<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">ABB</journal-id><journal-title-group><journal-title>Advances in Bioscience and Biotechnology</journal-title></journal-title-group><issn pub-type="epub">2156-8456</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/abb.2018.911042</article-id><article-id pub-id-type="publisher-id">ABB-88915</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Evaluation of Drought Stress-Inducible W&lt;i&gt;si&lt;/i&gt;18 Promoter in &lt;i&gt;Brachypodium distachyon&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Patrick</surname><given-names>Langille</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Wei</surname><given-names>Wei</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jim</surname><given-names>Karagiannis</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Tim</surname><given-names>Xing</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lining</surname><given-names>Tian</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff3"><addr-line>Department of Biology, University of Western Ontario, London, Canada</addr-line></aff><aff id="aff1"><addr-line>London Research and Development Centre, Agriculture and Agri-Food Canada, London, Canada</addr-line></aff><aff id="aff4"><addr-line>Department of Biology, Carleton University, Ottawa, Canada</addr-line></aff><aff id="aff2"><addr-line>State Key Laboratory Breeding Base for Zhejiang Sustainable Plant Pest Control, Institute of Quality and Standard for Agro-Products, Zhejiang Academy of Agricultural Sciences, Hangzhou, China</addr-line></aff><pub-date pub-type="epub"><day>15</day><month>11</month><year>2018</year></pub-date><volume>09</volume><issue>11</issue><fpage>596</fpage><lpage>612</lpage><history><date date-type="received"><day>4,</day>	<month>June</month>	<year>2018</year></date><date date-type="rev-recd"><day>27,</day>	<month>November</month>	<year>2018</year>	</date><date date-type="accepted"><day>30,</day>	<month>November</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  The rice 
  Wsi
  18 promoter confers drought-inducible gene expression. This property makes it a useful candidate to drive relevant genes for developing drought resistant trait for different monocot crops. In this study, we showed that the 
  Bradi
  2
  G
  47700 gene, the closest homologue to rice 
  Wsi
  18, was upregulated in 
  Brachypodium distachyon
   plants exposed to ABA and mannitol. 
  Wsi
  18:
   uidA
   transgenic 
  B. distachyon 
  plants were produced and then subjected to ABA or mannitol treatment. The expression of 
  uidA
   in three transgenic lines (line 10, 18 and 37) was significantly upregulated in plants exposed to ABA (fold increases of 5.61 &#177; 0.98, 2.88 &#177; 0.75 and 9.13 &#177; 1.96, respectively) compared to the same transgenic plant lines without treatment. The expression of 
  uidA 
  in two transgenic lines (lines 18 and 37) also showed upregulation when treated with mannitol (fold increases of 4.43 &#177; 1.07 and 8.47 &#177; 2.90, respectively) compared to the same transgenic plant lines without mannitol treatment. Moreover, GUS histochemical assay showed increased 
  Wsi
  18 promoter activity in the leaves and stems of transgenic lines upon treatment with ABA or mannitol. This is the first report of the drought inducible rice 
  Wsi
  18 promoter being active in 
  B. distachyon 
  which is a model plant for molecular biology research of various monocot plants. Taken together, the results indicate that the 
  Wsi
  18 promoter and its homologue may be explored as a useful tool for drought stress-inducible gene expression in different monocot crops.
 
</p></abstract><kwd-group><kwd>W&lt;i&gt;si&lt;/i&gt;18 Promoter</kwd><kwd> Drought Inducible</kwd><kwd> &lt;i&gt;Brachypodium distachyon&lt;/i&gt;</kwd><kwd> ABA</kwd><kwd> Mannitol</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Abiotic stresses area seriously threats to crop production. Each year, more than 50% of the global major crop yield is lost due to abiotic stress, with water deficit stresses such as drought and high salinity being the major contributors [<xref ref-type="bibr" rid="scirp.88915-ref1">1</xref>] . It is estimated that by the year 2050, the global demand for crop derived calories will have increased by 100%, and thus developing crop varieties with greater tolerance to abiotic stresses will be essential to meeting these needs [<xref ref-type="bibr" rid="scirp.88915-ref2">2</xref>] .</p><p>Introduction of relevant genes to crops via genetic engineering is an important approach for developing stress tolerance for plants. Several constitutive promoters have been previously used for such purpose, such as Ubi1 from maize, Act1, Rbcs and OsCc1 from rice [<xref ref-type="bibr" rid="scirp.88915-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.88915-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.88915-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.88915-ref6">6</xref>] . However, transgenic plants with strong constitutive promoters often suffer undesirable phenotypes. For example, transgenic rice constitutively over-expressing Ubil: OsNAC6 suffers from growth retardation to low reproductive yields [<xref ref-type="bibr" rid="scirp.88915-ref7">7</xref>] . Transgenic tobacco plants constitutively over-expressing 35S: TPS1 have greater drought tolerance, but suffer stunted growth [<xref ref-type="bibr" rid="scirp.88915-ref8">8</xref>] . This could be due to the cost of the resources needed to constantly overexpress the transgene, or negative interactions with normal cell metabolism [<xref ref-type="bibr" rid="scirp.88915-ref9">9</xref>] . Stress-inducible promoters offer the advantage of expressing the gene only under stress conditions. Thus, plants with stress-inducible promoters could eliminate undesirable phenotypes induced by constitutive transgene expression [<xref ref-type="bibr" rid="scirp.88915-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.88915-ref11">11</xref>] .