<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">EPE</journal-id><journal-title-group><journal-title>Energy and Power Engineering</journal-title></journal-title-group><issn pub-type="epub">1949-243X</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/epe.2018.1010029</article-id><article-id pub-id-type="publisher-id">EPE-88214</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Engineering</subject></subj-group></article-categories><title-group><article-title>
 
 
  Ethanol Production from Cassava Pulp by a Newly Isolated Thermotolerant &lt;i&gt;Pichia kudriavzevii&lt;/i&gt; LC375240
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ifeanyi</surname><given-names>A. Ndubuisi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Julius</surname><given-names>E. Nweze</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Nnaemeka</surname><given-names>J. Onoyima</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Murata</surname><given-names>Yoshinori</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>James</surname><given-names>C. Ogbonna</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Microbiology, University of Nigeria, Nsukka, Nigeria</addr-line></aff><aff id="aff2"><addr-line>Biological Resources and Post-Harvest Division, Japan International Research Center for Agricultural Sciences (JIRCAS), Tsukuba, Japan</addr-line></aff><pub-date pub-type="epub"><day>29</day><month>10</month><year>2018</year></pub-date><volume>10</volume><issue>10</issue><fpage>457</fpage><lpage>474</lpage><history><date date-type="received"><day>7,</day>	<month>September</month>	<year>2018</year></date><date date-type="rev-recd"><day>28,</day>	<month>October</month>	<year>2018</year>	</date><date date-type="accepted"><day>31,</day>	<month>October</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  A total of 500 thermotolerant fermenting yeast isolates (100 from palm-wine and 400 from spoilt fruits) were screened for ethanol production at high temperatures. The best isolate that produced up to 4% ethanol from 10% glucose at 45
  &#176;C was selected for further experiments. The optimum pH for ethanol production by the isolate was pH 6 at both 30
  &#176;C and 42
  &#176;C. The isolate was identified as 
  <em>Pichia kudriavzevii</em> base on the 18s ribosomal DNA. Ethanol production from 200 g/L cassava pulp using Simultaneous Saccharification and Fermentation (SSF) method at 30
  &#176;C and 42
  &#176;C by the isolate was investigated. At 30
  &#176;C, an ethanol concentration of 30 g/L was produced. This represents an ethanol yield of 0.15 g/g of cassava pulp and 58.8% of the theoretical yield. However at 42
  &#176;C, the concentration of ethanol produced increased to 42 g/L representing an ethanol yield of 0.21 g/g of cassava pulp and 82.4% of the theoretical yield. The isolate produced slightly higher ethanol than the two typed strains NCYC 587 and NCYC 2791 at 42
  &#176;C. This isolate has a good potential to be used for commercial bioethanol production since it can produce ethanol at 45
  &#176;C without a significant drop in ethanol yield.
 
</p></abstract><kwd-group><kwd>Bioethanol</kwd><kwd> Cassava Pulp</kwd><kwd> Yeast</kwd><kwd> Thermotolerant</kwd><kwd> &lt;i&gt;Pichia kudriavzevii&lt;/i&gt;</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The use of bio-ethanol as an alternative to fossil fuel has been gaining worldwide attention owing to its many advantages (renewability, sustainability and environmentally friendliness) over fossil fuel. Despite the many advantages of bio-ethanol, the current costs of production are still much higher than the cost of fossil fuel, thereby limiting its commercialization in many parts of the world. Currently, for large scale production of bio-ethanol, food crops such as corn, sucrose containing feedstock such as sugarcane [<xref ref-type="bibr" rid="scirp.88214-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref2">2</xref>] , as well as starchy materials such as cassava [<xref ref-type="bibr" rid="scirp.88214-ref3">3</xref>] are used as raw materials. Aside from direct competition with food, these raw materials are too expensive to compete with the current fossil fuel prices. Lignocellulosic materials on the other hand are cheap and abundant but the cost of converting them to bio-ethanol is high.