffer (PBB, 100 &#181;l) was added and incubated for 5 min at RT. 96-well Glass Fiber plate (PALL1) used and semi-automated glass fiber filtration method followed, while the corresponding DNA was bound to GF membrane [<xref ref-type="bibr" rid="scirp.89447-ref25">25</xref>]. GF Membrane rinsed by using Protein Wash Buffer (PWB) and the DNA eluted from GF plate to the collection microplate by adding pre-warmed double distilled water (60 &#181;l), covered with cap strip and stored for PCR.</p></sec><sec id="s2_6"><title>2.6. PCR and Sequencing</title><p>Three gene regions (rbcLa, matK, ITS2) were amplified using CCDB plant protocol [<xref ref-type="bibr" rid="scirp.89447-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref26">26</xref>]. Amplification of the different plant markers required different primers and PCR recipes in PCR plates shown in <xref ref-type="table" rid="table1">Table 1</xref> and <xref ref-type="table" rid="table2">Table 2</xref>. PCR plate placed into the thermo-cycling block and different PCR thermocycle programs were used for different primer set of three different barcode genes. Amplification of rbcLa: 94˚C for 4 min; 35 cycles of 94˚C for 30 sec, 55˚C for 30 sec; 72˚C for 1 min; final extension 72˚C for 10 min; hold at 4˚C. For ITS2: 94˚C for 5 min; 35 cycles of 94˚C for 30 sec, 56˚C for 30 sec, 72˚C for 45 sec; final extension 72˚C for 10 min; hold at 4˚C. Amplification of matK: 98˚C for 45 s; 35 cycles of 98˚C for 10 s, 54˚C for 30 s, 72˚C for 40 s; final extension 72˚C for 10 min; hold at 4˚C. PCR products visualized and analyzed on 2% Agarose E-gel <sup>R</sup> 96 system (Invitogen) using recommended program and software [<xref ref-type="bibr" rid="scirp.89447-ref27">27</xref>]. Strong amplification of rbcL and ITS2 were obtained using low concentration of primers, dNTPs and Taq polymerase with one primer set rbcLa-F [<xref ref-type="bibr" rid="scirp.89447-ref28">28</xref>] , rbcLa-R [<xref ref-type="bibr" rid="scirp.89447-ref29">29</xref>] and another primer set IITS-S2F [<xref ref-type="bibr" rid="scirp.89447-ref30">30</xref>] ITS4 [<xref ref-type="bibr" rid="scirp.89447-ref31">31</xref>]. In case of matK amplification, higher concentration of forward primer matK-xF [<xref ref-type="bibr" rid="scirp.89447-ref32">32</xref>] and reverse primer matK-MALPR1 [<xref ref-type="bibr" rid="scirp.89447-ref33">33</xref>] , dNTPs and Taq polymerase were used (<xref ref-type="table" rid="table2">Table 2</xref>). According to CCDB protocol, diluted PCR replicons used directly for sequencing [<xref ref-type="bibr" rid="scirp.89447-ref26">26</xref>]. PCR products were sequenced on an ABI 3730Xl DNA analyzer (Applied Biosystem, California, USA) following standard procedure. For bidirectional sequencing of rbcLa and ITS2, same PCR primer set used separately for bidirectional sequencing at 96˚C for 2 min; 30 cycles of 96˚C for 30 s, 55˚C for 15 s, 60˚C for 4 min; hold at 4˚C. For bidirectional sequencing of matK, three different primers used separately depending on PCR products used for sequencing at 96˚C for 2 min; 30 cycles of 96˚C for 30 s, 50˚C for 15 s, 60˚C for 4 min; hold at 4˚C.</p></sec><sec id="s2_7"><title>2.7. Sequence Editing, Aligning, Assembly and Data Analysis</title><p>Chromatographs of all the three markers of those plants recovered, trimmed, edited and aligned by using Codon Code Aligner version 3.7.1-6.0.2 (CodonCode</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> List of PCR primers and sequencing primers used in the DNA barcoding and identification of medicinal plants in Kingdom of Bahrain presented</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Barcode genes</th><th align="center" valign="middle" >PCR Primers</th><th align="center" valign="middle" >Primer sequence 5’-3’</th><th align="center" valign="middle" >Annealing Temp for (PCR)</th><th align="center" valign="middle" >Sequencing Primers</th><th align="center" valign="middle" >References</th></tr></thead><tr><td align="center" valign="middle" >rbcL</td><td align="center" valign="middle" >rbcLa-F (forward)</td><td align="center" valign="middle" >ATGTCACCACAAACAGAGACTAAAGC</td><td align="center" valign="middle"  rowspan="2"  >55˚C</td><td align="center" valign="middle" >1) rbcLa-F*</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.89447-ref41">41</xref>]</td></tr><tr><td align="center" valign="middle" >rbcL</td><td align="center" valign="middle" >rbcLa-R (reverse)</td><td align="center" valign="middle" >GTAAAATCAAGTCCACCRCG</td><td align="center" valign="middle" >2) rbcLa-R*</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.89447-ref37">37</xref>]</td></tr><tr><td align="center" valign="middle" >ITS2</td><td align="center" valign="middle" >ITS-S2F (forward)</td><td align="center" valign="middle" >ATGCGATACTTGGTGTGAAT</td><td align="center" valign="middle"  rowspan="2"  >56˚C</td><td align="center" valign="middle" >3) ITS-S2F*</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.89447-ref32">32</xref>]</td></tr><tr><td align="center" valign="middle" >ITS2</td><td align="center" valign="middle" >ITS4 (reverse)</td><td align="center" valign="middle" >TCCTCCGCTTATTGATATGC</td><td align="center" valign="middle" >4) ITS4*</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.89447-ref42">42</xref>]</td></tr><tr><td align="center" valign="middle" >matK</td><td align="center" valign="middle" >matK-xF (forward)</td><td align="center" valign="middle" >TAATTTACGATCAATTCATTC</td><td align="center" valign="middle"  rowspan="2"  >54˚C</td><td align="center" valign="middle" >5) matK-xF 6) matK-MALPR1 (choice I)*</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.89447-ref28">28</xref>]</td></tr><tr><td align="center" valign="middle" >matk</td><td align="center" valign="middle" >matK-MALPR1 (reverse)</td><td align="center" valign="middle" >ACAAGAAAGTCGAAGTAT</td><td align="center" valign="middle" >7) matK-1RKIM-f 6) matK-MALPR1 (choice II)*</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.89447-ref43">43</xref>]</td></tr><tr><td align="center" valign="middle" >matK</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >ACCCAGTCCATCTGGAAATCTTGGTTC</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >7) matK-1RKIM-f*</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.89447-ref39">39</xref>]</td></tr></tbody></table></table-wrap><p>*Bidirectional Sequencing.