<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2018.912174</article-id><article-id pub-id-type="publisher-id">AJPS-88571</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Quantitative Screening of Secretory Protein Genes in &lt;i&gt;Candidatus&lt;/i&gt; Liberibacter Asiaticus
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Binbin</surname><given-names>Li</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yi</surname><given-names>Yang</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Zhiwen</surname><given-names>Luo</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Zhixin</surname><given-names>Liu</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Naitong</surname><given-names>Yu</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff3"><addr-line>Tropical Fruit Trees Institute, Hainan Academy of Agricultural Sciences, Haikou, China</addr-line></aff><aff id="aff4"><addr-line>Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou, China</addr-line></aff><aff id="aff2"><addr-line>Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou, China</addr-line></aff><aff id="aff1"><addr-line>Institute of Tropical Agriculture and Forestry, Hainan University, Haikou, China</addr-line></aff><pub-date pub-type="epub"><day>02</day><month>11</month><year>2018</year></pub-date><volume>09</volume><issue>12</issue><fpage>2408</fpage><lpage>2419</lpage><history><date date-type="received"><day>20,</day>	<month>October</month>	<year>2018</year></date><date date-type="rev-recd"><day>16,</day>	<month>November</month>	<year>2018</year>	</date><date date-type="accepted"><day>19,</day>	<month>November</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Huanglongbing (HLB) is the most destructive disease of citrus worldwide. The disease is caused by 
  &lt;i&gt;
  Candidatus
  &lt;/i&gt;
   Liberibacter spp., which is vectored by the psyllids 
  &lt;i&gt;
  Diaphorina citri
  &lt;/i&gt;
   Kuwayama and 
  &lt;i&gt;
  Trioza erytreae
  &lt;/i&gt;
  . Secretory proteins are important in bacterial pathogenesis and structure components. Some of them are expressed at a high level. To obtain the highly-expressed secretory protein genes (SPGs) for antiserum preparation, six candidate SPGs were chosen from 
  &lt;i&gt;
  Candidatus
  &lt;/i&gt;
   Liberibacter asiaticus by bioinformatic analysis and were further tested by qPCR and RT-qPCR methods, respectively. The result showed that two SPGs, 408 and 
  &lt;i&gt;
  pap
  &lt;/i&gt;
   (both are Flp pilus assembly protein genes), have relative high amounts of DNA and RNA transcripts of early HLB-infected green orange leaves. The 408 and 
  &lt;i&gt;
  pap
  &lt;/i&gt;
   genes were further constructed into the plant expression vector pCAMBIA1300 (GV1300: GFP) and expressed in tobacco leaf epidermal cells for subcellular localization analysis. The transient expression results indicated that the 408 protein is located in the nuclei and cytoplasm of tobacco leaf cells. However, the pap protein is located in the cytoplasm of tobacco leaf cells, which may help the pathogen invade into plant cells. This research is an important foundation for the preparation of the antiserum against 
  &lt;i&gt;
  Candidatus
  &lt;/i&gt;
   Liberibacter asiaticus and the early detection of HLB disease.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Candidatus&lt;/i&gt; Liberibacter Asiaticus</kwd><kwd> Secretory Protein</kwd><kwd> DNA Amount</kwd><kwd> RNA Transcription</kwd><kwd> Subcellular Localization</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Citrus Huanglongbing (HLB), or greening disease, is a devastating disease that seriously threatens the development of the citrus industry globally [<xref ref-type="bibr" rid="scirp.88571-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref3">3</xref>] . Currently, the disease has been found in about 50 countries in the Asia, Africa, Oceania, South America, and North America regions. In China, 11 of the 19 major citrus-producing areas suffer from the HLB disease [<xref ref-type="bibr" rid="scirp.88571-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref6">6</xref>] . Citrus Huanglongbing is caused by the pathogen of Candidatus Liberibacter asiaticus, africanus, and americanus, a gram-negative bacterium, which belongs to the genus Candidatus Liberibacter [<xref ref-type="bibr" rid="scirp.88571-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref8">8</xref>] . There are no effective therapeutic agents or ideal resistant varieties for now. Integrated control management of HLB occurs mainly through controlling psyllids in field areas, removing HLB-infected trees, and planting healthy nursery trees. Of these three steps, the effective removal of infected trees depends on an accurate diagnosis of HLB at the early infection stage [<xref ref-type="bibr" rid="scirp.88571-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref10">10</xref>] .