</p><p>Only a few drought inducible promoters have been identified in plants so far. Wsi18 is a drought-inducible rice gene from the group 3 late embryogenesis abundant (LEA3) family [<xref ref-type="bibr" rid="scirp.88915-ref12">12</xref>] . The promoter has been analyzed in transgenic rice [<xref ref-type="bibr" rid="scirp.88915-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.88915-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.88915-ref15">15</xref>] and under normal condition, the basal expression of Wsi18 was low in transgenic rice tissues, but following drought, NaCl or ABA treatment, the expression of genes driven by Wsi18 was induced in the whole plant body [<xref ref-type="bibr" rid="scirp.88915-ref15">15</xref>] . Following drought conditions or exposure to ABA, Wsi18 had a level of transient expression comparable to that displayed by the strong constitutive promoter Act1 [<xref ref-type="bibr" rid="scirp.88915-ref16">16</xref>] . Despite the research conducted on Wsi18 in rice plant, its stable expression profile has never been studied in other plant species. Furthermore, it is not clear if the drought-inducible property can function in other monocot crops, more importantly, can be used to drive expression of suitable genes to develop drought tolerance in different monocot crops.</p><p>The family of Poaceae consists of grasses in three subfamilies, Ehrhartoideae, Panicoideae, and Pooideae. The Ehrhartoideae includes rice, the Panicoideae includes maize and sugar cane, and the Pooideae includes Purple false brome (Brachypodium distachyon) and the Triticeae tribe which includes many important crops such as wheat, rye, and barley [<xref ref-type="bibr" rid="scirp.88915-ref17">17</xref>] . Rice is distantly related to Pooideae and does not share some important agricultural traits with Pooideae members. Thus, rice is less suitable as research model plant for Poodeae members. B. distachyon is an emerging model for monocot plants and is more pertinent to many cereal crops [<xref ref-type="bibr" rid="scirp.88915-ref17">17</xref>] .</p><p>In this study, we identified Bradi2G47700 gene which is the closest homologue to rice Wsi18 promoter and found this gene was upregulated in B. distachyon plants upon exposure to ABA or mannitol. Furthermore, we show that the Wsi18 promoter drives high levels of uidA expression in transgenic B. distachyon plants under ABA and mannitol treatments. Our results demonstrate that the Wsi18 promoter has drought inducible activity in transgenic B. distachyon plants which is a model research plant closely related to many important monocot crops, and that the Wsi18 promoter might be an effective promoter to drive relevant genes for drought resistance in different monocot crops.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Vector Construction</title><p>The Wsi18 promoter region was amplified by PCR using the pWsi18 plasmid as the template (obtained from Ju-Kon Kim at Seoul National University) and the primers of FWsi18 and RWsi18 (<xref ref-type="table" rid="table1">Table 1</xref>). The 2 &#215; CaMV35S promoter region was amplified by PCR using the pMDC32 plasmid [<xref ref-type="bibr" rid="scirp.88915-ref18">18</xref>] and the primers of F2xCaMV35S and R2xCaMV35S with additional attB sites (<xref ref-type="table" rid="table1">Table 1</xref>). The PCR products of the Wsi18 promoter and the 2 &#215; CaMV35S promoter were separately inserted into pMDC163 plasmid using Gateway&#174; Technology (Thermo Fisher Scientific) [<xref ref-type="bibr" rid="scirp.88915-ref19">19</xref>] , generating the constructs of Wsi18:: uidA and 2 &#215; CaMV35S:: uidA respectively. The Wsi18:: uidA and 2 &#215; CaMV35S:: uidA plasmids were separated introduced into Agrobacterium tumefaciens strain AGL1 via electroporation.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers employed in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Primer use</th><th align="center" valign="middle" >Primer sequence 5’ &#224; 3’</th></tr></thead><tr><td align="center" valign="middle" >FWsi18</td><td align="center" valign="middle"  rowspan="2"  >Wsi18 gateway cloning</td><td align="center" valign="middle" >GGGGACAAGTTTGTACAAAAAAGCAGGCTGGCTCTAGAGGATCCTGAGA</td></tr><tr><td align="center" valign="middle" >RWsi18</td><td align="center" valign="middle" >GGGGACCACTTTGTACAAGAAAGCTGGGTCCATGGCGCAAACTTGGCTG</td></tr><tr><td align="center" valign="middle" >F2xCaMV35S</td><td align="center" valign="middle"  rowspan="2"  >2xCaMV35S gateway cloning</td><td align="center" valign="middle" >GGGGACAAGTTTGTACAAAAAAGCAGGCTCGACGGCCAGTGCCAAGC</td></tr><tr><td align="center" valign="middle" >R2xCaMV35S</td><td align="center" valign="middle" >GGGGACCACTTTGTACAAGAAAGCTGGGTCTCCTCTCCAAATGAAATGAAC TTC</td></tr><tr><td align="center" valign="middle" >FWsi18/GUS</td><td align="center" valign="middle"  rowspan="2"  >PCR genotyping</td><td align="center" valign="middle" >CCCGTTTCTCTGTCTTTTGC</td></tr><tr><td align="center" valign="middle" >RWsi18/GUS</td><td align="center" valign="middle" >GACCCACACTTTGCCGTAAT</td></tr><tr><td align="center" valign="middle" >FGUSQ</td><td align="center" valign="middle"  rowspan="2"  >RT-qPCRuidAcDNA</td><td align="center" valign="middle" >TACCGTACCTCGCATTACCC</td></tr><tr><td align="center" valign="middle" >RGUSQ</td><td align="center" valign="middle" >GAGGTTAAAGCCGACAGCAG</td></tr><tr><td align="center" valign="middle" >FBradi2G47700Q</td><td align="center" valign="middle"  rowspan="2"  >RT-qPCR Bradi2G47700 cDNA</td><td align="center" valign="middle" >GGCAAGGACAAGACAGGAAG</td></tr><tr><td align="center" valign="middle" >RBradi2G47700Q</td><td align="center" valign="middle" >CCATTCCGATGGTGTTCATC</td></tr><tr><td align="center" valign="middle" >FSamDCQ</td><td align="center" valign="middle"  rowspan="2"  >RT-qPCR SamDC cDNA</td><td align="center" valign="middle" >TGCTAATCTGCTCCAATGGC</td></tr><tr><td align="center" valign="middle" >RSamDCQ</td><td align="center" valign="middle" >GACGCAGCTGACCACCTAGA</td></tr></tbody></table></table-wrap></sec><sec id="s2_2"><title>2.2. Development of Transgenic B. distachyon Plants</title><p>Brachypodium distachyon ecotype Bd21 