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Combinations and concentrations of reagents used for PCR reactions of rbcL, matK and ITS2 for analysis of medicinal plants of Kingdom of Bahrain presented</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Reagents</th><th align="center" valign="middle" >rbcL</th><th align="center" valign="middle" >matK Volume per reaction (&#181;l)</th><th align="center" valign="middle" >ITS2</th></tr></thead><tr><td align="center" valign="middle" >10% Trehalose</td><td align="center" valign="middle" >6.25</td><td align="center" valign="middle" >---</td><td align="center" valign="middle" >6.25</td></tr><tr><td align="center" valign="middle" >20% Trehalose</td><td align="center" valign="middle" >----</td><td align="center" valign="middle" >1.875</td><td align="center" valign="middle" >---</td></tr><tr><td align="center" valign="middle" >ddH<sub>2</sub>O</td><td align="center" valign="middle" >2.00</td><td align="center" valign="middle" >2.60</td><td align="center" valign="middle" >2.00</td></tr><tr><td align="center" valign="middle" >10X Buffer</td><td align="center" valign="middle" >1.25</td><td align="center" valign="middle" >0.75</td><td align="center" valign="middle" >1.25</td></tr><tr><td align="center" valign="middle" >50 mM MgCl<sub>2</sub></td><td align="center" valign="middle" >0.625</td><td align="center" valign="middle" >0.225</td><td align="center" valign="middle" >0.625</td></tr><tr><td align="center" valign="middle" >10 &#181;M Primer Forward</td><td align="center" valign="middle" >0.125</td><td align="center" valign="middle" >0.375</td><td align="center" valign="middle" >0.125</td></tr><tr><td align="center" valign="middle" >10 &#181;M Primer Reverse</td><td align="center" valign="middle" >0.125</td><td align="center" valign="middle" >0.375</td><td align="center" valign="middle" >0.125</td></tr><tr><td align="center" valign="middle" >10 mM dNTPs</td><td align="center" valign="middle" >0.0625</td><td align="center" valign="middle" >0.15</td><td align="center" valign="middle" >0.0625</td></tr><tr><td align="center" valign="middle" >*DNA Polymerse (5U/&#181;l)</td><td align="center" valign="middle" >0.06</td><td align="center" valign="middle" >0.15</td><td align="center" valign="middle" >0.06</td></tr><tr><td align="center" valign="middle" >DNA Template (20 - 40 ng/&#181;l)</td><td align="center" valign="middle" >2.00</td><td align="center" valign="middle" >1.0</td><td align="center" valign="middle" >2.00</td></tr><tr><td align="center" valign="middle" >Total Reaction volume</td><td align="center" valign="middle" >12.5</td><td align="center" valign="middle" >7.5</td><td align="center" valign="middle" >12.5</td></tr></tbody></table></table-wrap><p>*Platimum DNA Polymerase (Invitrogen, Carlsbad, California, USA) used for PCR reactions.</p><p>Co., Massachusetts, USA) by CCDB and received DNA sequences for further analysis and study. The nucleotide sequences of different plants aligned using Basic Local Alignment Search Tool (BLAST) algorithm provided by National Centre for Biotechnology Information (NCBI) and European Bioinformatics Institute (EMBL-EBI). The level of similarity between the samples studied by BLAST algorithm using blastclust (http://www.ncbi.nih.gov), which automatically and systematically clusters the nucleotide and protein sequences based on pairwise distance. It is a query method of genus and species of the samples from which sequences separated by the smallest genetic distances in the matrix [<xref ref-type="bibr" rid="scirp.89447-ref18">18</xref>]. The FASTA files of barcode sequences of rbcL, matk and ITS2 prepared for comparison with reference data sites. Different BLAST matching tools used widely to optimize the molecular data mining and for the identification of plants at genus as well as species level. This comparison brought out the genus identification and in some cases species identification. FASTA files of nucleotide sequences explored MUSCLE program [<xref ref-type="bibr" rid="scirp.89447-ref34">34</xref>]. The nucleotide sequences were aligned; analyzed and phylogenetic tree was constructed using various algorithm programs in Molecular Evolutionary Genetics Analysis (MEGA 7) software [<xref ref-type="bibr" rid="scirp.89447-ref35">35</xref>]. Sequence editing and alignment were generated by MUSCLE [<xref ref-type="bibr" rid="scirp.89447-ref34">34</xref>] to construct phylogenetic tree and evolutionary distance measurement by Kimura 2-parameter of studied plants [<xref ref-type="bibr" rid="scirp.89447-ref36">36</xref>]. The nucleotide sequences of coding region of chloroplast gene rbcLa, matK and nuclear ITS2 regions deposited in GenBank (<xref ref-type="table" rid="table4">Table 4</xref>).</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><sec id="s3_1"><title>3.1. PCR and Sequencing Success</title><p>The success of sequencing of barcode markers evaluated based on the number of plant species that successfully generated a sequence for a particular marker. The sequence recovery and analysis of three DNA barcodes of 29 medicinal plants collected from different parts of Kingdom of Bahrain showed (<xref ref-type="fig" rid="fig1">Figure 1</xref>). DNA barcodes genes of rbcLa, matK and ITS2 of 29 different medicinal plants representing 21 different families analyzed. The primers of rbcLa, matK, and ITS2 are used for PCR amplification, sequencing (<xref ref-type="table" rid="table1">Table 1</xref>) and PCR reagents (<xref ref-type="table" rid="table2">Table 2</xref>). For PCR amplification and sequencing of rbcLa and ITS2 same primers worked but in bidirectional sequencing of matK PCR products, 70% PCR products sequenced by choice I combination while 30% sequencing worked choice II (<xref ref-type="table" rid="table1">Table 1</xref>). The detail sequencing results of 29 medicinal plants of 21 different families using rbcLa, matK and ITS2 represented (<xref ref-type="table" rid="table3">Table 3</xref>). The success of sequence obtained of the 29 plants of three different barcodes genes rbcLa, matK and ITS2 were 97%, 79% and 75% respectively (<xref ref-type="table" rid="table3">Table 3</xref>). In bidirectional sequencing for rbcLa, forward primer gave high quality sequencing result in 92% plants while reverse primer gave 78%. In case of Limonium axillare in Plumbaginaceae and Mesembryanthemum nodiflorum of Aizoaceae, we got moderate quality sequencing product from forward primer and no product from reverse primer. High quality sequencing in matK and ITS2 obtained by 68% and 72% plants respectively using forward primer and 65% and 68% using reverse primer respectively. The high sequencing success rate of rbcLa (90%) than matK (70%) and ITS2 (41%) was observed in Amazonian trees while eight different DNA markers were tested [<xref ref-type="bibr" rid="scirp.89447-ref14">14</xref>]. In another DNA barcode study to build a community phylogeny of tropical trees, sequencing success was higher in rbcL region (90%) in comparing matK (68%) [<xref ref-type="bibr" rid="scirp.89447-ref37">37</xref>]. Sequencing success of rbcL (95%), matK (76%) and ITS2 (89%) from fresh specimen of vascular plants from Churchill was reported [<xref ref-type="bibr" rid="scirp.89447-ref38">38</xref>]. Similarly, the low success rate of matK in compare to rbcL reported in the speedy assessment of species abundance in taxonomically poorly known area or in cryptic population [<xref ref-type="bibr" rid="scirp.89447-ref39">39</xref>] , while, the sequence success of 88% and 90% in case of matK region is reported respectively by [<xref ref-type="bibr" rid="scirp.89447-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref23">23</xref>]. The sequencing success of matK around 85% observed in standard and nested multiplex-tandem PCR [<xref ref-type="bibr" rid="scirp.89447-ref32">32</xref>]. In general, the lower success of matK sequence recovery also reflected due to difficulties in primer selection and binding of primers as explained [<xref ref-type="bibr" rid="scirp.89447-ref38">38</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref39">39</xref>]. The low success of in sequence recovery in some genera may be relatively thick leaves of desert plants, slower desiccation and consequent DNA degradation [<xref ref-type="bibr" rid="scirp.89447-ref38">38</xref>]. It has been noted that rbcLa is much easier to sequence than matK and others, so the selection of rbcLa is an important option in barcoding study [<xref ref-type="bibr" rid="scirp.89447-ref40">40</xref>]. In several comparative studies, the variation in the success of sequencing results of different DNA may depend on the nature of plants, their habitat and ecological behavior [<xref ref-type="bibr" rid="scirp.89447-ref41">41</xref>]. The sequences of three different barcode genes submitted in GenBank (<xref ref-type="table" rid="table4">Table 4</xref>).