Plants have evolved and perfected a series of light receptors to feel the light at different bands and regulate the expression, modification and interaction of related genes in plants through signal transduction. So far, many photoreceptors have been identified in plants,
UVR
8 has recently been identified as a receptor for
UV-B
light. This paper cloned a
WD
40 gene related to
UVR
8 protein subunit, named
RrRUP
2, based on the
Rosa rugose
transcriptome data, using
Rosa rugose
“Zi zhi” as experimental materials. The full length of cDNA
of the gene was obtained by RT-PCR and RACE methods. The total length of this gene is 1173 bp, and it encodes 390 amino acids. After bioinformatics analysis, the molecular formula C
3415
H
5659
N
1173
O
1434
S
313
was predicted; the relative molecular weight was 96129.27 Da; the theoretical isoelectric point PI value was 5.00; and its instability index was 47.06. The total average hydrophobic index was 0.750. In the secondary structure of
RrRUP
2 protein, there are 10
α
-helix, 45
β
-helix, 181 Random coil, and 154 Extended strand. Gene Bank Blast results showed that the amino acid sequence encoded by
RrRUP
2 was more than 90% homologous with the
RUP
2 protein of
Rosa chinensis, Fragaria, Malus, Pyrus, P
runus,
Juglans
,
Arabidopsis
and
Tobacco
, so it can be inferred that the
RrRUP
2 gene is a WD repeat-containing protein. Regarding to fluorescence quantitative expression analysis of
RrRUP
2, we find its experssion pattern is corresponded with the accumulation of anthocyanins.
Rosa rugosa is an ornamental shrub of the Rosaceae family, because of its beautiful pattern, unique fragrance and color; people call it “love flowers” and “gold flowers” [1] . There are many varieties of roses, but most roses are darker in color; how to improve rose color is particularly important. The color changes of plant petals are mainly related to the synthesis and regulation of anthocyanin, the biosynthesis and regulation of anthocyanin is accomplished by the complex network of the genetic background and environmental factors [2] [3] . The coding genes include 15 structural genes and 3 regulatory gene families [4] , among which 3 regulatory gene families are MYB, BHLH and WD40. Among them, WD40 protein provides the necessary platform for MBW transcription complex [5] . Coding genes determine the type and time of anthocyanin synthesis, while environmental factors such as light affect the time of anthocyanin biosynthesis [6] . Roses are masculine plant, which like growing with abundant of sunlight environment.
Light is very important for the growth and development of plants, not only providing energy for the whole life activities of plants, but also playing the role of environmental signal factors influencing the whole life cycle of plants from seed germination to flowering and fruiting. Therefore, plants have evolved and perfected a series of light receptors to feel the light at different bands and regulate the expression, modification and interaction of related genes in plants through signal transduction. So far, many photoreceptors have been identified in plants, such as photosensitive pigments that sense far-red and red light, cryptochrome that senses blue and UV-A, phototrophic proteins and ZTL, and UVR8 that has recently been identified as a receptor for UV-B light [7] [8] [9] [10] [11] .
UV-B is the b band of ultraviolet, which has a short wavelength and high energy [12] . UV-B radiation affects the synthesis of plant secondary metabolites and increases the content of phenolic compounds, terpenoid and anthocyanins in plant leaves. When plants irradiate UV-B, UVR8 can be a monomer to transmit light signals; When UV-B is removed, UVR8 can return to the ground state through dimerisation. Therefore, UVR8, as the light receptor that senses UV-B signal, is of great significance for plants to inactivate and return to the ground state. In order to prevent the over-amplification and output of UV-B signal, there is a very accurate negative feedback regulation mechanism in plants, among which RUP2 is a particularly important negative regulator [13] .
Some studies have shown that the signal transduction pathway of UVR8 in UV-B, at present, UVR8 has been cloned and analyzed in many plants such as Arabidopsis [14] , Malus domestica [15] , Prunus avium [16] and so on. However, studies on the negative regulatory factor RUP2 in this pathway are absent. In this study, based on the R. rugosa transcriptome data, we cloned and identified RrRUP2 gene from the petals of Rosa rugosa “Zi zhi” for the first time. We carried out detailed bioinformatics analysis, homology analysis and the temporal and spatial expression pattern analysis of the RrRUP2 gene in order to provide some useful informations for analyze the mechanism of the regulatory factors in UV-B signaling pathway.
2. Material and Methods
The experiment was conducted from April 2017 to January 2018 in the flower germplasm resources nursery of shandong agricultural university and the flower research institute of forestry university.