seeds were obtained from the United State Department of Agriculture (USDA). Seeds were germinated on medium containing 2.17 g/L Murashige &amp; Skoog (MS) basal salt mixture (Murashige and Skoog, 1962) (Phyto Technology Laboratories), 10 g/L sucrose, and 12 g/L of the gelling agent Phytagel™ (Sigma-Aldrich) in double distilled water (ddH<sub>2</sub>O). After germination, plants were grown in a growth room with a 20 hours photoperiod, light intensity of 172 &#181;mol・m<sup>−</sup><sup>2</sup>・s<sup>−</sup><sup>1</sup> and temperature of 22˚C. B. distachyon callus induction and plant transformation were conducted according to the protocol of Alves et al. [<xref ref-type="bibr" rid="scirp.88915-ref20">20</xref>] . Briefly, immature seeds that had just begun desiccation were collected from plants. The embryo was removed from the seed, plated on solid MS medium and cultured in the dark at 25˚C. Once calli had developed, compact embryogenic calli (CEC) were separated from any soft wet friable calli, and transferred to fresh medium. CEC were then divided into smaller fragments and subjected to transformation by co-cultivation with AgrobacteriumAGL1 containing the respective transformation vector. Calli infected by Agrobacterium were grown on MS medium containing 100 &#181;g/ml hygromycin B (Sigma-Aldrich) to regenerate transgenic plants. Our kill curve study indicated that this level of hygromycin selection could essentially inhibit the growth of non-transgenic tissues. Shoots developed from selection medium were picked and transferred to fresh medium for plant development. T1 seeds (seeds from T0 plants) were transferred to MS medium containing 115 mg/L hygromycin B for germination.</p><p>DNA was extracted from plants developed from hygromycin selection. Leaves of T0 plants were flash-frozen in liquid nitrogen and homogenized with a Tissue Lyser II machine (Qiagen). The forward primer FWsi18/GUS, which binds to the Wsi18 promoter, and the reverse primer RWsi18/GUS, which binds to the uidA gene (<xref ref-type="table" rid="table1">Table 1</xref>), were used to amplify the Wsi18: uidA. GoTaq&#174; Flexi DNA Polymerase (Promega) was used according to the product instructions for a PCR reaction with an annealing temperature of 60˚C and an extension time of 60 seconds. Transformed plants were expected to produce a 628 bp PCR product. To further confirm transformation, T1 seeds collected from T0 plants were germinated on seed germination medium containing 115 mg/L hygromycin B. Only the plants that were positive for PCR analysis and successfully germinated on 115 mg/L hygromycin medium were used to evaluate Wsi18 promoter expression.</p></sec><sec id="s2_3"><title>2.3. ABA and Drought Stress Treatments</title><p>B. distachyon plant seeds were placed on MS medium in Petri dishes for germination. Successfully germinated seedlings were transferred to the same MS medium in Magenta™ GA-7 Plant Tissue Culture Boxes (Sigma-Aldrich). Plants were grown in the growth room with a 20 hour photoperiod, light intensity of 172 &#181;mol・m<sup>−</sup><sup>2</sup>・s<sup>−</sup><sup>1</sup>and temperature of 22˚C for 14 days. At this time, plants were well established and extended photoperiod (20 hrs) was used to help to promote plant growth. For ABA treatment, plants were grown in hydroponic growth medium containing 100 &#181;M ABA (Sigma-Aldrich) for 8 hours. For mannitol treatment, plants were grown in hydroponic growth medium containing 400 mM mannitol (Sigma-Aldrich) for 18 hours, which was previously used as an effective and typical mannitol-mediated drought treatment [<xref ref-type="bibr" rid="scirp.88915-ref12">12</xref>] . Hydroponic growth medium was composed of 49 mg/L H<sub>3</sub>PO<sub>4</sub>, 250 mg/L CaCl<sub>2</sub>, 185 mg/L MgSO<sub>4</sub>・7H<sub>2</sub>O, 179 mg/L KCl, 58 mg/L NaCl, 241 mg/L NH<sub>4</sub>Cl, 454 mg/L KNO<sub>3</sub>, 2.86 g/L H<sub>3</sub>BO<sub>3</sub>, 1.81 g/L MnCl<sub>2</sub>・4H<sub>2</sub>O, 220 mg/L ZnSO<sub>4</sub>・7H<sub>2</sub>O, 51 mg/L CUSO<sub>4</sub>, and 120 mg/L NaMoO<sub>4</sub>・2H<sub>2</sub>O in ddH<sub>2</sub>O.</p></sec><sec id="s2_4"><title>2.4. Relative Water Content</title><p>Relative water content (RWC) was measured for each experimental group to gauge the amount of water loss created by each stress treatment [<xref ref-type="bibr" rid="scirp.88915-ref21">21</xref>] . All of the leaves from two non-transformed plants were collected, and weighed immediately after plants were removed from hydroponic growth medium to obtain the fresh weight (Wfresh). The leaves were floated on ddH<sub>2</sub>O in petri dishes for 6 hours, blotted dry, and reweighed to give the turgid weight (Wturgid). Leaves were then placed in an oven at 50˚C for 48 hours and reweighed to give the dry weight (Wdry). RWC was calculated using the equation: RWC = (Wfresh − Wdry)/(Wturgid-Wdry) &#215; 100.</p></sec><sec id="s2_5"><title>2.5. RNA Extraction and Quantitative Real-Time PCR</title><p>A sample used for expression analysis consisted of the entire shoot portion including the leaves of a single 3-week-old plant. Samples were collected in RNase-free microcentrifuge tubes, immediately flash frozen in liquid nitrogen, and stored at −80˚C until RNA extraction was performed. For RNA extraction, frozen samples were homogenized with a Tissue Lyser II machine, and 1 mL of TRIzol&#174; reagent (Thermo Fisher Scientific) was added to homogenized samples, followed by 200 μl chloroform. The RNA concentration of each sample was quantified using a Nanodrop™ 1000 spectrophotometer. DNase 1 treatment (Thermo Fisher Scientific) of 1 μg of RNA was performed as per the product’s instructions to remove residue DNA, and heat deactivation was used for DNase 1 deactivation. Complementary DNA (cDNA) conversion of the DNase 1 treated RNA samples was performed using iScript™ Reverse Transcription Supermix (BIO-RAD) as per the product instructions. cDNA was stored at −20˚C until use for quantitative PCR (qPCR) reactions. Quantitative PCR (qPCR) was performed on the cDNA templates using qPCR reaction mix SsoFast™ EVAGreen&#174; supermix (BIO-RAD) as per the products instructions in a CX96™ Real Time system―C1000 touch thermal cycler. The primers used for qPCR are listed in <xref ref-type="table" rid="table1">Table 1</xref>. Reactions had an annealing temperature of 60&#176;C and an extension time of 30 seconds. The comparative Ct (Ct) method (Livak and Schmittgen, 2001) was used to calculate the relative fold change between stress-treated plants and unstressed control plants within each transgenic line used. For each sample, at least three qPCR reactions were performed for the gene of interest as well as for the internal control gene. The technical replicates were averaged for each gene to obtain the cycle threshold (Ct) values. S-adenosylmethionine decarboxylase (SamDC) was used as the internal control gene to normalize expression levels between different samples, because it has been shown to have stable expression under water deficit conditions [<xref ref-type="bibr" rid="scirp.88915-ref22">22</xref>] . The Ct value of the internal control gene was subtracted from the Ct value of the gene of interest (uidA, or Bradi2G47700) to obtain the Ct value of each sample. Each transgenic line analyzed had 3 stress-treated samples, and 3 unstressed control samples. The Ct values of stress-treated plants and unstressed control plants were subtracted from the mean Ct value of the unstressed control plants within each line to obtain the Ct values. Fold change was calculated to express the difference in expression between stress-treated groups and unstressed control groups within each line.</p></sec><sec id="s2_6"><title>2.6. GUS Histochemical Analysis</title><p>GUS histochemical staining was performed as described by Jefferson et al. [<xref ref-type="bibr" rid="scirp.88915-ref23">23</xref>] . Briefly, shoots with leaves of plants in each treatment group were cut off and immediately submerged in GUS staining solution (2 mM 5-bromo-4-chloro-3-indolyl glucuronide (X-gluc), 0.1 M NaPO<sub>4</sub> (pH 7.0), 10 mM EDTA, 1% triton X-100, and 1 mM K<sub>3</sub> Fe(CN)<sub>6</sub>). X-gluc is a substrate of the β-glucuronidase enzyme, the product of the uidA gene. Each sample was vacuum infiltrated for 30 minutes, then incubated overnight at 37˚C. Samples were submerged in 95% ethanol for 48 hours to remove chlorophyll and make the staining easier to observe.</p></sec><sec id="s2_7"><title>2.7. Statistical Analysis</title><p>All statistical analyses were performed using the program “R” version 3.1.3 Copyright&#169; 2015 (The R Foundation for Statistical Computing). RWC measurements were expressed as mean &#177; standard error of 9 - 10 biological replicates for each stress-treated and unstressed control group. The statistical difference between each stress and its corresponding unstressed control group was assessed using a Welch’s two sample t-test. Significance was established at p &lt; 0.05. All RT-qPCR results were expressed as the mean &#177; standard error of 3 biological replicates in each stress treatment group, and 3 biological replicates in each unstressed control group of each transgenic line. The statistical difference between the fold change of each stress treatment group and their corresponding unstressed control group was assessed using a Welch’s two sample t-test. Significance was established at p &lt; 0.05.</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><sec id="s3_1"><title>3.1. RWC Decreases in B. distachyon Plants Subjected to Mannitol Treatment</title><p>In order to determine the effectiveness of drought treatment, plant relative water content (RWC) was measured after plants were subjected to ABA and mannitol treatment. Plants treated with ABA did not show a significant difference in RWC compared to control plants, with RWCs of 93.44% &#177; 2.75% and 90.41% &#177; 2.80% respectively (<xref ref-type="fig" rid="fig1"><xref ref-type="fig" rid="fig">Figure </xref>1</xref>(a)). This was predictable as ABA itself should not cause drought condition, rather, ABA only functions to mediate plant response to drought. On the other hand, the plants grown in hydroponic growth medium containing mannitol had a RWC of 64.81% &#177; 4.63%, a significant decrease compared to control plants which had a RWC of 90.99% &#177; 3.87% (<xref ref-type="fig" rid="fig1"><xref ref-type="fig" rid="fig">Figure </xref>1</xref>(b)). Thus, mannitol treatment was effective to induce water deficit condition in B. distachyon as observed in some other plants such as Sesuvium portulacastrum [<xref ref-type="bibr" rid="scirp.88915-ref24">24</xref>] , tobacco [<xref ref-type="bibr" rid="scirp.88915-ref25">25</xref>] and wheat [<xref ref-type="bibr" rid="scirp.88915-ref26">26</xref>] .</p></sec><sec id="s3_2"><title>3.2. Bradi2G47700 Gene Expression Is Upregulated in B. distachyon Plants Under Drought Stress</title><p>The plant genome database of www.phytozome.net was used to identify possible Wsi18 homologous genes native to B. distachyon. Putative homologues were identified based on amino acid sequence similarity to that of the Wsi18 gene of rice rather than the promoter DNA sequence because coding regions are usually more conserved than non-coding regions [<xref ref-type="bibr" rid="scirp.88915-ref27">27</xref>] . The Bradi2G47700 amino acid sequence was identified as the most similar protein to Wsi18 in B. distachyon and shares 74% amino acid sequence similarity with Wsi18 (<xref ref-type="fig" rid="fig2"><xref ref-type="fig" rid="fig">Figure </xref>2</xref>). To investigate the expression of Bradi2G47700 gene in B. distachyon under drought stresses, the non-transformed B. distachyon plants were subjected to ABA and mannitol treatments, and the Bradi2G47700 gene expression was analyzed via RT-qPCR at 8 hours and 18 hours after treatment, respectively. The SamDC gene, which has been shown to express stably under water deficit conditions [<xref ref-type="bibr" rid="scirp.88915-ref22">22</xref>] , was used as a reference gene for RT-qPCR to normalize Bradi2G47700 transcript levels between samples. The normalized level of Bradi2G47700 