</p><p>Cassava pulp is a promising feedstock for commercial production of bio-ethanol and other value-added bio-products. It is a residue material that is produced as a waste when starch is extracted from cassava. It is cheap and available throughout the year because cassava which is the source of cassava pulp is flexible in terms of planting and harvesting seasons [<xref ref-type="bibr" rid="scirp.88214-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref7">7</xref>] . Also, cassava can grow on arid and semiarid land with moderate yield [<xref ref-type="bibr" rid="scirp.88214-ref8">8</xref>] , does not require much input of fertilizer and has little application in food industry. Cassava pulp contains about 40% - 70% starch on a dry weight basis, 20% - 30% cellulose fiber and other non-starch polysaccharides, with moisture content of 70% - 80% [<xref ref-type="bibr" rid="scirp.88214-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref10">10</xref>] . Due to its high starch and moisture content, it spoils rapidly and causes environmental problems including strong and offensive odour and contamination of local water supply [<xref ref-type="bibr" rid="scirp.88214-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref12">12</xref>] . Currently, Nigeria is the largest producer of cassava in the world [<xref ref-type="bibr" rid="scirp.88214-ref13">13</xref>] . The waste generated from cassava presently is already posing disposal and environmental problems. With the quest to expand cassava production and processing in Nigeria, a lot of cassava pulps will be generated which if not utilized will result in a lot of environmental pollution. Besides, converting this waste to wealth will greatly improve the economic feasibility of cassava processing industries as well as provide jobs for the many unemployed.</p><p>Hydrolysis is the first step in conversion of cassava pulp to bio-ethanol. Due to environmental problems associated with acid/base hydrolysis, attention is now focused on biological hydrolysis using purified or crude enzymes, or hydrolytic enzyme-producing microorganisms. The optimal temperatures for most of the carbohydrate hydrolyzing enzymes are usually higher than the optimal temperatures for the conventional yeast strains used to convert the products of hydrolysis to ethanol. Although conversion of cassava pulp to ethanol can be done in two sequential steps of hydrolysis followed by fermentation, many reports have demonstrated that simultaneous hydrolysis and fermentation leads to higher productivities and yields [<xref ref-type="bibr" rid="scirp.88214-ref14">14</xref>] . However, the use of Simultaneous Saccharification and Fermentation process requires a yeast strain capable of growing, fermenting sugars as well as producing high concentration of ethanol at temperatures close to the temperature of hydrolysis [<xref ref-type="bibr" rid="scirp.88214-ref15">15</xref>] . Also, the use of thermo-tolerant yeast will save cost of cooling especially in tropical climates where ambient temperature can easily exceed 40˚C [<xref ref-type="bibr" rid="scirp.88214-ref16">16</xref>] . There have been documentations on thermotolerant yeast strains capable of producing ethanol at a temperature up to 42˚C [<xref ref-type="bibr" rid="scirp.88214-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref19">19</xref>] among others. However, these yeasts have not yet been reported for commercial bioethanol production and they are not as robust as Saccharomyces cerevisiae in terms of ethanol production. Thus, there is need to screen for more thermotolerant yeast strains for industrial production of bioethanol. The aim of this work is to screen for thermotolerant ethanol fermenting yeasts and evaluate their potentials for bioethanol production from cassava pulp.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Samples</title><p>Palm wine was collected from wine tappers at Enugu-Ezike while spoilt fruits (mostly soursop) were collected from the middle of compost heaps in and around University of Nigeria Nsukka. All samples were collected into sterile containers and transported to the Microbiology laboratory for treatment and isolation of the yeast strains. Cassava pulp was obtained from Nigeria Starch Mill in Iheala, Anambra state Nigeria. The pulps were sun-dried to constant weight, milled, sieved and stored in a refrigerator until used.