</p></sec><sec id="s3_2"><title>3.2. Identification and Comparison of Barcodes</title><p>The performance of the three-barcode markers for identification of plant genus and species level compared with Global multiple sequence alignment (MSA) and</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> List of bidirectional sequence results of rbcL, matK and ITS2</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >No.</th><th align="center" valign="middle"  rowspan="2"  >Sample ID</th><th align="center" valign="middle"  rowspan="2"  >Plant Name</th><th align="center" valign="middle"  rowspan="2"  >Family</th><th align="center" valign="middle"  colspan="3"  >Barcode Regions</th></tr></thead><tr><td align="center" valign="middle" >rbcL</td><td align="center" valign="middle" >ITS2</td><td align="center" valign="middle" >matK</td></tr><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >BAHMP001110117</td><td align="center" valign="middle" >Launaea nudicaulis</td><td align="center" valign="middle" >Asteraceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ (5,6)</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >BAHMP003110117</td><td align="center" valign="middle" >Alhagi graecorum</td><td align="center" valign="middle" >Fabaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ (5,6)</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >BAHMP004110117R</td><td align="center" valign="middle" >Cressa cretica</td><td align="center" valign="middle" >Convolvulaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >HQ (7,6)</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >BAHMP007280316R</td><td align="center" valign="middle" >Lycium shawii</td><td align="center" valign="middle" >Solanaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >HQ (7,6)</td></tr><tr><td align="center" valign="middle" >5</td><td align="center" valign="middle" >BAHMP008280316H</td><td align="center" valign="middle" >Anastatica hierochuntica</td><td align="center" valign="middle" >Brassicaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >6</td><td align="center" valign="middle" >BAHMP011280316R</td><td align="center" valign="middle" >Francoeuria undulata</td><td align="center" valign="middle" >Asteraceae</td><td align="center" valign="middle" >HQ (1), MQ (2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ (7,6)</td></tr><tr><td align="center" valign="middle" >7</td><td align="center" valign="middle" >BAHMP013280316H</td><td align="center" valign="middle" >Limonium axillare</td><td align="center" valign="middle" >Plumbaginaceae</td><td align="center" valign="middle" >MQ (1)</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >8</td><td align="center" valign="middle" >BAHMP014241216R</td><td align="center" valign="middle" >Cynanchum varians</td><td align="center" valign="middle" >Apocynaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ (7,6)</td></tr><tr><td align="center" valign="middle" >9</td><td align="center" valign="middle" >BAHMP015241216B</td><td align="center" valign="middle" >Malva parviflora</td><td align="center" valign="middle" >Malvaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >10</td><td align="center" valign="middle" >BAHMP018090416</td><td align="center" valign="middle" >Herniaria hemistemon</td><td align="center" valign="middle" >Caryophyllaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ(6)</td></tr><tr><td align="center" valign="middle" >11</td><td align="center" valign="middle" >BAHMP019311216H</td><td align="center" valign="middle" >Teucrium polium</td><td align="center" valign="middle" >Lamiaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >MQ (3)</td><td align="center" valign="middle" >HQ (7,6)</td></tr><tr><td align="center" valign="middle" >12</td><td align="center" valign="middle" >BAHMP020040117R</td><td align="center" valign="middle" >Euphorbia serpens</td><td align="center" valign="middle" >Euphorbiaceae</td><td align="center" valign="middle" >HQ (1), MQ (2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >MQ (7,6)</td></tr><tr><td align="center" valign="middle" >13</td><td align="center" valign="middle" >BAHMP025241216R</td><td align="center" valign="middle" >Andrachne telephioides</td><td align="center" valign="middle" >Phyllanthaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ (7,6)</td></tr><tr><td align="center" valign="middle" >14</td><td align="center" valign="middle" >BAHMP026311216R</td><td align="center" valign="middle" >Savignya parviflora</td><td align="center" valign="middle" >Brassicaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >MQ (6)</td></tr><tr><td align="center" valign="middle" >15</td><td align="center" valign="middle" >BAHMP027311216H</td><td align="center" valign="middle" >Senecio glaucus</td><td align="center" valign="middle" >Asteraceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ (7,6)</td></tr><tr><td align="center" valign="middle" >16</td><td align="center" valign="middle" >BAHMP029311216R</td><td align="center" valign="middle" >Dipcadi erythraeum</td><td align="center" valign="middle" >Asparagaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >HQ (7,6)</td></tr><tr><td align="center" valign="middle" >17</td><td align="center" valign="middle" >BAHMP031040117</td><td align="center" valign="middle" >Tribulus terrestris</td><td align="center" valign="middle" >Zygophyllaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ (5,6)</td></tr><tr><td align="center" valign="middle" >18</td><td align="center" valign="middle" >BAHMP035140117R</td><td align="center" valign="middle" >Spergularia marina</td><td align="center" valign="middle" >Caryophyllaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >19</td><td align="center" valign="middle" >BAHMP036160117</td><td align="center" valign="middle" >Convolvulus arvensis</td><td align="center" valign="middle" >Convolvulaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ (5,6)</td></tr><tr><td align="center" valign="middle" >20</td><td align="center" valign="middle" >BAHMP037110117R</td><td align="center" valign="middle" >Sesuvium portulacastrum</td><td align="center" valign="middle" >Aizoaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >HQ (7), MQ (6)</td></tr><tr><td align="center" valign="middle" >21</td><td align="center" valign="middle" >BAHMP039200117</td><td align="center" valign="middle" >Cynomorium coccineum</td><td align="center" valign="middle" >Cynomoriaceae</td><td align="center" valign="middle" >LQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >22</td><td align="center" valign="middle" >BAHMP043040217R</td><td align="center" valign="middle" >Cistanche tubulosa</td><td align="center" valign="middle" >Orobanchaceae</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >HQ (3), MQ (4)</td><td align="center" valign="middle" >MQ (7,6)</td></tr><tr><td align="center" valign="middle" >23</td><td align="center" valign="middle" >BAHMP044050217H</td><td align="center" valign="middle" >Frankenia pulverulenta</td><td align="center" valign="middle" >Frankeniaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ (7,6)</td></tr><tr><td align="center" valign="middle" >24</td><td align="center" valign="middle" >BAHMP045050217</td><td