</p><p>The content of Candidatus Liberibacter asiaticus is low from the infected trees and unevenly distributed in different parts of diseased plants [<xref ref-type="bibr" rid="scirp.88571-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref12">12</xref>] . Therefore, establishment of an efficient and sensitive detection method for diagnosis of HLB at the early infection stage is a key factor for healthy development of the citrus industry. In recent years, with the fast development of the green orange industry in Hainan Province of China, the citrus Huanglongbing also spread rapidly [<xref ref-type="bibr" rid="scirp.88571-ref13">13</xref>] . At present, a rapid and large-scale field detection method for the pathogen mainly depends on protein technology, e.g., enzyme-linked immunosorbent assay (ELISA) [<xref ref-type="bibr" rid="scirp.88571-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref16">16</xref>] . However, a commercial large-scale detection method based on the protein level for HLB disease is yet to be developed.</p><p>There are six types of protein secretion system (types I-VI) in gram-negative bacteria [<xref ref-type="bibr" rid="scirp.88571-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref18">18</xref>] . Each type of protein secretion system consists of a series of proteins with specific structures and functions. Through these protein secretion systems, gram-negative bacteria can release various toxic factors and effector factors to the extracellular environment or into the host cell to cause infection, which eventually leads to various diseases [<xref ref-type="bibr" rid="scirp.88571-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref19">19</xref>] . Therefore, it is an ideal gene for the preparation of the antiserum against the Candidatus Liberibacter asiaticus because the content of secreted protein is at least thousands times higher than the number of its pathogen. Studies have shown that the pathogen of Candidatus Liberibacter asiaticus has an incomplete type III and type IV protein secretion systems but has a complete type I protein secretion system [<xref ref-type="bibr" rid="scirp.88571-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref21">21</xref>] .</p><p>In this study, six candidate secretory protein genes (SPGs) from Candidatus Liberibacter asiaticus were chosen by bioinformatics analysis and two SPGs of 408 and pap with relatively high DNA and RNA contents were identified by qPCR and RT-qPCR methods. Furthermore, the 408 protein was located in the nuclei and cytoplasm of tobacco cells, while the pap protein was localized in the cytoplasm of tobacco leaf cells by Agrobacterium-mediated transformation in tobacco leaf cells for transient expression. The study is an important foundation for the preparation of the antiserum against Candidatus Liberibacter asiaticus for the early detection and prevention of citrus HLB.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Materials</title><p>In 2016, the QH sample was mixed from five early HLB-infected green orange leaves with asymptomatic in Qionghai County, Hainan Province, and the QZ sample was mixed from another five early HLB-infected green orange leaves with asymptomatic in Qiongzhong County, Hainan Province. Both pathogens of QH and QZ were identical with the Candidatus Liberibacter asiaticus psy62 isolate (GenBank accession number: CP001677.5) [<xref ref-type="bibr" rid="scirp.88571-ref22">22</xref>] . Wild-type Nicotiana benthamiana (N. benthamiana) (Ferox genus) was kept in the Laboratory of Molecular Virology, Institute of Tropical Bioscience and Biotechnology (ITBB), Chinese Academy of Tropical Agricultural Sciences (CATAS). The GV1300 plasmid (pCAMBIA1300: GFP) was provided by Professor Ming Peng of ITBB, CATAS.</p></sec><sec id="s2_2"><title>2.2. Primers Design, DNA, and cDNA Preparation</title><p>In order to identify one or two high-expression SPGs, six SPGs were chosen from the different protein secretory systems according to the complete genome sequence of Candidatus Liberibacter asiaticus [<xref ref-type="bibr" rid="scirp.88571-ref22">22</xref>] (<xref ref-type="table" rid="table1">Table 1</xref>). Based on the nucleotide sequences of these SPGs, 6 primer-pairs of the 408, 24A, fATP, pap, msp, and 377 genes were designed for qPCR or RT-qPCR using the online website (https://www.idtdna.com/Scitools/Applications/RealTimePCR/) (<xref ref-type="table" rid="table2">Table 2</xref>). 18S rRNA of citrus was used as an internal reference gene [<xref ref-type="bibr" rid="scirp.88571-ref23">23</xref>] (<xref ref-type="table" rid="table2">Table 2</xref>). All primers were synthesized by the Beijing Genomics Institute (BGI).</p><p>Total DNA extraction of the QH and QZ samples was performed according to the manufacturer’s instructions with a Plant Genomic DNA Kit (TIANGEN BIOTECH, Beijing, China) and total RNA extraction was performed according to the Trizol Universal Regent (TIANGEN BIOTECH, Beijing, China). First-strand cDNA was synthesized from 2.0 μL of total RNA using 0.5 μL of random hexamer primer (10 μM) and the Fast Quant RT Kit (with gDNase) (TIANGEN BIOTECH, Beijing, China).