</p></sec><sec id="s2_2"><title>2.2. Isolation of Thermotolerant Fermenting Yeasts</title><p>The samples for yeast isolation were inoculated into an enrichment medium containing 10% glucose, 2% peptone and 1% yeast extract (10% YPD) and incubated at 42˚C for 24 hours. A 100 μL aliquot of the 24 hours old enrichment culture was spread on agar plates containing 2% glucose, 2% peptone, 2% agar-agar and 1% yeast extract. The plates were incubated at 42˚C for 24 hours. After incubation, discrete colonies were picked and inoculated into tubes containing 3 ml of 10% YPD and incubated at 30˚C. Isolates showing signs of fermentation after 24 hours of incubation were sub-cultured into a fresh 10% YPD and incubated at 42˚C for 24 hours. Isolates showing signs of fermentation after incubation at 42˚C were sub-cultured into a fresh 10% YPD in a 96 culture well plate, incubated at 30˚C for 24 hours and stored at 4˚C as stock culture for further use. Prior to use, the stock culture from 4˚C was left at room temperature for 2 hours. A 10 μL aliquot of each isolate from the stock culture was inoculated into 180 μL of 10% YPD in a 96 culture well plate using a multichannel pipette. The plates were incubated at 30˚C for 16 hours.</p></sec><sec id="s2_3"><title>2.3. Screening the Isolates for Ethanol Production at High Temperatures</title><p>A 10 μL aliquot of each isolate from 16 hours old pre-cultures was inoculated into 180 μL of 10% YPD in a 96 culture well plate using a multichannel pipette. The plates were incubated at 42˚C for 24 hours. After incubation, the concentration of ethanol produced by each isolate was determined.</p></sec><sec id="s2_4"><title>2.4. Rough Screening of the Isolates by NBT/PMS</title><p>This was done using a colorimetric method called Nitroblue Tetrazolium/Phenazine Methosulfate (NBT/PMS) according to Johannes et al. [<xref ref-type="bibr" rid="scirp.88214-ref20">20</xref>] . After incubation, the culture was diluted 50 times using distilled water in a 96 culture well plate. Ethanol standards (0.005%, 0.01%, 0.02%, 0.05% and 0.1%) were also prepared and also placed in different wells. A 100 μL of 0.1 M Na-Phosphate buffer, pH 7.5 containing 0.1% Triton X100, 20 μL of 0.4% NAD<sup>+</sup> and 20 μL of Alcohol Dehydrogenase (10 U/mL) were added in each well. The content of each well was mixed well by repeated pipetting and dispensing, and then the plates were incubated at room temperature for 5 mins. After incubation, 20 μL of 0.01% PMS/0.1% NBT mixture was added to each well and the plates were incubated at room temperature for 5 mins. The color intensity was compared with that of the different ethanol standards used. The screening was done at 42˚C and the best 10 stains were isolated.</p></sec><sec id="s2_5"><title>2.5. Confirmation of the Ethanol Production Abilities of the Isolates</title><p>The isolates (S26 and P27) were activated in YPD medium for 16 hours, and inoculated into a fresh 3 mL 10% YPD to an optical density (OD) of 0.2 at 600 nm. The tubes were incubated at 42˚C or 45˚C. The percentage concentration of ethanol produced by each strain was measured using High Performance Liquid Chromatography (HPLC) after 16 and then 24 hours. The best isolate was then used for subsequent experiments.</p></sec><sec id="s2_6"><title>2.6. Identification of the Isolate</title><p>Genome DNA was extracted from 24 hours old pure culture of the isolate according to Dhaliwal et al. [<xref ref-type="bibr" rid="scirp.88214-ref17">17</xref>] . About 15 mL of 24 hours old culture in YPD broth was centrifuged at 3000 g for 10 minutes and the supernatant was discarded. The precipitate was washed severally by re-suspending in sterile distilled water, centrifuging at 3000 g and discarding the supernatant. After washing, the precipitate was re-suspended in 2 mL of set buffer (20 mM Tris-HCl, pH 7.5, 1.2 M sorbitol, 10 mM EDTA) and 100 &#181;L of zymolyase (1.0 mg/mL) was added. The mixture was incubated at 30˚C for 30 minutes. After incubation, 200 &#181;L of 10% SDS (Sodium Dodecyl Sulfate) was added to the mixture, followed by the addition of 2 mL phenol-chloroform isoamylalcohol (NIPPON GENE, Tokyo, Japan). The mixture was centrifuged at 6000 g for 15 minutes after vigorous agitation. The clear aqua phase of the supernatant was transferred into a new tube and 10 &#181;L of RNAse was added to it. It was incubated at 37˚C for 2 hours. After incubation, 1 mL of phenol-chloroform was added to the mixture followed by centrifugation at 6000 g for 15 minutes. The clear aqua phase of the