transcripts in stress-treated plants were compared to the transcript level of unstressed</p><p>control plants to calculate the relative fold change. The Bradi2G47700 gene expression in ABA treated plants was upregulated 794.14 &#177; 504.91 (P = 0.01914) fold on average compared to the non-stressed control group (<xref ref-type="fig" rid="fig3"><xref ref-type="fig" rid="fig">Figure </xref>3</xref>(a)). The Bradi2G47700gene expression in mannitol treated plants resulted in 101.85 &#177; 8.17 (P &lt; 0.01) fold increase on average as compared to the non-stressed control group (<xref ref-type="fig" rid="fig3"><xref ref-type="fig" rid="fig">Figure </xref>3</xref>(b)). Yi et al. [<xref ref-type="bibr" rid="scirp.88915-ref15">15</xref>] reported that Wsi18 mRNA abundance increased in leaf tissues or roots exposure to ABA. Interestingly, Joshee et al. [<xref ref-type="bibr" rid="scirp.88915-ref12">12</xref>] reported that Wsi18 gene can be induced by water stress conditions such as mannitol and NaCl, but not by ABA. Probably Joshee et al. [<xref ref-type="bibr" rid="scirp.88915-ref12">12</xref>] used low dose of ABA (20 M), and the dose of ABA as Yi et al. reported (100 M) was five times higher. Taken together, the upregulation of Bradi2G47700gene after ABA and mannitol treatments indicates that the Bradi2G47700gene in B. distachyon is similarly water stress inducible like Wsi18. As Bradi2G47700 shares a high level of similarity with Wsi18 and is also inducible for expression under drought treatments, Bradi2G47700 is probably the true homologue of Wsi18. The results indicate Wsi18 homologues in other monocot crops may be explored for drought stress tolerance development for respective and specific situations.</p></sec><sec id="s3_3"><title>3.3. Wsi18 Expression Was Upregulated in Wsi18: UidA transgenic B. distachyon Subjected to ABA and Mannitol Treatments</title><p>Transgenic B. distachyon plants were developed to evaluate the expression of the Wsi18 promoter under water deficit condition and in response to ABA. PCR was first performed to evaluate plant transformation. B ands of 628 bp which was expected the size of PCR product were detected in 21 of the 32 regenerated plants (Supplemental <xref ref-type="fig" rid="fig">Figure </xref>S1). In addition to PCR genotyping, T1 seeds (seeds from T0 plants) were transferred to MS medium containing 115 mg/L hygromycin B for germination. This level of selection was found to be sufficient</p><p>to kill non-transgenic plants (Supplemental <xref ref-type="fig" rid="fig">Figure </xref>S2). All the lines which were PCR positive germinated normally on medium containing 115 mg/L hygromycin. On the other hand, the plants which did not produce the correct 628 bp product in PCR genotyping either did not germinate in the presence of hygromycin B, or produced only black roots (not shown). PCR genotyping and hygromycin B seed selection provided two levels of plant transformation analyses and only the plants that were PCR positive and showed normal germination and growth under high level (115 mg/L) of hygromycin B selection were used to evaluate Wsi18 expression.</p><p>Real-time PCR analysis was used to examine the expression of the uidA reporter gene, which was driven by the Wsi18 promoter, in transgenic lines of Wsi18: uidA following ABA or mannitol treatment. The SamDC gene was used as a reference gene for RT-qPCR to normalize uidA gene expression between samples. Normalized uidA expression levels within each line were compared to the expression level of non-drought-treated control plants of the same transgenic line to determine their relative fold change. Control was the plants that were grown in fresh hydroponic growth medium for the same duration as their respective stress treatment. Of the five transgenic lines, the uidA expression in three lines (lines 10, 18 and 37) was significantly upregulated after ABA treatment. Lines 10, 18 and 37 showed fold increases of 5.61 &#177; 0.98 (P &lt; 0.01), 2.88 &#177; 0.75 (P &lt; 0.05) and 9.13 &#177; 1.96 (P &lt; 0.05), respectively (<xref ref-type="fig" rid="fig">Figure </xref>4(a)). The uidA expression in the other two lines (lines 3 and 12) did not display significant increase in expression (<xref ref-type="fig" rid="fig">Figure </xref>4(a)). For mannitol treatment, the uidA expression in two lines (lines 18 and 37) was significantly upregulated. The uidA expression in lines 18 and 37 displayed fold increases of 4.43 &#177; 1.07 (P &lt; 0.05) and 8.47 &#177; 2.90 (P &lt; 0.05) respectively. Although uidA expression in lines 11, 15 and 27</p><p>showed an increased upregulation of 2.16 &#177; 1.27 (P = 0.2298), 6.10 &#177; 3.52 (P = 0.0938) and 2.96 &#177; 0.90 (P = 0.0659) fold respectively, there was no significant difference between the control and treated groups (<xref ref-type="fig" rid="fig">Figure </xref>4(b)). Variation of transgene expression in different transgenic plants has been frequently reported for both constitutive and inducible promoters before [<xref ref-type="bibr" rid="scirp.88915-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.88915-ref28">28</xref>] . One explanation for the observed differences in uidA expression between the transgenic lines in this study could be the differences in the site of transgene integration into the B. distachyon genome, known as positional effects. Transcriptional regulatory sequences such as enhancers and inhibitors found around the site of integration, as well as the chromatin structure around the site of integration, could all influence the expression of the transgene. Integration at highly expressing loci will produce higher expressing transgenic lines than integration at loci with lower transcriptional activity (Butaye et al., 2005). Additionally, copy number has been shown to influence transgene expression levels. Integration of multiple transgene copies often produces low levels of expression due to homology-dependent gene silencing [<xref ref-type="bibr" rid="scirp.88915-ref29">29</xref>] . Homology-dependent gene silencing can be the result of transcriptional gene silencing or post-transcriptional gene silencing. Transcriptional gene silencing includes processes such as promoter methylation, which blocks transcription from occurring from the promoter, while post-transcriptional gene silencing causes transcripts to be degraded before they can be translated into protein. If Wsi18 was not water deficit-inducible in B. distachyon, no difference in uidA expression would be expected between the stress-treated and unstressed control plants of any transgenic lines. The mannitol and ABA treatment did show a significant increase in Wsi18 driven uidA expression in certain transgenic lines, suggesting Wsi18 does have water deficit inducible activity in B. distachyon.