align="center" valign="middle" >Phyla nodiflora</td><td align="center" valign="middle" >Verbenaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ(5,6)</td></tr><tr><td align="center" valign="middle" >25</td><td align="center" valign="middle" >BAHMP050250317</td><td align="center" valign="middle" >Ziziphus spina-christi</td><td align="center" valign="middle" >Rhamnaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ (7,6)</td></tr><tr><td align="center" valign="middle" >26</td><td align="center" valign="middle" >BAHMP057250317</td><td align="center" valign="middle" >Erodium laciniatum</td><td align="center" valign="middle" >Geraniaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >27</td><td align="center" valign="middle" >BAHMP065120417</td><td align="center" valign="middle" >Prosopis juliflora</td><td align="center" valign="middle" >Fabaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >HQ (7,6)</td></tr><tr><td align="center" valign="middle" >28</td><td align="center" valign="middle" >BAHMP068120417</td><td align="center" valign="middle" >Mesembryanthemum nodiflorum</td><td align="center" valign="middle" >Aizoaceae</td><td align="center" valign="middle" >MQ (1), HQ (2)</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >MQ (7), HQ (6)</td></tr><tr><td align="center" valign="middle" >29</td><td align="center" valign="middle" >BAHMP069120417</td><td align="center" valign="middle" >Leptadenia pyrotechnica</td><td align="center" valign="middle" >Apocynaceae</td><td align="center" valign="middle" >HQ (1,2)</td><td align="center" valign="middle" >HQ (3,4)</td><td align="center" valign="middle" >HQ (7)</td></tr></tbody></table></table-wrap><p>Primers used for sequencing were 1) rbcLa-F, 2) rbcLa-R, 3) ITS-S2F, 4) ITS4, 5) matK-xF, 6) matK-MALPR1, 7) matK-1RKIM-f and level of sequencing results mentioned as HQ: high quality sequencing and MQ: moderate quality sequencing.</p><p>presented (<xref ref-type="table" rid="table5">Table 5</xref>). The obtained sequence of the three barcode genes, rbcLa, matK and ITS2 analyzed following BLAST to confirm the taxonomic identification of the plants at the molecular level, using online database sites of International Nucleotide Sequence Database Collaboration (INSDC). The genetic distance (GD) between sequence pair and percent identity value (PI) after global multiple sequence alignment is helpful for comparative study, species identification and to score relatedness and distance. BLAST search data is helpful for</p><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> List of submitted Genbank Accession Numbers of rbcLa, ITS2 and matK nucleotide sequences presented with plant Sample ID and plant name</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >No.</th><th align="center" valign="middle"  rowspan="2"  >Sample ID</th><th align="center" valign="middle"  rowspan="2"  >Plant Name</th><th align="center" valign="middle"  colspan="3"  >GenBank Accession numbers</th></tr></thead><tr><td align="center" valign="middle" >rbcLa</td><td align="center" valign="middle" >ITS2</td><td align="center" valign="middle" >matK</td></tr><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >BAHMP001110117</td><td align="center" valign="middle" >Launaea nudicaulis</td><td align="center" valign="middle" >MH093899</td><td align="center" valign="middle" >MH191253</td><td align="center" valign="middle" >MH168726</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >BAHMP003110117</td><td align="center" valign="middle" >Alhagi graecorum</td><td align="center" valign="middle" >MH107147</td><td align="center" valign="middle" >MH191258</td><td align="center" valign="middle" >MH168727</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >BAHMP004110117R</td><td align="center" valign="middle" >Cressa cretica</td><td align="center" valign="middle" >MH115436</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >MH168728</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >BAHMP007280316R</td><td align="center" valign="middle" >Lycium shawii</td><td align="center" valign="middle" >MH115437</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >MH168729</td></tr><tr><td align="center" valign="middle" >5</td><td align="center" valign="middle" >BAHMP008280316H</td><td align="center" valign="middle" >Anastatica hierochuntica</td><td align="center" valign="middle" >MH115438</td><td align="center" valign="middle" >MH191259</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >6</td><td align="center" valign="middle" >BAHMP011280316R</td><td align="center" valign="middle" >Francoeuria undulata</td><td align="center" valign="middle" >MH115439</td><td align="center" valign="middle" >MH191260</td><td align="center" valign="middle" >MH168730</td></tr><tr><td align="center" valign="middle" >7</td><td align="center" valign="middle" >BAHMP013280316H</td><td align="center" valign="middle" >Limonium axillare</td><td align="center" valign="middle" >MH115440</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >8</td><td align="center" valign="middle" >BAHMP014241216R</td><td align="center" valign="middle" >Chyancum varians</td><td align="center" valign="middle" >MH168725</td><td align="center" valign="middle" >MH191261</td><td align="center" valign="middle" >MH211036</td></tr><tr><td align="center" valign="middle" >9</td><td align="center" valign="middle" >BAHMP015241216B</td><td align="center" valign="middle" >Malva parviflora</td><td align="center" valign="middle" >MH115441</td><td align="center" valign="middle" >MH203147</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >10</td><td align="center" valign="middle" >BAHMP018090416</td><td align="center" valign="middle" >Herniaria hemistemon</td><td align="center" valign="middle" >MH115442</td><td align="center" valign="middle" >MH203148</td><td align="center" valign="middle" >MH211035</td></tr><tr><td align="center" valign="middle" >11</td><td align="center" valign="middle" >BAHMP019311216H</td><td align="center" valign="middle" >Teucrium polium</td><td align="center" valign="middle" >MH115443</td><td align="center" valign="middle" >MH203149</td><td align="center" valign="middle" >MH211034</td></tr><tr><td align="center" valign="middle" >12</td><td align="center" valign="middle" >BAHMP020040117R</td><td align="center" valign="middle" >Euphorbia serpens</td><td align="center" valign="middle" >MH115444</td><td align="center" valign="middle" >MH203150</td><td align="center" valign="middle" >MH211042</td></tr><tr><td align="center" valign="middle" >13</td><td align="center" valign="middle" >BAHMP025241216R</td><td align="center" valign="middle" >Andrachne telephioides</td><td align="center" valign="middle" >MH115445</td><td align="center" valign="middle" >MH201309</td><td align="center" valign="middle" >MH211043</td></tr><tr><td align="center" valign="middle" >14</td><td align="center" valign="middle" >BAHMP026311216R</td><td align="center" valign="middle" >Savignya parviflora</td><td align="center" valign="middle" >MH115446</td><td align="center" valign="middle" >MH203151</td><td align="center" valign="middle" >MH211041</td></tr><tr><td align="center" valign="middle" >15</td><td align="center" valign="middle" >BAHMP027311216H</td><td align="center" valign="middle" >Senecio glaucus</td><td align="center" valign="middle" >MH115447</td><td align="center" valign="middle" >MH203152</td><td align="center" valign="middle" >MH211040</td></tr><tr><td align="center" valign="middle" >16</td><td align="center" valign="middle" >BAHMP029311216R</td><td