</p></sec><sec id="s2_3"><title>2.3. Screening of Candidate SPGs and Establishment of Real-Time Quantitative PCR (qPCR)</title><p>In order to measure the efficiency and correlation coefficients of six SPG primer pairs in qPCR, the initial amplified DNA template was further diluted to 1:10<sup>−1</sup>, 1:10<sup>−2</sup>, 1:10<sup>−3</sup>, 1:10<sup>−4</sup>, and 1:10<sup>−5</sup> by ddH<sub>2</sub>O, and these samples were used to establish the standard curves by each pair primer in the Stratagene Mx3005 machine. The results showed that six qPCR reactions by the specific primer pairs amplified SPGs highly efficiently (efficiencies of 86.8% to 92.2%) with correlation coefficients between 0.981 and 0.999.</p><p>In order to measure the relative DNA amounts and their RNA expression levels of six SPGs, qPCR and RT-qPCR analyses were performed on an Agilent Stratagen Mx3005P instrument using the Hieff<sup>TM</sup> qPCR SYBR Green Master Mix with Low Rox Plus (Yeasan, Shanghai, China) according to the instructions, and</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Characteristic summary of six candidate secretory protein genes from Candidatus liberibacter asiaticus</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Protein</th><th align="center" valign="middle" >Region name</th><th align="center" valign="middle" >Protein ID</th><th align="center" valign="middle" >Protein function</th><th align="center" valign="middle" >Type of protein</th></tr></thead><tr><td align="center" valign="middle" >408</td><td align="center" valign="middle" >T2SS-T3SS pilN</td><td align="center" valign="middle" >ACT57211.2</td><td align="center" valign="middle" >Flp pilus assembly protein, secretin CpaC</td><td align="center" valign="middle" >Secreted protein</td></tr><tr><td align="center" valign="middle" >24A</td><td align="center" valign="middle" >Peptidase A24</td><td align="center" valign="middle" >ACT57202.1</td><td align="center" valign="middle" >Type II secretory pathway, prepilin signal peptidase PulO and related peptidases</td><td align="center" valign="middle" >Type II secretory pathway</td></tr><tr><td align="center" valign="middle" >pap</td><td align="center" valign="middle" >CpaC</td><td align="center" valign="middle" >ACT57200.1</td><td align="center" valign="middle" >Flp pilus assembly protein, secretin CpaC</td><td align="center" valign="middle" >Secreted protein</td></tr><tr><td align="center" valign="middle" >msp</td><td align="center" valign="middle" >FliN</td><td align="center" valign="middle" >ACT57161.1</td><td align="center" valign="middle" >Flagellar motor switch/Predicted secreted (periplasmic) protein</td><td align="center" valign="middle" >Secreted protein</td></tr><tr><td align="center" valign="middle" >fATP</td><td align="center" valign="middle" >fliI</td><td align="center" valign="middle" >ACT57157.1</td><td align="center" valign="middle" >Flagellar biosynthesis/type III secretory pathway ATPase</td><td align="center" valign="middle" >Type III secretory pathway</td></tr><tr><td align="center" valign="middle" >377</td><td align="center" valign="middle" >COG5462</td><td align="center" valign="middle" >ACT57577.1</td><td align="center" valign="middle" >Predicted secreted (periplasmic) protein</td><td align="center" valign="middle" >Secreted protein</td></tr></tbody></table></table-wrap><p>The database sources: NCBI Reference Sequence database (http://www.ncbi.nlm.nih.gov).</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene</th><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Primer sequences (5’-3’)</th><th align="center" valign="middle" >Length (bp)</th><th align="center" valign="middle" ></th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >408</td><td align="center" valign="middle" >408-F</td><td align="center" valign="middle" >CTGTACTCCAAGATGCCTACC</td><td align="center" valign="middle"  rowspan="2"  >131</td><td align="center" valign="middle"  rowspan="14"  >Real-time PCR assay</td></tr><tr><td align="center" valign="middle" >408-R</td><td align="center" valign="middle" >CGTGCCTATCATGCTTGTTTC</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >PAP</td><td align="center" valign="middle" >PAP-F</td><td align="center" valign="middle" >AGCCAGTAATCGGAGTCAATG</td><td align="center" valign="middle"  rowspan="2"  >119</td></tr><tr><td align="center" valign="middle" >PAP-R</td><td align="center" valign="middle" >TCATCTTTCAATAACCCCGCC</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >MSP</td><td align="center" valign="middle" >MSP-F</td><td align="center" valign="middle" >AGACATGTGCCATTTTAAGTGC</td><td align="center" valign="middle"  rowspan="2"  >96</td></tr><tr><td align="center" valign="middle" >MSP-R</td><td align="center" valign="middle" >TCTATCTGTTATGCGAATCGTGT</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >377</td><td align="center" valign="middle" >377-F</td><td align="center" valign="middle" >CCAAGAGAACTGTAGAAAGGCG</td><td align="center" valign="middle"  rowspan="2"  >147</td></tr><tr><td align="center" valign="middle" >377-R</td><td align="center" valign="middle" >AGAAGTATAACCTCCCCACTCG</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >24A</td><td align="center" valign="middle" >24A-F</td><td align="center" valign="middle" >GGGTGGAGGGGATGTAAAATT</td><td align="center" valign="middle"  rowspan="2"  >113</td></tr><tr><td align="center" valign="middle" >24A-R</td><td