</p></sec><sec id="s3_4"><title>3.4. Qualitative Analysis of Wsi18 Activity in Wsi18: UidA Transgenic B. distachyon Using the GUS Histochemical Assay</title><p>In addition to Real-time PCR analysis, GUS histochemical analysis was used to analyze and visualize the expression mediated by the Wsi18 promoter following mannitoland ABA treatments. The GUS histochemical assay can provide a further and protein level of evaluation of Wsi18 expression. The CaMV35S: uidA transgenic B. distachyon plants showed a greater amount of GUS activity in both the stem and leaves compared to wild type B. distachyon without drought treatment (<xref ref-type="fig" rid="fig">Figure </xref>5(a)). Three transgenic lines in which the uidA reporter gene was driven by the Wsi18 promoter were used for each analysis; plants were 3 weeks old at the time of analysis. Plants in the ABA-treated group were grown for 8 hours in hydroponic growth medium containing 100 μM ABA, plants grown in the mannitol-treated group were grown for 18 hours in hydroponic growth medium containing 400 mM mannitol. Unstressed control plants were of the same transgenic lines used for the stress treatments, and were grown in fresh hydroponic growth medium for the same duration as their respective stress treatment. The three Wsi18: uidA transgenic lines 10, 12 and 37 showed a greater amount of GUS activity in both the stem and leaves of plants which had undergone the ABA treatment, compared to control plants (<xref ref-type="fig" rid="fig">Figure </xref>5(b)). The three Wsi18: uidA transgenic lines 11, 18 and 24 which underwent the mannitol treatment also showed a greater degree of GUS staining compared to control plants, with no detectable GUS activity in any of the control plants (<xref ref-type="fig" rid="fig">Figure </xref>5(c)). There was variation in the level of GUS activity between the different transgenic lines, however, GUS activity was more prevalent following stress treatments than in unstressed control plants for each stress treatment. Some unstressed control plants did show small areas of GUS activity, but always to a lesser degree than their stress-treated counterparts. Low level Wsi18 promoter activity in unstressed control plants is consistent with the observations of Wsi18 activity in transgenic rice reported by Yi et al. [<xref ref-type="bibr" rid="scirp.88915-ref15">15</xref>] . The low levels of expression driven by Wsi18 in unstressed control plants may be due to less stringent regulation of gene expression in transgenes than genes in their native context. Non-transformed plant acted as a negative control to ensure there was no endogenous GUS</p><p>expression in B. distachyon, or contamination of the staining solutions.</p><p>Ourresults showed that the Bradi2G47700 gene, the closest homologue to rice Wsi18, was upregulated in B. distachyon plants exposed to ABA and mannitol. Further, we showed that the Wsi18 promoter can be induced to express by the water deficit conditions created by mannitol and the ABA. Response to ABA suggests Wsi18 is probably through ABA dependant signaling pathway to mediate plants for drought stress. The research indicates Wsi18 and the homologues may be used to drive relevant genes for drought stress resistance in different monocot crops.</p></sec></sec><sec id="s4"><title>Acknowledgements</title><p>We would like to thank Ju-Kon Kim from Seoul National University for providing the pWsi18 plasmid containing the Wsi18 promoter sequence. We thank Dr. Rima Menassa and Dr. Danielle Way for the discussion and suggestions during the research.</p></sec><sec id="s5"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s6"><title>Cite this paper</title><p>Langille, P., Wei, W., Karagiannis, J., Xing, T. and Tian, L.N. (2018) Evaluation of Drought Stress-Inducible Wsi18 Promoter in Brachypodium distachyon. Advances in Bioscience and Biotechnology, 9, 596-612. https://doi.org/10.4236/abb.2018.911042</p></sec><sec id="s7"><title>Supplemental</title></sec></body><back><ref-list><title>References</title><ref id="scirp.88915-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Valliyodan, B. and Nguyen, H.T. (2006) Understanding Regulatory Networks and Engineering for Enhanced Drought Tolerance in Plants. Current Opinion in Plant Biology, 9, 189-195. https://doi.org/10.1016/j.pbi.2006.01.019</mixed-citation></ref><ref id="scirp.88915-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Tilman, D., Balzer, C., Hill, J. and Befort, B.L. (2011) Global Food Demand and the Sustainable Intensification of Agriculture. Proceedings of the National Academy of Sciences of the USA, 108, 20260-20264. https://doi.org/10.1073/pnas.1116437108</mixed-citation></ref><ref id="scirp.88915-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Cornejo, M.J., Luth, D., Blankenship, K.M., Anderson, O.D. and Blechl, A.E. (1993) Activity of a Maize Ubiquitin Promoter in Transgenic Rice. Plant Molecular Biology, 23, 567-581. https://doi.org/10.1007/BF00019304</mixed-citation></ref><ref id="scirp.88915-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Jang, I.C., Choi, W.B., Lee, K.H., Song, S.I., Nahm, B.H. and Kim, J.K. (2002) High-Level and Ubiquitous Expression of the Rice Cytochrome c Gene OsCc1 and Its Promoter Activity in Transgenic Plants Provides a Useful Promoter for Transgenesis of Monocots. Plant Physiology, 129, 1473-1481.  