align="center" valign="middle" >Dipcadi erythraeum</td><td align="center" valign="middle" >MH133120</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >MH211039</td></tr><tr><td align="center" valign="middle" >17</td><td align="center" valign="middle" >BAHMP031040117</td><td align="center" valign="middle" >Tribulus terrestris</td><td align="center" valign="middle" >MH133121</td><td align="center" valign="middle" >MH203153</td><td align="center" valign="middle" >MH211038</td></tr><tr><td align="center" valign="middle" >18</td><td align="center" valign="middle" >BAHMP035140117R</td><td align="center" valign="middle" >Spergularia marina</td><td align="center" valign="middle" >MH133122</td><td align="center" valign="middle" >MH203154</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >19</td><td align="center" valign="middle" >BAHMP036160117</td><td align="center" valign="middle" >Convolvulus arvensis</td><td align="center" valign="middle" >MH133123</td><td align="center" valign="middle" >MH203155</td><td align="center" valign="middle" >MH211037</td></tr><tr><td align="center" valign="middle" >20</td><td align="center" valign="middle" >BAHMP037110117R</td><td align="center" valign="middle" >Sesuvium portulacastrum</td><td align="center" valign="middle" >MH133124</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >MH211044</td></tr><tr><td align="center" valign="middle" >21</td><td align="center" valign="middle" >BAHMP039200117</td><td align="center" valign="middle" >Cynomorium coccineum</td><td align="center" valign="middle" >MH168717</td><td align="center" valign="middle" >MH203156</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >22</td><td align="center" valign="middle" >BAHMP043040217R</td><td align="center" valign="middle" >Cistanche tubulosa</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >MH203157</td><td align="center" valign="middle" >MH211045</td></tr><tr><td align="center" valign="middle" >23</td><td align="center" valign="middle" >BAHMP044050217H</td><td align="center" valign="middle" >Frankenia pulverulenta</td><td align="center" valign="middle" >MH168718</td><td align="center" valign="middle" >MH203158</td><td align="center" valign="middle" >MH211046</td></tr><tr><td align="center" valign="middle" >24</td><td align="center" valign="middle" >BAHMP045050217</td><td align="center" valign="middle" >Phyla nodiflora</td><td align="center" valign="middle" >MH168719</td><td align="center" valign="middle" >MH203159</td><td align="center" valign="middle" >MH211047</td></tr><tr><td align="center" valign="middle" >25</td><td align="center" valign="middle" >BAHMP050250317</td><td align="center" valign="middle" >Ziziphus spina-christi</td><td align="center" valign="middle" >MH168720</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >MH211048</td></tr><tr><td align="center" valign="middle" >26</td><td align="center" valign="middle" >BAHMP050250317R</td><td align="center" valign="middle" >Ziziphus spina-christi</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >MH203160</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >27</td><td align="center" valign="middle" >BAHMP057250317</td><td align="center" valign="middle" >Erodium laciniatum</td><td align="center" valign="middle" >MH168721</td><td align="center" valign="middle" >MH203161</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >28</td><td align="center" valign="middle" >BAHMP065120417</td><td align="center" valign="middle" >Prosopis juliflora</td><td align="center" valign="middle" >MH168722</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >MH211049</td></tr><tr><td align="center" valign="middle" >29</td><td align="center" valign="middle" >BAHMP068120417</td><td align="center" valign="middle" >Mesembryanthemum nodiflorum</td><td align="center" valign="middle" >MH168723</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >MH211050</td></tr><tr><td align="center" valign="middle" >30</td><td align="center" valign="middle" >BAHMP069120417</td><td align="center" valign="middle" >Leptadenia pyrotechnica</td><td align="center" valign="middle" >MH168724</td><td align="center" valign="middle" >MH203162</td><td align="center" valign="middle" >MH211051</td></tr></tbody></table></table-wrap><p>genus and species identification of plants at the molecular level, which is one of the main objectives of this study. This is helping in the process of plant taxonomical query in the regional and global accomplishment. Using NCBI database in BLAST analysis, 100%, 92.85% and 86.95% plant genus of the analyzed medicinal plants confirmed by obtained barcode sequences of ITS2, rbcLa and matK sequences respectively (<xref ref-type="table" rid="table5">Table 5</xref>). The use of rbcLa and ITS2 barcodes worked fine in compare to matK. Overall, 97% plants species were correctly</p><table-wrap id="table5" ><label><xref ref-type="table" rid="table5">Table 5</xref></label><caption><title> The comparison of nucleotide sequences of three barcode genes of rbcLa, matK and ITS2 of medicinal plants in the Kingdom of Bahrain</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Identification level using MSA</th><th align="center" valign="middle"  colspan="3"  >Barcode genes</th><th align="center" valign="middle"  rowspan="2"  >Plant Identification (%)</th></tr></thead><tr><td align="center" valign="middle" >rbcLa</td><td align="center" valign="middle" >matK</td><td align="center" valign="middle" >ITS2</td></tr><tr><td align="center" valign="middle" >Plant genus</td><td align="center" valign="middle" >rbcLa</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >92.85</td></tr><tr><td align="center" valign="middle" >Plant genus</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >matK</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >86.95</td></tr><tr><td align="center" valign="middle" >Plant genus</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >ITS2</td><td align="center" valign="middle" >100</td></tr><tr><td align="center" valign="middle" >Plant species</td><td align="center" valign="middle" >rbcLa</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >89.28</td></tr><tr><td align="center" valign="middle" >Plant species</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >matK</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >60.86</td></tr><tr><td align="center" valign="middle" >Plant species</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >ITS2</td><td align="center" valign="middle" >86.32</td></tr><tr><td align="center" valign="middle" >Plant species</td><td align="center" valign="middle" >rbcLa+</td><td align="center" valign="middle" >matK+</td><td align="center" valign="middle" >ITS2</td><td align="center" valign="middle" >28.57</td></tr><tr><td align="center" valign="middle" >Plant species</td><td align="center" valign="middle" >rbcLa+</td><td align="center" valign="middle" >matK+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >21.42</td></tr><tr><td align="center" valign="middle" >Plant species</td><td align="center" valign="middle" >rbcLa+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >ITS2</td><td align="center" valign="middle" >28.57</td></tr><tr><td align="center" valign="middle" >Plant species</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >matK+</td><td align="center" valign="middle" >ITS2</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Plant species</td><td align="center" valign="middle" >rbcLa only</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >10.71</td></tr><tr><td align="center" valign="middle" >Plant species</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >ITS2 only</td><td align="center" valign="middle" >10.71</td></tr></tbody></table></table-wrap><p>The percentage of plant identification at species and genus level calculated on the number of identified plants (genus/species level) based on total plants considered for the BLAST study.