align="center" valign="middle" >GACAGATAATATTCCGCCTAAAATAGC</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >fATP</td><td align="center" valign="middle" >fATP-F</td><td align="center" valign="middle" >ATAGCGGATTCTGTTCGTAGC</td><td align="center" valign="middle"  rowspan="2"  >136</td></tr><tr><td align="center" valign="middle" >fATP-R</td><td align="center" valign="middle" >ATCAGCACTCCAAGCCTTATC</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >18S rRNA</td><td align="center" valign="middle" >18S rRNA-F</td><td align="center" valign="middle" >TCGGGTGTTTTCACGTCTCA</td><td align="center" valign="middle"  rowspan="2"  >120</td></tr><tr><td align="center" valign="middle" >18S rRNA-R</td><td align="center" valign="middle" >TGGATGCCGCTGGGAAGC</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >408</td><td align="center" valign="middle" >408-gF</td><td align="center" valign="middle" >CGCGTCGACTTGCATCGTAAGCGCC (Sal I)</td><td align="center" valign="middle"  rowspan="2"  >423</td><td align="center" valign="middle"  rowspan="4"  >Recombinant plasmids construction</td></tr><tr><td align="center" valign="middle" >408-gR</td><td align="center" valign="middle" >CGCACTAGTCCTGACGGGAGGAGAGGAG (Spe I)</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >pap</td><td align="center" valign="middle" >pap-gF</td><td align="center" valign="middle" >CGCGTCGACATGAGGTATTTGCAACGCAC (Sal I)</td><td align="center" valign="middle"  rowspan="2"  >1440</td></tr><tr><td align="center" valign="middle" >pap-gR</td><td align="center" valign="middle" >CGCGGATCCTTTATAAATAAAACCAATTGCACC (BamH I)</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >GV1300</td><td align="center" valign="middle" >1300-F</td><td align="center" valign="middle" >AACTTGTGGCCGTTTACGTCG</td><td align="center" valign="middle"  rowspan="2"  >207</td><td align="center" valign="middle"  rowspan="2"  >Primers for GV1300</td></tr><tr><td align="center" valign="middle" >1300-R</td><td align="center" valign="middle" >TTTGGAGAGAACACGGGGGAC</td></tr></tbody></table></table-wrap><p>Note: The bold sequences represent the restriction enzymes.</p><p>each gene was measured three times independently. The total DNA from healthy green orange leaves was used as a negative control. The qPCR or RT-qPCR mixture was 10 μL of Hieff<sup>TM</sup> qPCR SYBR Green Master Mix, 0.4 μL of forward primer (10 μM), 0.4 μL of reverse primer (10 μM), 1 μL of template DNA or cDNA, and 8.2 μL of ddH<sub>2</sub>O. The qPCR and RT-qPCR programs involved pre-denaturing at 95˚C for 5 min, followed by 40 cycles of denaturing at 95˚C for 10 s, annealing at 55˚C for 30 s, extending at 72˚C for 20 s, and a dissolution curves program using the Agilent Strata Mx3005P instrument.</p></sec><sec id="s2_4"><title>2.4. Plasmid Construction and Subcellular Localization of 408 and Pap Proteins</title><p>The 408 gene was amplified with the 408-gF/408-gR primers, while the pap gene was amplified by using the pap-gF/pap-gR primers (<xref ref-type="table" rid="table2">Table 2</xref>). The PCR reaction was conducted using PrimeSTAR HS DNA Polymerase kit (Takara, Dalian, China): 0.5 μL of PrimeSTAR HS DNA Polymerase (2.5 U/μL), 10 μL of 5 &#215; PrimeSTAR Buffer (Mg<sup>2+</sup> plus), 4 μL of dNTP Mixture (2.5 mM each), 2 μL of F/R (5 μM) primer, and 2 μL of total DNA, and ddH<sub>2</sub>O was added up to 50 μL. The PCR program involved pre-denaturing at 98˚C for 3 min, followed by 35 cycles of denaturing at 98˚C for 30 s, annealing at 55˚C for 30 s, extending at 72˚C for 50 s; and finally, the reaction was terminated by post-extending at 72˚C for 10 min. The amplified target fragments of 408 and pap were gel-extracted by using the DNA Gel Extraction Kit (Omega Bio-Tek, Doraville, GA, USA) and subsequently, cloned into the plant expression vector GV1300 using T4 DNA ligase (Takara, Dalian, China). The recombinant plasmid was further transformed into Escherichia coli (E. coli) Trans 5a competent cells (TransGen, Beijing, China), and three positive clones were selected for bidirectional sequencing by 1300-F and 1300-R primers at Thermo Fisher (Guangzhou, China).</p><p>The recombinant plasmids of GV1300, GV1300-408, and GV1300-pap were transformed into Agrobacterium tumefaciens GV3101 competent cells by the freeze-thaw method, as described in Sparkes and Al [<xref ref-type="bibr" rid="scirp.88571-ref24">24</xref>] . The transfected tobacco leaves were cut into pieces of 1 cm &#215; 1 cm, and fluorescence images were visualized on a microscope (FluoView FV1000D IX81; Olympus, Tokyo, Japan) to observe the subcellular localization of the fusion protein under wavelengths of 488 nm and 546 nm.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Preparation of Total DNA and cDNA from Diseased Green Orange Leaves</title><p>Total DNA extracted from two mixed samples were visualized on a 1% agarose gel, and the specific DNA bands of more than 10 kbp in lengths were consistent with the predicted sizes (data not shown). Total RNA samples were also extracted from these two samples and were visualized on a 1% agarose gel (data not shown). The results indicated that the RNA bands of 28S, 18S, and 5S were abundant which suggests that a high quality of total RNA was obtained. The total RNA was further used to synthesize the first strand cDNA (1<sup>st</sup> cDNA) which subsequently could be used for RT-qPCR.