https://doi.org/10.1104/pp.002261</mixed-citation></ref><ref id="scirp.88915-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Kyozuka, J., McElroy, D., Hayakawa, T., Xie, Y., Wu, R. and Shimamoto, K. (1993) Light-Regulated and Cell-Specific Expression of Tomato rbcS-gusA and Rice rbcS-gusA Fusion Genes in Transgenic Rice. Plant Physiology, 102, 991-1000.  
https://doi.org/10.1104/pp.102.3.991</mixed-citation></ref><ref id="scirp.88915-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, W., McElroy, D. and Wu, R. (1991) Analysis of rice Act1 5' Region Activity in Transgenic Rice Plants. The Plant Cell, 3, 1155-1165.</mixed-citation></ref><ref id="scirp.88915-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Nakashima, K., Tran, L.S., Van Nguyen, D., Fujita, M., Maruyama, K., Todaka, D., Ito, Y., Hayashi, N., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2007) Functional Analysis of a NAC-Type Transcription Factor OsNAC6 Involved in Abiotic and Biotic Stress-Responsive Gene Expression in Rice. The Plant Journal, 51, 617-630.  
https://doi.org/10.1111/j.1365-313X.2007.03168.x</mixed-citation></ref><ref id="scirp.88915-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Romero, C., Belles, J.M., Vaya, J.L., Serrano, R. and Culianez-Macia, F.A. (1997) Expression of the Yeast Trehalose-6-Phosphate Synthase Gene in Transgenic Tobacco Plants: Pleiotropic Phenotypes Include Drought Tolerance. Planta, 201, 293-297. https://doi.org/10.1007/s004250050069</mixed-citation></ref><ref id="scirp.88915-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Mahajan, S. and Tuteja, N. (2005) Cold, Salinity and Drought Stresses: An Overview. Archives of Biochemistry and Biophysics, 444, 139-158.  
https://doi.org/10.1016/j.abb.2005.10.018</mixed-citation></ref><ref id="scirp.88915-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K. and Shinozaki, K. (1999) Improving Plant Drought, Salt, and Freezing Tolerance by Gene Transfer of a Single Stress-Inducible Transcription Factor. Nature Biotechnology, 17, 287-291.  
https://doi.org/10.1038/7036</mixed-citation></ref><ref id="scirp.88915-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Verma, D., Singla-Pareek, S.L., Rajagopal, D., Reddy, M.K. and Sopory, S.K. (2007) Functional Validation of a Novel Isoform of Na+/H+ Antiporter from Pennisetum glaucum for Enhancing Salinity Tolerance in Rice. Journal of Biosciences, 32, 621-628. https://doi.org/10.1007/s12038-007-0061-9</mixed-citation></ref><ref id="scirp.88915-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Joshee, N., Kisaka, H. and Kitagawa, Y. (1998) Isolation and Characterization of a Water Stress-Specific Genomic Gene, pwsi 18, from Rice. Plant and Cell Physiology, 39, 64-72. https://doi.org/10.1093/oxfordjournals.pcp.a029290</mixed-citation></ref><ref id="scirp.88915-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Nakashima, K., Jan, A., Todaka, D., Maruyama, K., Goto, S., Shinozaki, K. and Yamaguchi-Shinozaki, K. (2014) Comparative Functional Analysis of Six Drought-Responsive Promoters in Transgenic Rice. Planta, 239, 47-60.  
https://doi.org/10.1007/s00425-013-1960-7</mixed-citation></ref><ref id="scirp.88915-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Yi, N., Kim, Y.S., Jeong, M.H., Oh, S.J., Jeong, J.S., Park, S.H., Jung, H., Choi, Y.D. and Kim, J.K. (2010) Functional Analysis of Six Drought-Inducible Promoters in Transgenic Rice Plants throughout All Stages of Plant Growth. Planta, 232, 743-754.  
https://doi.org/10.1007/s00425-010-1212-z</mixed-citation></ref><ref id="scirp.88915-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Yi, N., Oh, S.J., Kim, Y.S., Jang, H.J., Park, S.H., Jeong, J.S., Song, S.I., Choi, Y.D. and Kim, J.K. (2011) Analysis of the Wsi18, a Stress-Inducible Promoter That Is Active in the Whole Grain of Transgenic Rice. Transgenic Research, 20, 153-163.  
https://doi.org/10.1007/s11248-010-9400-y</mixed-citation></ref><ref id="scirp.88915-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Xiao, F.H. and Xue, G.P. (2001) Analysis of the Promoter Activity of Late Embryogenesis Abundant Protein Genes in Barley Seedlings under Conditions of Water Deficit. Plant Cell Reports, 20, 667-673. https://doi.org/10.1007/s002990100384</mixed-citation></ref><ref id="scirp.88915-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Curtis, M.D. and Grossniklaus, U. (2003) A Gateway Cloning Vector Set for High-Throughput Functional Analysis of Genes in Planta. Plant Physiology, 133, 462-469. https://doi.org/10.1104/pp.103.027979</mixed-citation></ref><ref id="scirp.88915-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">International Brachypodium Initiative (2010) Genome Sequencing and Analysis of the Model Grass Brachypodium distachyon. Nature, 463, 763-768.  