2.1. Plant Material
The plant materials, Chinese representative Rosa rugosa “Zi zhi”, Rosa rugosa “Fen zi zhi”, Rosa rugosa “Bai Zi zhi”. R. rugosa “Zi zhi” is purple, R. rugosa “Fen zi zhi” is pink, R. rugosa “Bai zi zhi” is white. Plants were selected from April to May 2017 with robust, stable and pure designs, and the half-open petals of the above three varieties were collected as the experimental materials for gene cloning. The flower petals of the above three varieties were collected in the bud stage, the initial stage, the half stage, the blooming stage and the end of the blooming period as the differential expression test among the varieties; Five flowering stages and root, stem, leaf, pistil, stamen, sepals were collected for tissue differential expression test. All samples were collected directly frozen with liquid nitrogen, and finally stored at −80˚C until used.
2.2. Methods2.2.1. Total RNA Extraction and cDNA Synthesis
According to the instructions of EASY spin plant RNA rapid extraction kit (Aidlab Biotech, Beijing, China), RNA of all tissue parts and total RNA of Rosa rugosa “Zi zhi” petals were extracted. Their concentration and purity were determined by uv spectrophotometer. Meanwhile, their integrity was detected by 1% agarose gel electrophoresis (Thermo Fisher Scientific, Wilmington, Delaware, USA). The first strand of reverse transcription synthesis cDNA was synthesized by RNA reverse transcription according to the instructions of abm reverse transcription kit (ABM Company, Vancouver, Canada).
2.2.2. PCR Cloning of Anthocyanin Biosynthesis Related Gene
According to the notes of the R. rugosa-transcriptome database, 48 Wd40 genes were isolated and specific primers were designed using Oligo7.0 software (Table 1). The reaction system included 1 µL cDNA, 1 µL F1 primer (10 µmol/L), 1 µL R1 primer (10 µmol/L), and 12.5 µL PCR MIX, with ddH2O added to a total volume of 25 µL. The reaction conditions were: 94˚C for 5 min; 94˚C for 30 s, 53˚C for 30 s, and 72˚C for 1 min for a total of 35 cycles; and then extension at 72˚C for 10 min. Next, 1% agarose gel electrophoresis was used to detect the PCR products. The target PCR fragment was recovered with the Hipure Gel Pure DNA Mini Kit (Magen). The recovered fragment was ligated to the pMD18-T vector and then transformed into Ecoli DH5a. The positive clones were selected and sent to BGI for sequencing.
Primers used in the present study
Primer name
(5’ 3’) Nucleotide sequence
Purpose
β-F
ATGAACCCACCTTTCCATTTCC
Intermediate segment amplification
β-R
GTACGTCACTGTCTTATCG
B26
GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT
3’RACE PCR for RrRUP2
β-3’-F
CGGTGAGGAACAGTGTAC
RrRUP2-F
ATGAACCCACCTTTCCATTTCC
Full-length cDNA for RrRUP2
RrRUP2
CTAATCCGAAGCTAATGACT
Actin-F
CACTTAGCACCTTCCAGCAGATGT
qRT-PCR for RrRUP2 and Actin
Actin-R
CTACAACAGCAGACCTGAGTTCACT
RrRUP2-Q-F
ACTCTCTCCACGGTCGTC
RrRUP2-Q-R
CTCCGGTGGCTAGAACAGT
RrRUP2-S-F
ACTAGTATGAACCCACCTTTCCATTTCC
Expression vector construction for RrRUP2
RrRUP2-P-R
CACGTGCTAATCCGAAGCTAATGACTTTC
2.2.3. Bioinformatics
Homologous sequence alignment analysis was performed using Blast online provided by NCBI. The open reading frame for Wd40 gene cDNA was found online, using ORF Finder predict protein secondary structure, using online software Prot-Param and CD-Search was used to analyze the physical and chemical properties of proteins and the prediction of conservative structural domains. Build the phylogenetic tree using MEGA5.0 software.