</p><p>identified either anyone of the barcodes (rbcLa, matK or ITS2) using BLAST survey. 28.57% plant species were confirmed by the analysis of all the three barcode sequences (rbcLa, matK and ITS2). 21.42% plant species were confirmed by the analysis of sequences of rbcLa and matK while 28.57% plant species were confirmed by the analysis of sequences of rbcLa and ITS2 combinations. 10.71% plant species were identified only by rbcLa (Limonium axillare, Herniaria hemistemon, Dipcadi erythraeum) and only by ITS2 sequences separately (Cynanchum variance, Cyanomorium coccineum, Cistanche coccineum). Only one barcode gene specifically confirmed the species identification using GenBank BLAST tool of those plants. BLAST analysis confirmed 100% medicinal plant genus and 89.28%, 86.32% and 60.86% plant species of medicinal plants by rbcLa, ITS2 and matK barcodes respectively. Similarly using BLAST analysis of sequence in the genetic distance analysis (GD), 99% success rate of genus identification and 73% and 75% species identification for rbcL and matK respectively observed in the identification of African rainforest trees was reported [<xref ref-type="bibr" rid="scirp.89447-ref18">18</xref>]. Similarly, the selection of rbcL and matK as core plant barcode marker reported by several workers and they have universal discriminatory power [<xref ref-type="bibr" rid="scirp.89447-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref42">42</xref>]. For identification of medicinal plant, the importance ITS2 together with rbcL, matK reported and justified that ITS2 is a valuable DNA barcode gene for the identification of closely related species [<xref ref-type="bibr" rid="scirp.89447-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref30">30</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref43">43</xref>]. Moreover, DNA polymorphism is typically low in coding plastid genes such as rbcL and matK but is frequent in noncoding ITS2 region and is helpful for species identification [<xref ref-type="bibr" rid="scirp.89447-ref18">18</xref>].</p></sec><sec id="s3_3"><title>3.3. Phylogeny Study</title><p>The comparative analysis of molecular sequence data is essentially important for reconstructing evolutionary history of plants. The discriminatory influence of three barcode genes was considered in pairwise distance matrix to construct phylogenetic tree using in MEGA7 software [<xref ref-type="bibr" rid="scirp.89447-ref34">34</xref>]. The evolutionary history was inferred using pairwise distances in Maximum Composite Likelihood (MCL) [<xref ref-type="bibr" rid="scirp.89447-ref35">35</xref>]. The phylogenetic relatedness and evolutionary history drown by means of neighbor-Join (NJ) method [<xref ref-type="bibr" rid="scirp.89447-ref44">44</xref>] using nucleotide sequence alignment of rbcLa and ITS2 (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="fig" rid="fig3">Figure 3</xref>). The evolutionary distance analysis conducted using Kimura 2-parameter [<xref ref-type="bibr" rid="scirp.89447-ref36">36</xref>] method of base substitution per site and mentioned</p><p>by units. The pairwise distance matrix value indicates their closeness during evolution and ultimately helps to draw their phylogenetic tree and the history of evolution. The clades formed in the trees were mostly mixture of several plant species and the big and small branches showed their relatedness and distances clearly among the plant species. Cynanchum varians and Leptadenia pyrotechnica showed their closeness and common ancestry as they belong to the same family confirmed by taxonomic observation too. Similarly Herniaria hemistemon and Spargularia marina are closely related in their evolutionary history and belong to the same family Caryophyllaceae. In a double-locus (rbcLa and ITS2) phylogenetic trees, tree nodes and close branches supported the taxonomic clarity, relatedness and clade phylogeny. For each species, the higher interspecific distance obtained by ITS2 (33.17%) in compare to rbcLa (8.72%), so the value of closeness differed in phylogenetic tree of ITS2 (<xref ref-type="fig" rid="fig2">Figure 2</xref>) and rbcLa (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Phylogenetic tree analysis of ITS2 and rbcL provided species resolution in a better way by using pairwise distance matrix value and indicated their closeness and distance with each other. Similarly, in the building of community parsimony, rbcL and ITS2 sequence alignment in constructing phylogenetic tress nodes showed support value in plant phylogeny [<xref ref-type="bibr" rid="scirp.89447-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref29">29</xref>]. We noticed that the matK region of chloroplast genome is little problematic in sequence retrieving, phylogenetic data analysis and identification of plants in comparing to rbcLa and ITS2 barcodes, similar to other studies [<xref ref-type="bibr" rid="scirp.89447-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref32">32</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref42">42</xref>]. In the present study, rbcLa and ITS2 demonstrated excellent reliability for species authentication and less genetic diversity, due to the limited dispersal capacity in the plant communities of the arid and semiarid regions in comparison to tropics where it is frequent factor. So, the DNA barcode analysis of those plants is of a little bit challenging for species differentiation [<xref ref-type="bibr" rid="scirp.89447-ref18">18</xref>]. We noticed that the matK region of chloroplast genome is little problematic in sequence retrieving, phylogenetic data analysis and identification of plants in comparing to rbcLa and ITS2 barcodes, similar to other studies [<xref ref-type="bibr" rid="scirp.89447-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref32">32</xref>] [<xref ref-type="bibr" rid="scirp.89447-ref42">42</xref>].</p><p>In conclusion, primarily, rbcLa and ITS2 are very useful barcode region and can be of wider application in the study of desert plant identification, ecology, and plant diversity study. Moreover, our sequences submitted to the GenBank will be of very helpful data for future study in various aspects. As, DNA barcoding has potentials to transfigure the systems of taxonomists work by giving considerable momentum during this era as a helpful tool for plant identification at molecular level.</p></sec></sec><sec id="s4"><title>Acknowledgements</title><p>The research was supported by the Research Grant # “TS-LS-BIOT.011_2015-2017” from College of Graduate studies, Agricultural Biotechnology Program, Department of Life Sciences, Arabian Gulf University. We like to Acknowledge CCDB for DNA analysis and sequencing work.</p></sec><sec id="s5"><title>Conflicts of Interest</title><p>The authors declare no conflict of interest.