https://doi.org/10.1038/nature08747</mixed-citation></ref><ref id="scirp.88915-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Hartley, J.L., Temple, G.F. and Brasch, M.A. (2000) DNA Cloning Using in Vitro Site-Specific Recombination. Genome Research, 10, 1788-1795.  
https://doi.org/10.1101/gr.143000</mixed-citation></ref><ref id="scirp.88915-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Alves, S.C., Worland, B., Thole, V., Snape, J.W., Bevan, M.W. and Vain, P. (2009) A Protocol for Agrobacterium-Mediated Transformation of Brachypodium distachyon Community Standard Line Bd21. Nature Protocols, 4, 638-649.  
https://doi.org/10.1038/nprot.2009.30</mixed-citation></ref><ref id="scirp.88915-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Smart, R.E. (1974) Rapid Estimates of Relative Water Content. Plant Physiology, 53, 258-260. https://doi.org/10.1104/pp.53.2.258</mixed-citation></ref><ref id="scirp.88915-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Hong, S.Y., Seo, P.J., Yang, M.S., Xiang, F. and Park, C.M. (2008) Exploring Valid Reference Genes for Gene Expression Studies in Brachypodium distachyon by Real-Time PCR. BMC Plant Biology, 8, 112.  
https://doi.org/10.1186/1471-2229-8-112</mixed-citation></ref><ref id="scirp.88915-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Jefferson, R.A., Kavanagh, T.A. and Bevan, M.W. (1987) GUS Fusions: Beta-Glucuronidase as a Sensitive. The EMBO Journal, 6, 3901-3907.  
https://doi.org/10.1002/j.1460-2075.1987.tb02730.x</mixed-citation></ref><ref id="scirp.88915-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Slama, I., Ghnaya, T., Messedi, D., Hessini, K., Labidi, N., Savoure, A. and Abdelly, C. (2007) Effect of Sodium Chloride on the Response of the Halophyte Species Sesuvium portulacastrum Grown in Mannitol-Induced Water Stress. Journal of Plant Research, 120, 291-299. https://doi.org/10.1007/s10265-006-0056-x</mixed-citation></ref><ref id="scirp.88915-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Karakas, B., Ozias-Akins, P., Stushnoff, C., Suefferheld, M. and Rieger, M. (1997) Salinity and Drought Tolerance of Mannitol-Accumulating Transgenic Tobacco. Plant, Cell &amp; Environment, 20, 609-616.  
https://doi.org/10.1111/j.1365-3040.1997.00132.x</mixed-citation></ref><ref id="scirp.88915-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Hameed, A. and Iqbal, N. (2014) Chemo-Priming with Mannose, Mannitol and H2O2 Mitigate Drought Stress in Wheat. Cereal Research Communications, 42, 450-462. https://doi.org/10.1556/CRC.2013.0066</mixed-citation></ref><ref id="scirp.88915-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Taher, L., McGaughey, D.M., Maragh, S., Aneas, I., Bessling, S.L., Miller, W., Ovcharenko, I., et al. (2011) Genome-Wide Identification of Conserved Regulatory Function in Diverged Sequences. Genome Research, 21, 1139-1149.  
https://doi.org/10.1101/gr.119016.110</mixed-citation></ref><ref id="scirp.88915-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Peach, C. and Velten, J. (1991) Transgene Expression Variability (Position Effect) of CAT and GUS Reporter Genes Driven by Linked Divergent T-DNA Promoters. Plant Molecular Biology, 17, 49-60. https://doi.org/10.1007/BF00036805</mixed-citation></ref><ref id="scirp.88915-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Meyer, P. and Saedler, H. (1996) Homology-Dependent Gene Silencing in Plants. Annual Review of Plant Physiology and Plant Molecular Biology, 47, 23-48.</mixed-citation></ref></ref-list></back></article>0"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Goodstein, D.M., Shu, S., Howson, R., Neupane, R., Hayes, R.D., Fazo, J., Rokhsar, D.S., et al. (2012) Phytozome: A Comparative Platform for Green Plant Genomics. Nucleic Acids Research, 40, 1178-1186. https://doi.org/10.1093/nar/gkr944</mixed-citation></ref><ref id="scirp.88915-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Goujon, M., McWilliam, H., Li, W., Valentin, F., Squizzato, S., Paern, J. and Lopez, R. (2010) A New Bioinformatics Analysis Tools Framework at EMBL-EBI. Nucleic Acids Research, 38, 695-699. https://doi.org/10.1093/nar/gkq313</mixed-citation></ref><ref id="scirp.88915-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., Higgins, D.G., et al. (2011) Fast, Scalable Generation of High-Quality Protein Multiple Sequence Alignments Using Clustal Omega. Molecular Systems Biology, 7, 539.  
https://doi.org/10.1038/msb.2011.75</mixed-citation></ref><ref id="scirp.88915-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">McWilliam, H., Li, W., Uludag, M., Squizzato, S., Park, Y. M., Buso, N., Lopez, R., et al. (2013) Analysis Tool Web Services from the EMBL-EBI. Nucleic Acids Research, 41, 597-600. https://doi.org/10.1093/nar/gkt376</mixed-citation></ref><ref id="scirp.88915-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Butaye, K.M.J., Cammue, B.P.A., Delauré, S.L. and De Bolle, M.F.C. (2005) Approaches to Minimize Variation of Transgene Expression in Plants. Molecular Breeding, 16, 79-91. https://doi.org/10.1007/s11032-005-4929-9</mixed-citation></ref></ref-list></back></article>