</p></sec><sec id="s3_2"><title>3.2. Screening of Candidate SPGs from HLB-Infected Green Orange Leaves</title><p>Analysis of the real-time qPCR showed that the amplification plot of six SPGs and the internal reference gene shown in the dissociation curve of QH sample (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)), similar result was observed in QZ sample. Further analysis indicated that the DNA contents of the 408 and pap genes were 26.48 and 9.36 times that of the 377 gene, while the other genes were 2.17 - 4.11 times that of the</p><p>377 gene in the QH sample (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). In the QZ sample, the DNA contents of the 408 and pap genes were 15.20 and 8.35 times that of the 377 gene, while the DNA content of the 24A gene was also relatively high, about 9.22 times that of the 377 gene (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). In summary, the relative DNA contents of the 408, pap, and 24A genes were relatively high in QH and QZ samples.</p><p>The results from the RT-qPCR quantification did not match the DNA amount shown in the qPCR reactions. Of these six SPGs, only the 408 and pap genes had amplification curves, and the Ct value was between 15 and 35. Other genes did not have an obvious amplification curve, or their Ct value was more than 35 which should be insignificant (Very low amount or unspecific amplification). Further analysis revealed that the relative transcription level of the 408 gene was 2.43 higher than the transcription level of the pap gene in QH sample. In the QZ sample, the relative transcription level of the 408 gene was 9.45 higher than the transcription level of pap gene, and the relative transcript RNA level was much higher than that of the 408 gene in the QH sample (<xref ref-type="fig" rid="fig2">Figure 2</xref>). In this study, two relatively high transcription levels of SPGs were screened from the ten candidate SPGs.</p></sec><sec id="s3_3"><title>3.3. Subcellular Localization of 408 and Pap Proteins</title><p>In order to further clarify the distribution of the 408 and pap proteins in the host cells, the recombinant plasmids of GV1300-408 and GV1300-pap were transformed into Agrobacterium tumefaciens GV1301 competent cells. Then, the positive clones were identified by colony PCR (Single colony was used as template), as described above. After injection of GV1300-408/GV1301 and GV1300-pap/GV1301 into the tobacco leaves, fluorescence images were visualized</p><p>by microscopy at 72 hours post inoculation (h.p.i.). The green fluorescence signal from the 408-GFP fusion protein was observed in the nuclei and cytoplasm of tobacco leaf cells, while the green fluorescence signal of the pap-GFP fusion protein was observed in the cytoplasm of tobacco leaf cells. These results indicate that the 408 protein localizes in the nucleus and cytoplasm tobacco mesophyll cells, but the pap protein localizes in the cytoplasm of tobacco leaf cells. In addition, the GFP protein is localized in the cytoplasm and the nuclei of tobacco mesophyll cells (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Bacteria-secreted proteins play important roles in pathogenicity and infection in host cells [<xref ref-type="bibr" rid="scirp.88571-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref26">26</xref>] . Briefly, pathogenic bacteria have a number of different protein secretion systems and secrete virulence factors extracellularly or directly to the host via these secretion systems. Currently, it is known that there are at least</p><p>six protein secretion systems in Gram-negative bacteria [<xref ref-type="bibr" rid="scirp.88571-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref18">18</xref>] . Candidatus Liberibacter asiaticus has incomplete type III and type IV protein secretion systems and a complete type I protein secretion system. In this study, the obtained 408 gene was secreted by the type III secretion system, while the pap gene was secreted by the type IV secretion system [<xref ref-type="bibr" rid="scirp.88571-ref22">22</xref>] . The Flp pilus, which is assembled by the proteins encoded by the flp (fimbrial low-molecular-weight protein), may play an important role in bacterial adherence. Here, both of 408 and pap proteins are flp pilus assembly proteins. Pili, flagella, and other adhesive structures usually assemble at the cell surface of gram-negative bacteria. The ability of diverse bacteria to adhere to host cell surfaces is an important property and a critical step in colonization [<xref ref-type="bibr" rid="scirp.88571-ref27">27</xref>] . Therefore, 408 and pap may be involved in these adhesive organelle assemblies via the extracellular nucleation-precipitation pathway [<xref ref-type="bibr" rid="scirp.88571-ref28">28</xref>] . Furthermore, subcellular localization analyses indicated that the 408 protein is located in the nuclei and cytoplasm of tobacco leaf cells. This suggests that the 408 gene may have other functions besides the formation of flagella on the bacterial surface. However, the pap protein was shown to be located in the cytoplasm of tobacco leaf cells and may interact with host cells to help pathogens invade into plant cells.