</p></sec><sec id="s6"><title>Cite this paper</title><p>Pathak, M.R., Mohamedm A.A.M. and Farooq, M. (2018) DNA Barcoding and Identification of Medicinal Plants in the Kingdom of Bahrain. American Journal of Plant Sciences, 9, 2757-2774. https://doi.org/10.4236/ajps.2018.913200</p></sec></body><back><ref-list><title>References</title><ref id="scirp.89447-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Willcox, M.L. and Bodeker, G. (2004) Traditional Herbal Medicines for Malaria. British Medical Journal, 329, 1156-1159. https://doi.org/10.1136/bmj.329.7475.1156</mixed-citation></ref><ref id="scirp.89447-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Gurib-Fakim, A. (2006) Medicinal Plants: Traditions of Yesterday and Drugs of Tomorrow. Molecular Aspects of Medicine, 27, 1-93. https://doi.org/10.1016/j.mam.2005.07.008</mixed-citation></ref><ref id="scirp.89447-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Atanasov, A.G., Waltenberger, B., Pferschy-Wenzig, E., Linder T., Wawrosch, C., Uhrin, P., Temml, V., Wang, L., Schwaiger, S., Heiss, E.H., Rollinger, J.M., Schuster, D., Breuss, J.M., Bochkov, V., Mihovilovic, M.D., Kopp B., Bauer, R., Dirsch, V.M. and Stuppner, H. (2015) Discovery and Resupply of Pharmacologically Active Plant-Derived Natural Products: A Review. Biotechnology Advances, 33, 1582-1614. https://doi.org/10.1016/j.biotechadv.2015.08.001</mixed-citation></ref><ref id="scirp.89447-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization (2011) The World Traditional Medicines Situation, in Traditional Medicines: Global Situation, Issues and Challenges. 3rd Edition. http://digicollection.org/hss/en/m/abstract/Js18063en/</mixed-citation></ref><ref id="scirp.89447-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Brower, V. (2008) Back to Nature: Extinction of Medicinal Plants Threatens Drug Discovery. Journal of the National Cancer Institute, 100, 838-839. https://doi.org/10.1093/jnci/djn199</mixed-citation></ref><ref id="scirp.89447-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Newman, D.J. and Cragg, G.M. (2012) Natural Products as Sources of New Drugs over the 30 Years from 1981 to 2010. Journal of Natural Products, 75, 311-335. https://doi.org/10.1021/np200906s</mixed-citation></ref><ref id="scirp.89447-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">De Luca, V., Salim, V., Atsumi, S.M. and Yu, F. (2012) Mining the Biodiversity of Plants: A Revolution in the Making. Science, 336, 1658-1661. https://doi.org/10.1126/science.1217410</mixed-citation></ref><ref id="scirp.89447-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Public Commission for the Protection of Marine Resources, Environment and Wildlife (2006) Bahrain First National Report to the Convention on Biological Diversity. 1-17. http://www.biodiv.be/bahrain/implementation/national-reports-cbd/bahrain-first-national-report</mixed-citation></ref><ref id="scirp.89447-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Jameel, A., Mandeel, Q. and Al-Laith, A. (2010a) Folk Medicine and the Use of Herbal Plants in the Kingdom of Bahrain. Arab Gulf Journal of Scientific Research, 28, 91-104.</mixed-citation></ref><ref id="scirp.89447-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Abbas, J.A., El-Oqlah, A.A. and Mahasneh, A.M. (1992) Herbal Plants in the Traditional Medicine of Bahrain. Economic Botany, 46, 158-163. https://doi.org/10.1007/BF02930630</mixed-citation></ref><ref id="scirp.89447-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Jameel, A., Al-Laith, A. and Qaher, M. (2010b) Knowledge, Attitudes and Practices regarding Medicinal Plants Used by the Indigenous People of Bahrain. Arab Gulf Journal of Scientific Research, 28, 105-117</mixed-citation></ref><ref id="scirp.89447-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Manal, A.S., Malabika, R.P., Ahmed, A.S., Mohammed, A. and Asma A. (2014) Somatic Embryogenesis and Organogenesis for Regeneration of Endangered Multipurpose Desert Plant Leptadenia pyrotechnica Forsk. Decne in the Kingdom of Bahrain. American Journal of Plant Sciences, 5, 2342-2353. https://doi.org/10.4236/ajps.2014.515248</mixed-citation></ref><ref id="scirp.89447-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Malabika, R.P. and Mohammad, S.A. (2014) The Role of Biotechnology in the Conservation of Biodiversity. Journal of Experimental Biology and Agriculture Sciences, 2, 352-363.</mixed-citation></ref><ref id="scirp.89447-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Gonzalez, M.A., Baraloto, C., Engel, J., Mori, S.A., Pétronelli, P., Riéra, B., Roger, A., Thébaud, C. and Chave, J. (2009) Identification of Amazonian Trees with DNA barcodes. PLoS ONE, 4, e7483. https://doi.org/10.1371/journal.pone.0007483</mixed-citation></ref><ref id="scirp.89447-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Hebert, P.D.N., Cywinska, A., Ball, S.L. and deWaard, J.R. (2003) Biological Identifications through DNA Barcodes. Proceedings of the Royal Society B: Biological Sciences, 270, 313-321. https://doi.org/10.1098/rspb.2002.2218</mixed-citation></ref><ref id="scirp.89447-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Techen, N., Parveen, I., Pan, Z. and Khan, I.A. (2014) DNA Barcoding of Medicinal Plant Material for Identification. Current Opinion in Biotechnology, 25, 103-110. https://doi.org/10.1016/j.copbio.2013.09.010</mixed-citation></ref><ref id="scirp.89447-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Hollingsworth, P.M., Graham, S.W. and Little, D.P. (2011) Choosing and Using a Plant DNA Barcode. PLoS ONE, 6, e19254. https://doi.org/10.1371/journal.pone.0019254</mixed-citation></ref><ref id="scirp.89447-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Parmentier, I., Duminil, J., Kuzmina, M., Philippe, M., Thomas, D.W., Kenfack, D., Chuyong, G.B., Cruaud, C. and Hardy, O.J. (2013) How Effective Are DNA Barcodes in the Identification of African Rainforest Trees? PLoS ONE, 8, e54921. https://doi.org/10.1371/journal.pone.0054921</mixed-citation></ref><ref id="scirp.89447-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Kress, W.J., García-Robledo, C., Uriarte, M. and Erickson, D.L. (2015) DNA Barcodes for Ecology, Evolution, and Conservation. Trends in Ecology &amp; Evolution, 30, 25-35. https://doi.org/10.1016/j.tree.2014.10.008</mixed-citation></ref><ref id="scirp.89447-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Fazekas, A.J., Burgess, K.S., Kesanakurti, P.R., Graham, S.W., Newmaster, S.G., Husband, B.C., Percy, D.M., Hajibabaei, M. and Barrett, S.C.H. (2008) Multiple Multilocus DNA Barcodes from the Plastid Genome Discriminate Plant Species Equally Well. PLoS ONE, 3, e2802. https://doi.org/10.1371/journal.pone.0002802</mixed-citation></ref><ref id="scirp.89447-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Bidak, L.M., Kamal, S.A., Halmy, M.W.A. and Heneidy, S.Z. (2015) Goods and Services Provided by Native Plants in Desert Ecosystems: Examples from the Northwestern Coastal Desert of Egypt. Global Ecology and Conservation, 3, 433-447. https://doi.org/10.1016/j.gecco.2015.02.001</mixed-citation></ref><ref id="scirp.89447-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Liu, J., M&amp;ouml;ller, M., Gao, L., Zhang, D. and Li, D. (2011) DNA Barcoding for the Discrimination of Eurasian Yews (Taxus L., Taxaceae) and the Discovery of Cryptic Species. Molecular Ecology Resources, 11, 89-100. https://doi.org/10.1111/j.1755-0998.2010.02907.x</mixed-citation></ref><ref id="scirp.89447-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Hollingsworth, M.L., Andra, Clark, A., Forrest, L.L., Richardson, J., Pennington, R.T., Long, D.G., Cowan, R., Chase, M.W., Gaudeul, M. and Hollingsworth, P.M. (2009) Selecting