2.2.4. Expression Analysis of RrRUP2 in Different Tissues and Different Flower Developments
According to the CFX96TM Real-Time System Real Time quantitative PCR and SYBR® Premix Ex TaqTM kit instructions (TaKaRa, Inc., Japan). Referencing to abm reverse transcriptase kit to synthesize cDNA and use it as template for real-time fluorescence quantitative PCR method to detect the expression of Wd40 gene in 5 developmental stages and 7 tissue sites. According to the sequence information of Wd40 gene cloned, the primers were designed by using DNAMAN software (Table 1). The reaction volume was comprised of 20 µL containing 10 µL SYBR®Premix Ex TaqTM, 0.4 µL primer (RrRUP2-Q-F and RrRUP2-Q-R) and 1 µL cDNA, with ddH2O added to a total volume of 20 µL. The reaction conditions were as follows: pre-heating at 94˚C for 5 min; 39 cycles at 95˚C for 10 s, at 60˚C for 30 s. Signals were monitored by the Chromo 3 real-time PCR system, finally 30 s at 60˚C and 30 s at 95˚C for the melting curve. Each gene was set to repeat three times, and the experimental data were processed by the method of marking. Each gene was assessed with three biological replications. The relative expression levels of the genes were calculated by the 2-ΔΔCt method.
2.2.5. Construction of Expression Vector
According to the ORF of RrRUP2, the corresponding primers RrRUP2-s-f and RrRUP2-p-r (Table 1) were designed. After the sequencing validation, select right sequence to extract plasmids. The RrRUP2 was digested by SpeI and PmlI and connected to the vector pCAMBIA1304 by Solution-I. The diagram of pCAMBIA1304 was shown in Figure 1.
3. Results and Analysis3.1. Cloning and Sequence Analysis of RrRUP2
A Wd40 protein was cloned from R. rugosa “Zi zhi” petals, named RrRUP2. The RrRUP2 gene 3’ terminal sequence of 553 bp length by using nested PCR method (Figure 2(a)) and the full length of the gene was 1173 bp (Figure 2(b)), and the open reading frame was 717 bp, encoding 390 amino acids. BLAST the nucleotide sequences and the translated amino acid sequences were compared on NCBI, and it was found that the amino acid sequences encoded by RrRUP2 were as much as 90% homologous with the RUP2 proteins of Rosa chinensis, Fragaria and homologous with the Pyrus, Malus domestica, Juglans is respectively 69%, 70%, 66%. To sum up, this gene is highly cognate with the discovered RUP2 gene, which can be concluded to be RrRUP2 gene in R. rugosa.
3.2. Bioinformatics Analysis of RrRUP2 Gene
The RrRUP2 gene encodes 390 amino acids, and the predicted molecular formula is C3415H5659N1173O1434S313, the relative molecular weight is 96,129.27 Da, and
the theoretical isoelectric PI value is 5.00. Among the 390 amino acids coded, 34 basic amino acids (Arg + Lys) and 50 acidic amino acids (Asp + Glu) are included. Its instability index is 48.76, belonging to the unstable protein; The total average hydrophobic index was −0.364, belonging to hydrophilic protein. The secondary structure of RrRUP2 demonstrates that there are 10α-helix, 45 β-helix, 181 random coil, 154 extended peptide chain. The phosphorylation site prediction results reveals that there are 37 Ser phosphorylation sites, 43 Gly phosphorylation sites, 39 Val phosphorylation sites, and 29 Leu phosphorylation sites, so we can infer that it may participate in phosphorylation control.
3.3. Construction of Plasmid for Transient Gene Expression Assay
DNAman analysis shows that RrRUP2 gene is highly homologous to the Rosa chinensis (xp-024192945), genetic homology with Fragaria (xp-004309213), Pyrus (xp-009340009), Malus (xp-008376565), Juglans (xp-018830865) are respectively 85%, 69%, 70%, 66%. According to the NCBI, we found 72 RUP2 genes with similarity. Predicting the conserved domain of RrRUP2 protein amino acid sequences, the results showed that the amino acid sequences of RrRUP2 protein had typical WD and XR dipeptide structures, in which can interact with DDB1 to form an E3 ligase with CUL4 as the backbone to participate in biological processes (Figure 3).
In order to study the evolutionary relationship between RrRUP2 protein and other Wd40 protein, we constructed phylogenetic trees, which showed that RrRUP2 was closely related to the RUP2 familes (Figure 4).