</p><p>At present, the effective detection methods of pathogen microscopy, loop-mediated isothermal amplification (LAMP), PCR and real-time quantitative PCR were available for HLB diagnosis [<xref ref-type="bibr" rid="scirp.88571-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref30">30</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref31">31</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref32">32</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref33">33</xref>] . However, a protein detection technology for citrus Huanglongbing with convenience and high sensitivity at a large-scale needs to be developed. Although Yuan et al. and Liu et al. reported monoclonal antibodies against Candidatus Liberibacter asiaticus [<xref ref-type="bibr" rid="scirp.88571-ref34">34</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref35">35</xref>] [<xref ref-type="bibr" rid="scirp.88571-ref36">36</xref>] , there are no commercial products available yet. In order to prepare an antiserum against the Candidatus Liberibacter asiaticus for the early detection and prevention of citrus HLB, six SPGs were selected from different protein secretion systems of Candidatus Liberibacter asiaticus and tested by qPCR and RT-qPCR, and two SPGs of 408 and pap with relatively high DNA contents and their transcription level were identified. This provides an important scientific basis for the preparation of an antiserum against Candidatus Liberibacter asiaticus and the early detection and prevention of citrus HLB.</p></sec><sec id="s5"><title>Acknowledgements</title><p>This work was supported by the Major Science and Technology Program of Hainan Province (grant number ZDKJ2017003), the Young Elite Scientists Sponsorship Program by CSTC (project no. CSTC-QN201704), and the Key Laboratory of Tropical Fruit Tree Biology of Hainan Province (grant number KFZX2017002).</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s7"><title>Cite this paper</title><p>Li, B.B., Yang, Y., Luo, Z.W., Liu, Z.X. and Yu, N.T. (2018) Quantitative Screening of Secretory Protein Genes in Candidatus Liberibacter Asiaticus. American Journal of Plant Sciences, 9, 2408-2419. https://doi.org/10.4236/ajps.2018.912174</p></sec></body><back><ref-list><title>References</title><ref id="scirp.88571-ref1"><label>1</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Bové</surname><given-names> J.M. </given-names></name>,<etal>et al</etal>. (<year>2006</year>)<article-title>Huanglongbing: A Destructive, Newly-Emerging, Century-Old Disease of Citrus</article-title><source> Journal of Plant Pathology</source><volume> 88</volume>,<fpage> 7</fpage>-<lpage>37</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.88571-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Gottwald, T.R. (2010) Current Epidemiological Understanding of Citrus Huanglongbing. Annual Review of Phytopathology, 48, 119-139. https://doi.org/10.1146/annurev-phyto-073009-114418</mixed-citation></ref><ref id="scirp.88571-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Arratia-Castro, A.A., Santos-Cervantes, M.E., Arce-Leal, á.P., Espinoza-Mancillas, M.G., Rodríguez Negrete, E.A., Méndez-Lozano, J., Arocha-Rosete, Y. and Leyva-López, N.E. (2016) Detection and Quantification of ‘Candidatus Phytoplasma asteris' and ‘Candidatus Liberibacter Asiaticus' at Early and Late Stages of Huanglongbing Disease Development. Canadian Journal of Plant Pathology, 38, 411-421. https://doi.org/10.1080/07060661.2016.1243586</mixed-citation></ref><ref id="scirp.88571-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Fan, G.C., Bo, L., Ru-Jian, W.U., Tao, L.I., Cai, Z.J. and Chong, K.E. (2009) Thirty Years of Research on Citrus Huanglongbing in China. Fujian Journal of Agricultural Sciences, 24,183-190.</mixed-citation></ref><ref id="scirp.88571-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Bai, Z.Q. (2012) Occurrence Dynamics of Citrus Huanglongbing in P.R. China and Population Differentitation of ‘Candidatus Liberibacter Asiaticus’. Master Dissertation, Southwest University, Chongqing.</mixed-citation></ref><ref id="scirp.88571-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Da, G.J., Douhan, G.W., Halbert, S.E., Keremane, M.L., Lee, R.F., Vidalakis, G. and Zhao, H. (2016) Huanglongbing: An Overview of a Complex Pathosystem Ravaging the World’s Citrus. Journal of Integrative Plant Biology, 58, 373-387. https://doi.org/10.1111/jipb.12437</mixed-citation></ref><ref id="scirp.88571-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Villechanoux, S., Garnier, M., Renaudin, J. and Bové, M. (1992) Detection of Several Strains of the Bacterium-Like Organism of Citrus Greening Disease by DNA Probes. Current Microbiology, 24, 89-95. https://doi.org/10.1007/BF01570903</mixed-citation></ref><ref id="scirp.88571-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Gottwald, T.R., Graa, J.V.D. and