Barcoding Loci for Plants: Evaluation of Seven Candidate Loci with Species-Level Sampling in Three Divergent Groups of Land Plants. Molecular Ecology Resources, 9, 439-457. https://doi.org/10.1111/j.1755-0998.2008.02439.x</mixed-citation></ref><ref id="scirp.89447-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">CBOL Plant Working Group (2009) A DNA Barcode for Land Plants. Proceedings of the National Academy of Sciences USA, 106, 12794-12797. https://doi.org/10.1073/pnas.0905845106</mixed-citation></ref><ref id="scirp.89447-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Fazekas, A.J., Kuzmina, M.L., Newmaster, S.G. and Hollingsworth, P.M. (2012) DNA Barcoding Methods for Land Plants. Methods in Molecular Biology, 858, 223-252. https://doi.org/10.1007/978-1-61779-591-6_11</mixed-citation></ref><ref id="scirp.89447-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Kuzmina, M.L. and Ivanova, N.V. (2016) PCR Amplification for Plants and Fungi. CCDB Protocols. http://ccdb.ca/site/wpcontent/uploads/2016/09/CCDB_Amplification-Plants.pdf</mixed-citation></ref><ref id="scirp.89447-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Ivanova, N.V. and Kuzmina, M.L. (2013) Protocols for Dry DNA Storage and Shipment at Room Temperature. Molecular Ecology Resources, 13, 890-898. https://doi.org/10.1111/1755-0998.12134</mixed-citation></ref><ref id="scirp.89447-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Levin, R.A., Wagner, W.L., Hoch, P.C., Nepokroeff, M., Pires, J.C., Zimmer, E.A. and Sytsma, K.J. (2003) Family-Level Relationships of Onagraceae Based on Chloroplast rbcL and ndhF Data. American Journal of Botany, 90, 107-115. https://doi.org/10.3732/ajb.90.1.107</mixed-citation></ref><ref id="scirp.89447-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Kress, W.J., Erickson, D.L., Jones, F.A., Swenson, N.G., Perez, R., Sanjur, O. and Bermingham, E. (2009) Plant DNA Barcodes and a Community Phylogeny of a Tropical Forest Dynamics Plot in Panama. Proceedings of the National Academy of Sciences USA, 106, 18621-18626. https://doi.org/10.1073/pnas.0909820106</mixed-citation></ref><ref id="scirp.89447-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Chen, S., Yao, H., Han, J., Liu, C., Song, J., Shi, L., Zhu, Y., Ma, X., Gao, T., Pang X., Luo, K., Li, Y., Li, X., Jia, X., Lin, Y. and Leon, C. (2010) Validation of the ITS2 Region as a Novel DNA Barcode for Identifying Medicinal Plant Species. PLoS ONE, 5, e8613. https://doi.org/10.1371/journal.pone.0008613</mixed-citation></ref><ref id="scirp.89447-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Dunning, L.T. and Savolainen, V. (2010) Broad-Scale Amplification of matK for DNA Barcoding Plants, a Technical Note. Botanical Journal of the Linnean Society, 164, 1-9. https://doi.org/10.1111/j.1095-8339.2010.01071.x</mixed-citation></ref><ref id="scirp.89447-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Ford, C.S., Ayres, K.L., Toomey, N., Haider, N., Van, Alphen, Stahl, J., Kelly, L.J., Wikstr&amp;ouml;m, N., Hollingsworth, P.M., Duff, R.J., Hoot, S.B., Cowan, R.S., Chase, M.W. and Wilkinson, M.J. (2009) Selection of Candidate Coding DNA Barcoding Regions for Use on Land Plants. Botanical Journal of the Linnean Society, 159, 1-11. https://doi.org/10.1111/j.1095-8339.2008.00938.x</mixed-citation></ref><ref id="scirp.89447-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">White, T.J., Bruns, T.D., Lee, S.B. and Taylor, J.W. (1990) Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. PCR Protocols: A Guide to Methods and Applications, 315-322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1</mixed-citation></ref><ref id="scirp.89447-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Edgar, R.C. (2004) MUSCLE: Multiple Sequence Alignment with High Accuracy and High Throughput. Nucleic Acids Research, 32, 1792-1797. https://doi.org/10.1093/nar/gkh340</mixed-citation></ref><ref id="scirp.89447-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Kumar, S., Stecher, G. and Tamura, K. (2016) MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution, 33, 1870-1874. https://doi.org/10.1093/molbev/msw054</mixed-citation></ref><ref id="scirp.89447-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Kimura, M. (1980) A Simple Method for Estimating Evolutionary Rates of Base Substitutions through Comparative Studies of Nucleotide Sequences. Journal of Molecular Evolution, 16, 111-120. https://doi.org/10.1007/BF01731581</mixed-citation></ref><ref id="scirp.89447-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Kress, W.J., Erickson, D.L., Swenson, N.G., Thompson, J., Uriarte, M. and Zimmerman, J.K. (2010) Advances in the Use of DNA Barcodes to Build a Community Phylogeny for Tropical Trees in a Puerto Rican Forest Dynamics Plot. PLoS ONE, 5, e15409. https://doi.org/10.1371/journal.pone.0015409</mixed-citation></ref><ref id="scirp.89447-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Kuzmina, M.L., Johnson, K.L., Barron, H.R. and Hebert, P.D. (2012) Identification of the Vascular Plants of Churchill, Manitoba, Using a DNA Barcode Library. BMC Ecology, 12, 25. https://doi.org/10.1186/1472-6785-12-25</mixed-citation></ref><ref id="scirp.89447-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Costion, C., Ford, A., Cross, H., Crayn, D. Harrington, M. and Lowe, A. (2011) Plant DNA Barcodes can Accurately Estimate Species Richness in Poorly Known Floras. PLoS ONE, 6, e26841. https://doi.org/10.1371/journal.pone.0026841</mixed-citation></ref><ref id="scirp.89447-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Taberlet, P., Coissac, E., Pompanon, F., Gielly, L., Miquel, C., Valentini, A., Vermat, T., Corthier, G., Brochmann, C. and Willerslev, E. (2007) Power and Limitations of the Chloroplast trnL (UAA) Intron for Plant DNA Barcoding. Nucleic Acids Research, 35, e14. https://doi.org/10.1093/nar/gkl938</mixed-citation></ref><ref id="scirp.89447-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Jurado-Rivera, J.A., Vogler, A.P., Reid, C.A.M., Petitpierre, E. and Gómez-Zurita, J. (2009) DNA Barcoding Insect-Host Plant Associations. Proceedings Biological Sciences, 276, 639-648. https://doi.org/10.1098/rspb.2008.1264</mixed-citation></ref><ref id="scirp.89447-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Kuzmina, M.L., Braukmann, T.W.A., Fazekas, A.J., Graham, S.W., Dewaard, S.L., Rodrigues, A., Bennett, B.A., Dickinson, T.A., Saarela, J.M., Catling, P.M., Newmaster, S.G., Percy, D.M., Fenneman, E., Lauron-Moreau, A., Ford, B., Gillespie, L., Subramanyam, R., Whitton, J., Jennings, L., Metsger, D., Warne, C.P., Brown, A., Sears, E., Dewaard, J.R., Zakharov, E.V. and Hebert, P.D.N. (2017) Using Herbarium-Derived DNAs to Assemble a Large-Scale DNA Barcode Library for the Vascular Plants of Canada. Applications in Plant Sciences, 5, 12. https://doi.org/10.3732/apps.1700079</mixed-citation></ref><ref id="scirp.89447-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Yao, H., Song, J., Liu, C., Luo, K., Han, J., Li, Y., Pang, X., Xu, H., Zhu, Y., Xiao, P. and Chen, S. (2010) Use of ITS2 Region as the Universal DNA Barcode for Plants and Animals. PLoS ONE, 5, e13102. https://doi.org/10.1371/journal.pone.0013102</mixed-citation></ref><ref id="scirp.89447-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Saitou, N. and Nei, M. (1987) The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Molecular Biology and Evolution, 4, 406-425.</mixed-citation></ref></ref-list></back></article>