3.4. Expression Analysis of RrRUP2 in Different Tissues and Different Flower Developments
To analyze the specificity of RrRUP2 gene in different parts and varieties, RT-pcr analysis was used to detect the transcription level of the gene in the root, stem, leaf, petals, pistils, stamens, sepals of the R. rugosa “Zi zhi”. Real-time
fluorescence quantitative results of gene RrRUP2 showed (Figure 5): The highest expression level of RrRUP2 was observed in root and sepal, while it expressed slightly in flower, pistil and leaves, and almost didn’t express in stem and stamen. The expression of this gene in five different periods of R. rugosa “Zi zhi”, R. rugosa “Bai Zi zhi” and R. rugosa “Fen Zi zhi” was analyzed. We found that the general trend at the the bud stage, the initial stage, the half stage, the blooming stage and the end of the blooming period was that the expression of the gene decreased with the development of color. It is obvious that the expression of the R. rugosa “Bai Zi zhi” is much higher than that of the other two species (Figure 6).
3.5. Construction of Plasmid for Transient Gene Expression Assay
After the expression vector pCAMBIA1304 was cut with the restriction endonuclease with Spe I and PmlI (Firure 4
connected with the vector cutting through the solutionI to form a pCAMBIA1304-RrRUP2 (Figure 7). A represented the target band of RrRUP2, the light band was located near 1173 bp, which was the target gene band. B represented the target band of pCAMBIA1304. Finally, we obtain the agrobacterium vector and intend to transfer the recombinant plasmid RrRUP2-pCAMBIA1304 to Arabidopsis thaliana to verify its function.
4. Discussion
In this study, RrRUP2 was cloned from Rosa rugosa. RrRUP2 belongs to WD40 super family. WD40 has a variety of biochemical and cellular biological functions, mainly including signal transduction, RNA processing vesicle transport, cytoskeleton assembly and a variety of biological processes [17] . For example, it can form MBW complex with MYB and BHLH to regulate anthocyanin biosynthesis [18] . RUP2 acted on the downstream of UVR-8-cop1 and played a negative feedback regulating role in UV-B induced photomorphogenesis of plants. Through bioinformatics analysis, it was found that C-terminal conservative relatively. The 27th amino acid of C-terminal can interact with UVR8. In yeast, RUP2 can interact with monomer form of UVR8W285A, also it can interact with dimer form of UVR8W285F [19] . The results showed that the amino acid sequences RrRUP2 protein had typical WD and XR dipeptide structures, in which can interact with DDB1 to form an E3 ligase with CUL4 as the backbone to participate in biological processes [20] .
The RrRUP2 amino acid sequences cloned from Rosa were compared with the amino acid sequences of other species, which shows that RrRUP2 is more than 90% similar to RUP2 protein in Rosa chinensis and Fragaria. RUP 1 and RUP2 encode two highly homologous DWD proteins from two genes without introns, with protein lengths of 385 and 368 amino acids, and homology of 63 percent in 349 overlapping amino acids. From a phylogenetic perspective, these two proteins are most similar to COP1 and SPA proteins in photomorphogenesis [21] . They are all important members of the UV-B signaling pathway.
The expression levels of the RrRUP2 gene during flower development and in different tissues were investigated. It has been found that in the three varieties, gene expression decreased with color increasing. It is shown that RUP2 may be a negative regulator in flower and color regulation. According to the fluorescence quantification of tissues, the highest expression level of RrRUP2 was observed in root and sepal, followed by flowers. RUP2 could regulate the expression of RUP2 gene by regulating the plant biological clock, which was called EFO2.
Light is one of the main environmental factors affecting the biosynthesis of anthocyanin [22] , UV-B light is potentially destructive to both genetic material and photosynthetic systems. Plants respond to low levels of UV-B radiation and have a coordinated photoresponse that adapts to this environmental pressure factor [23] . Key participants in this UV-B reaction are COP1 (E3 ubiquitin ligase), UVR8 (propeller protein) and HY5 bZIP transcription factor) [24] . In order to prevent the over-amplification and output of UV-B signal, there is a very accurate negative feedback regulation mechanism in the plant to participate in the UV-B photomorphic signal pathway, among which RUP2 is an important negative regulator. RUP2 can promote the dimerization of UVR8, thus promoting its inactivation back to the ground state, effectively terminating the continued output of UV-B signal, and the re-formed UVR8 dimer weight has new UV-B response capacity [25] . UV-B can induce the expression of CHS, a key enzyme in the flavonoid synthesis pathway, thus promoting the accumulation of anthocyanin. However, when overexpression of RUP2 was detected, the CHS gene expression was inhibited, thus hindering the synthesis of anthocyanin.