Bassanezi, R.B. (2007) Citrus Huanglongbing: The Pathogen and Its Impact. Plant Health Progress, 1, 0906-0901. https://doi.org/10.1094/PHP-2007-0906-01-RV</mixed-citation></ref><ref id="scirp.88571-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Iftikhar, Y., Rauf, S., Shahzad, U. and Zahid, M.A. (2016) Huanglongbing: Pathogen Detection System for Integrated Disease Management—A Review. Journal of the Saudi Society of Agricultural Sciences, 15, 1-11. https://doi.org/10.1016/j.jssas.2014.04.006</mixed-citation></ref><ref id="scirp.88571-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Munir, S., He, P., Wu, Y., He, P., Khan, S., Huang, M., Cui, W., He, P. and He, Y. (2018) Huanglongbing Control: Perhaps the End of the Beginning. Microbial Ecology, 76, 192-204. https://doi.org/10.1007/s00248-017-1123-7</mixed-citation></ref><ref id="scirp.88571-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Li, W., Laurene, L. and Johns, H. (2009) Quantitative Distribution of ‘Candidatus Liberibacter Asiaticus’ in Citrus Plants with Citrus Huanglongbin. Phytopathology, 99, 139-144. https://doi.org/10.1094/PHYTO-99-2-0139</mixed-citation></ref><ref id="scirp.88571-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Lu, L., Fan, G., Hu, X., Zhang, L., Huang, Z. and Chen, G. (2011) PCR Detection of Huanglongbing Pathogen in Different Parts of Citrus Plants in the Field and Analysis of the Cause of the Disease. Plant Protection, 23, 271-312.</mixed-citation></ref><ref id="scirp.88571-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Wu, X., Meng, C., Wang, G., Liu, Y., Zhang, X., Yi, K. and Peng, J. (2016) Rapid and Quantitative Detection of Citrus Huanglongbing Bacterium ‘Candidatus Liberibacter Asiaticus’ by Real-Time Fluorescent Loop-Mediated Isothermal Amplification Assay in China. Physiological &amp; Molecular Plant Pathology, 94, 1-7. https://doi.org/10.1016/j.pmpp.2016.03.001</mixed-citation></ref><ref id="scirp.88571-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Vetten, H.J., Ehlers, U. and Paul, H.L. (2010) Detection of Potato Viruses Y and A in Tubers by Enzyme-Linked Immunosorbent Assay after Natural and Artificial Break of Dormancy. Journal of Phytopathology, 108, 41-53. https://doi.org/10.1111/j.1439-0434.1983.tb00562.x</mixed-citation></ref><ref id="scirp.88571-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Selvarajan, R., Balasubramanian, V. and Gayathrie, T. (2016) Highly Efficient Immunodiagnosis of Episomal Banana Streak MY Virus Using Polyclonal Antibodies Raised against Recombinant Viral-Associated Protein. Journal of Phytopathology, 164, 497-508. https://doi.org/10.1111/jph.12475</mixed-citation></ref><ref id="scirp.88571-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Webster, C.G., Turechek, W.W., Li, W., Kousik, C.S. and Adkins, S. (2016) Development and Evaluation of ELISA and qRT-PCR for Identification of Squash Vein Yellowing Virus in Cucurbits. Plant Disease, 101, 178-185. https://doi.org/10.1094/PDIS-06-16-0872-RE</mixed-citation></ref><ref id="scirp.88571-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Costa, T.R., Felisberto-Rodrigues, C., Meir, A., Prevost, M.S., Redzej, A., Trokter, M. and Waksman, G. (2015) Secretion Systems in Gram-Negative Bacteria: Structural and Mechanistic Insights. Nature Reviews Microbiology, 13, 343-359. https://doi.org/10.1038/nrmicro3456</mixed-citation></ref><ref id="scirp.88571-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Yu, L.Z., Liu, F.J., Yan, N.N., Cheng, X., Li, Y.Z. and Guo, Y.Z. (2017) Progress on Secretion Systems and Secretory Products of Gram-Negative Bacteria. Progress in Veterinary Medicine, 38, 80-84.</mixed-citation></ref><ref id="scirp.88571-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Clark, K., Franco, J.Y., Schwizer, S., Pang, Z., Hawara, E., Liebrand, T.W.H., Pagliaccia, D., Zeng, L., Gurung, F.B., Wang, P., Shi, J., Wang, Y., Ancona, V., van der Hoorn, R.A.L., Wang, N., Coaker, G. and Ma, W. (2018) An Effector from the Huanglongbing-Associated Pathogen Targets Citrus Proteases. Nature Communications, 9, 1718. https://doi.org/10.1038/s41467-018-04140-9</mixed-citation></ref><ref id="scirp.88571-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Hao, J. (2011) Construction Expression and Purification Research of Citrus Huanglongbing Serralysin Protein. Master Dissertation, Huazhong Agricultural University, Wuhan.</mixed-citation></ref><ref id="scirp.88571-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Hou, W.Z. (2014) Expression and Purification of Citrus Huanglongbing Serralysin and Molecular Detection of Two Important Pathogens. Master Dissertation, Huazhong Agricultural University, Wuhan.