5. Conclusion
According to the current progress, although the modified gene has been cloned from Rosa rugosa and we were going to transgenic, the regulatory mechanism of RrRUP2 and UVR8 gene in rugosa has not been determined. It is not clear how the optical signal can be transmitted and regulated by RrRUP2 gene in rosa under different light quality and light conditions. Recently, more and more studies have been conducted on the key genes in the anthocyanin pathway and the mechanism of flower color regulation has been improved. However, few studies have been conducted on the light which is most important environmental regulator. In this study, we cloned RrRUP2 and analyzed its expression, which was beneficial to analyzing of how light is transmitted through signal transduction and regulating the expression of transcription factors and structural genes, and how the transcription factors involved in anthocyanin synthesis interact synergistically to the regulation; what is more, it also provided some important information to research anthocyanin in Rosa rugosa.
Conflicts of Interest
The authors declare no conflicts of interest regarding the publication of this paper.
Cite this paper
Wang, Y.N., Zhao, M.Y., Han, X., Zhao, L.Y. and Xu, Z.D. (2018) Cloning and Expression Analysis of RrRUP2 Gene Related to Photomorphogenesis Biosynthesis in Rosa rugosa. American Journal of Plant Sciences, 9, 2533-2544. https://doi.org/10.4236/ajps.2018.913183
NOTESReferencesLi, M. (2006) Survey and Quality Evaluation of Shandong Rose Varieties. Shandong University of Traditional Chinese Medicine, Jinan.Isabels, C., Teresa, C., Laram, C. and Paula, D. (2010) Effect of Photoperiod on Flavonoid Pathway Activity in Sweet Potato (Ipomoea batatas (L.) Lam.) Leaves. Food Chemistry, 118, 384-390. https://doi.org/10.1016/j.foodchem.2009.05.005Yang, Y.J., Li, Y., Li, X., Guo, X.H., Xiao, X.J. and Tang, D.Y., et al. (2010) Comparative Proteomics Analysis of Light Responses in Cryptochrome1-304 and Columbia Wild-Type 4 of Arabidopsis thaliana. Acta Biochimica et Biophysica Sinica, 40, 27-37. https://doi.org/10.1111/j.1745-7270.2008.00367.xBan, Y., Honda, C., Hatsuyama, Y., Igarashi, M., Bessho, H. and Moriguchi, T. (2007) Isolation and Functional Analysis of a MYB Transcription Factor Gene That Is a Key Regulator for The development of Red Coloration in Apple Skin. Plant & Cell Physiology, 48, 958-970. https://doi.org/10.1093/pcp/pcm066Han, Y.P., Sornkanok, V., Elena, S.G.R. and Korban, S.S. (2012) Introduction of ANR genes into Tobacco Inhibits Expression of Both CHI and DFR genes in Flowers, Leading to Loss of Anthocyanin. Journal of Experimental Botany, 63, 2437-2447. https://doi.org/10.1093/jxb/err415Albert, N.W., Lewis, D.H., Zhang, H.B., Irving, L.J., Jameson, P.E. and Davies, K.M. (2009) Light-Induced Vegetative Anthocyanin Pigmentation in Petunia. Journal of Experimental Botany, 60, 2191-2202. https://doi.org/10.1093/jxb/erp097Rockwell, N.C., Su, Y.S. and Lagarias, J.C. (2006) Phytochrome Structure and Signaling Mechanisms. Annual Review of Plant Biology, 57, 837-858. https://doi.org/10.1146/annurev.arplant.56.032604.144208Georgieva, D.N., Nikolov, P. and Betzel, C. (1998) Steady-State and Time-Resolved Fluorescence of Esperase®: Comparison with the X-Ray Structure in the Region of the Two Tryptophans. Spectrochimica Acta Part A: Molecular & Biomolecular Spectroscopy, 54, 1109-1116. https://doi.org/10.1016/S1386-1425(98)00026-2Zhang, J., Stankey, R.J. and Vierstra, R.D. (2013) Structure-Guided Engineering of Plant Phytochrome B with Altered Photochemistry and Light Signaling. Plant Physiology, 161, 1445-1457. https://doi.org/10.1104/pp.112.208892Heijde, M. and Ulm, R. (2012) UV-B Photoreceptor-Mediated Signalling in Plants. Trends