</mixed-citation></ref><ref id="scirp.88571-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Duan, Y.P., Zhou, L.J., Hall, D.G., Li, W.B., Doddapaneni, H., Lin, H., Liu, L., Vahling, C.M., Gabriel, D.W. and Williams, K.P. (2009) Complete Genome Sequence of Citrus Huanglongbing Bacterium, “Candidatus Liberibacter Asiaticus” Obtained through Metagenomics. Molecular Plant-Microbe Interactions, 22, 1011-1020. https://doi.org/10.1094/MPMI-22-8-1011</mixed-citation></ref><ref id="scirp.88571-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Yan, J., Yuan, F., Long, G., Qin, L. and Deng, Z. (2012) Selection of Reference Genes for Quantitative Real-Time RT-PCR Analysis in Citrus. Molecular Biology Reports, 39, 1831-1838. https://doi.org/10.1007/s11033-011-0925-9</mixed-citation></ref><ref id="scirp.88571-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Sparkes, I.A. and Al, E. (2006) Rapid, Transient Expression of Fluorescent Fusion Proteins in Tobacco Plants and Generation of Stably Transformed Plants. Nature Protocols, 1, 2019-2025. https://doi.org/10.1038/nprot.2006.286</mixed-citation></ref><ref id="scirp.88571-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Barny, M.A., Gaudriault, S., Brisset, M.N. and Paulin, J.P. (1999) HRP Secreted Proteins: Their Role in Pathogenicity and HR Elicitation. Acta Horticulturae, 489, 353-358. https://doi.org/10.17660/ActaHortic.1999.489.62</mixed-citation></ref><ref id="scirp.88571-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Abby, S.S. and Rocha, E.P.C. (2016) Identification of Protein Secretion Systems in Bacterial Genomes Using MacSyFinder. Methods in Molecular Biology, 1615, 1-21.</mixed-citation></ref><ref id="scirp.88571-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Li, T., Xu, Z., Zhang, T., Li, L., Chen, H. and Zhou, R. (2012) The Genetic Analysis of the Flp Locus of Actinobacillus pleuropneumoniae. Archives of Microbiology, 194, 167-176. https://doi.org/10.1007/s00203-011-0741-6</mixed-citation></ref><ref id="scirp.88571-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Zav’Yalov, V., Zavialov, A., Zav’Yalova, G. and Korpela, T. (2010) Adhesive Organelles of Gram-Negative Pathogens Assembled with the Classical Chaperone/Usher Machinery: Structure and Function from a Clinical Standpoint. FEMS Microbiology Reviews, 34, 317-378. https://doi.org/10.1111/j.1574-6976.2009.00201.x</mixed-citation></ref><ref id="scirp.88571-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Okuda, M., Matsumoto, M., Tanaka, Y., Subandiyah, S. and Iwanami, T. (2005) Characterization of the tufB-secE-nusG-rplKAJL-rpoB Gene Cluster of the Citrus Greening Organism and Detection by Loop-Mediated Isothermal Amplification. Plant Disease, 89, 705-711. https://doi.org/10.1094/PD-89-0705</mixed-citation></ref><ref id="scirp.88571-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Li, W., Hartung, J.S. and Levy, L. (2006) Quantitative Real-Time PCR for Detection and Identification of Candidatus Liberibacter Species Associated with Citrus Huanglongbing. Journal of Microbiological Methods, 66, 104-115. https://doi.org/10.1016/j.mimet.2005.10.018</mixed-citation></ref><ref id="scirp.88571-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Tanaka, F.A.O., Coletta-Filho, H.D., Alves, K.C.S., Spinelli, M.O., Machado, M.A. and Kitajima, E.W. (2007) Detection of the “Candidatus Liberibacter Americanus” in Phloem Vessels of Experimentally Infected Cataranthus Roseus by Scanning Electron Microscopy Detec&amp;atilde;o de Candidatus Liberibacter americanus em vasos de floema de Catharantus roseus infectados exper. Tropical Plant Pathology, 32, 519-519.</mixed-citation></ref><ref id="scirp.88571-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Fujikawa, T., Miyata, S. and Iwanami, T. (2013) Convenient Detection of the Citrus Greening (Huanglongbing) Bacterium “Candidatus Liberibacter Asiaticus” by Direct PCR from the Midrib Extract. PLoS ONE, 8, e57011. https://doi.org/10.1371/journal.pone.0057011</mixed-citation></ref><ref id="scirp.88571-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Fang, D., Paul, C., Brlansky, R. and Hartung, J.S. (2017) Immune Tissue Print and Immune Capture-PCR for Diagnosis and Detection of Candidatus Liberibacter Asiaticus. Scientific Reports, 7, Article No. 46467. https://doi.org/10.1038/srep46467</mixed-citation></ref><ref id="scirp.88571-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Yuan, Q., Jordan, R., Brlansky, R.H., Minenkova, O. and Hartung, J. (2016) Development of Single Chain Variable Fragment (scFv) Antibodies against Surface Proteins of “Ca. Liberibacter Asiaticus”. Journal of Microbiological Methods, 122, 1-7. https://doi.org/10.1016/j.mimet.2015.12.015</mixed-citation></ref><ref id="scirp.88571-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Liu, H., Atta, S. and Hartung, J.S. (2017) Characterization and Purification of Proteins Suitable for the Production of Antibodies against “Ca. Liberibacter Asiaticus”. Protein Expression and Purification, 139, 36-42. https://doi.org/10.1016/j.pep.2017.07.010</mixed-citation></ref><ref id="scirp.88571-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Pagliaccia, D., Shi, J., Pang, Z., Hawara, E., Clark, K., Thapa, S.P., De Francesco, A.D., Liu, J., Tran, T.T., Bodaghi, S., Folimonova, S.Y., Ancona, V., Mulchandani, A., Coaker, G., Wang, N., Vidalakis, G. and Ma, W. (2017) A Pathogen Secreted Protein as a Detection Marker for Citrus Huanglongbing. Frontiers in Microbiology, 8, 2041. https://doi.org/10.3389/fmicb.2017.02041</mixed-citation></ref></ref-list></back></article>