in Plant Science, 17, 230-237. https://doi.org/10.1016/j.tplants.2012.01.007Tilbrook, K., Arongaus, A.B., Binkert, M., Heijde, M., Yin, R. and Ulm, R. (2013) The UVR8 UV-B Photoreceptor: Perception, Signaling and Response. Arabidopsis Book, 11, e0164. https://doi.org/10.1199/tab.0164Brosche, N. and Strid, A. (2010) Molecular Events Following Perception of Ultraviolet-B Radiation by Plants. Physiologia Plantarum, 117, 1-10. https://doi.org/10.1034/j.1399-3054.2003.1170101.xMa, G.L.B., Bartels, S., Albert, A. and Ulm, R. (2011) Arabidopsis Map Kinase Phosphatase 1 and Its Target Map Kinases 3 and 6 Antagonistically Determine UV-B Stress Tolerance, Independent of the UVR8 Photoreceptor Pathway. Plant Journal, 68, 727-737. https://doi.org/10.1111/j.1365-313X.2011.04725.xKliebenstein, D.J., Lim, J.E., Landry, L.G. and Last, R.L. (2002) Arabidopsis UVR8 Regulates Ultraviolet-B Signal Transduction and Tolerance and Contains Sequence Similarity to Human Regulator of Chromatin Condensation 1. Plant Physiology, 130, 234-243. https://doi.org/10.1104/pp.005041Ding, W.Z., Zhang, G.L., Fan, L.M., Liu, G.S., Sui, X.Q. and Yuan, Y.B. (2015) Cloning and Bioinformatics Analysis of Apple UVR8. Molecular Plant Breeding, 13, 1779-1785.Ben-Simhon, Z., Judeinstein, S., Nadler-Hassar, T., Trainin, T., Bar-Ya’Akov, I., Borochov-Neori, H., et al. (2011) A Pomegranate (Punica granatum L.) wd40-Repeat Gene Is a Functional Homologue of Arabidopsis ttg1, and Is Involved in the Regulation of Anthocyanin Biosynthesis during Pomegranate Fruit Development. Planta, 234, 865-881. https://doi.org/10.1007/s00425-011-1438-4Lloyd, A., Brockman, A., Aguirre, L., Campbell, A., Bean, A., Cantero, A., et al. (2017) Advances in the MYB-bHLH-WD Repeat (MBW) Pigment Regulatory Model: Addition of a WRKY Factor and Co-Option of an Anthocyanin MYB for Betalain Regulation. Plant & Cell Physiology, 58, 1431-1441. https://doi.org/10.1093/pcp/pcx075Yang, T., Liang, D., Guan, J., Zhu, T., Xia, H. and Lu, X. (2017) Cloning and Expression Analysis of uvr8 (uvr8) in Sweet Cherry. Genomics and Applied Biology, No. 4, 1563-1569.Wang, W., Yang, D. and Feldmann, K.A. (2011) Efo1 and Efo2, Encoding Putative Wd-Domain Proteins, Have Overlapping and Distinct Roles in the Regulation of Vegetative Development and Flowering of Arabidopsis. Journal of Experimental Botany, 62, 1077. https://doi.org/10.1093/jxb/erq336Gruber, H., Heijde, M., Heller, W., Albert, A., Seidlitz, H.K. and Ulm, R. (2010) Negative Feedback Regulation of Uv-B Induced Photomorphogenesis and Stress Acclimation in Arabidopsis. Proceedings of the National Academy of Sciences of the United States, 107, 20132-20137. https://doi.org/10.1073/pnas.0914532107Heijde, M., Binkert, M., Yin, R., Aresorpel, F., Rizzini, L., Van, E.D.S., et al. (2013) Constitutively Active uvr8 Photoreceptor Variant in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America, 110, 20326-20331. https://doi.org/10.1073/pnas.1314336110Yang, H.Q., Wu, Y.J., Tang, R.H., Liu, D., Liu, Y. and Cashmore, A.R. (2000) The c Termini of Arabidopsis Cryptochromes Mediate a Constitutive Light Response. Cell, 103, 815-827. https://doi.org/10.1016/S0092-8674(00)00184-7Lau, O.S. and Deng, X.W. (2012) The Photomorphogenic Repressors cop1 and det1: 20 Years Later. Trends in Plant Science, 17, 584-593. https://doi.org/10.1016/j.tplants.2012.05.004Saijo, Y., Sullivan, J.A., Wang, H., Yang, J., Shen, Y., Rubio, V., et al. (2003) The Cop1-Spa1 Interaction Defines a Criti. Genes & Development, 17, 2642-2647. https://doi.org/10.1101/gad.1122903Deng, X.W., Caspar, T. and Quail, P.H. (1992) Cop1: A Regulatory Locus Involved in Light-Controlled Development and Gene Expression in Arabidopsis. The Plant Cell, 4, 1507-1518. https://doi.org/10.1105/tpc.4.12.1507