supernatant was transferred into a clean tube where one-tenth volume (150 &#181;L) of 3 M sodium acetate and 4.5 mL of 100% ethanol were added. The mixture was centrifuged at 6000 g and supernatant was discarded. To the DNA precipitate, 2 mL of cold 80% ethanol was added, it was centrifuged for 5 minutes and the supernatant was discarded. The DNA was air-dried at room temperature for 10 minutes and re-suspended in sterile distillate water. Polymerase Chain Reaction (PCR) amplification of 18s ribosomal Ribonucleic Acid (rRNA) gene was carried out on the isolated DNA using Internally Transcribed Spacer (ITS) primer. Both ITS4 (5’TCCTCCGCTTATTGATATGC3’) and ITS5 (5’GGAAGTAAAAGTCGTAACAAGG3’) were used for the amplification of appropriate DNA region. The sequence of DNA fragment was decided, and yeast strain was identified by comparison with the sequences of other strains. The evolutionary history of the isolates was inferred using the Neighbor-Joining method according to Saitou and Nei [<xref ref-type="bibr" rid="scirp.88214-ref21">21</xref>] . The tree was drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood method of Tamura et al. [<xref ref-type="bibr" rid="scirp.88214-ref22">22</xref>] and are in the units of the number of base substitutions per site. The analysis involved 25 nucleotide sequences. Codon positions included were 1st + 2nd + 3rd + Noncoding. All positions containing gaps and missing data were eliminated. There were a total of 500 positions in the final dataset. Evolutionary analyses were conducted in MEGA6 software according to Tamura et al. [<xref ref-type="bibr" rid="scirp.88214-ref23">23</xref>] .</p></sec><sec id="s2_7"><title>2.7. Characterization of the Isolate</title><p>The isolate was characterized by checking its sugar assimilation profile, temperature tolerance, pH, ethanol and Acetic acid tolerance.</p></sec><sec id="s2_8"><title>2.8. Sugar Assimilation Profile</title><p>This was carried out using the Api 20C AUX sugar assimilation kit (Analytab products, Div. of Ayerst Laboratories, Plainview, New York). The isolate was inoculated in 10% YPD and incubated at 30˚C on a rotary shaker at 120 rpm for 8 hours. The OD of the isolates at 600 nm was adjusted to 0.4 in 0.8% NaCl. A 100 μL aliquot of the NaCl-diluted sample was transferred into a basal medium containing all the nutrients required for growth except the sugar, and subsequently, a 200 μL of this was transferred into each sugar well. The kit was incubated at 30˚C for 72 hours and the ability of the isolates to assimilate a sugar was inferred by comparing the turbidity in each sugar well with the control.</p></sec><sec id="s2_9"><title>2.9. Temperature Tolerance</title><p>The temperature tolerance ability of the isolate was measured by incubating it at different temperatures (30˚C, 37˚C, 40˚C, 42˚C, 45˚C and 47˚C) in 10% YPD. The isolate was first pre-cultured at 30˚C for 16 hours. It was inoculated into a fresh 10% YPD to an OD of 0.2 at 600 nm. The concentration of ethanol produced by the isolate was measured after 24 and 48 hours using HPLC.</p></sec><sec id="s2_10"><title>2.10. pH Tolerance</title><p>The pH tolerance ability of the isolate was measured by inoculating them in 10% YPD adjusted to different pH values (2, 4, 6, 8 and 10) using either hydrochloric acid (for acidic pH) or sodium hydroxide (for the alkaline pH). This was incubated at 30˚C or 42˚C and cultivated for 48 hours. Measurement of concentration of ethanol produced by the isolate was also done using HPLC.</p></sec><sec id="s2_11"><title>2.11. Ethanol and Acetic Acid Stress Tolerance</title><p>The growth phenotypes of the isolated strain and two typed strains (NCYC 587 and NCYC 2791) were compared in media containing ethanol and acetic acid. Approximately 2.0 - 6.0 &#215; 10<sup>4</sup> cells (A600 = 1.0) of each strain (dilution factor 10<sup>0</sup>) and those of serially diluted (10<sup>−</sup><sup>1</sup> - 10<sup>−4</sup>) were spotted onto YPD containing 6% (w/v) ethanol, and varied concentrations (50 mM, 60 mM, and 70 mM) of acetic acid. These plates were incubated for 22 hours at 40˚C.</p></sec><sec id="s2_12"><title>2.12. Analysis of Starch and Cellulose Contents of the Cassava Pulp</title><p>The starch content was analyzed using the iodine method. One gram (1 g) of the cassava pulp was homogenized in 70 mL of distilled water. It was boiled for 30 minutes and allowed to cool. The volume was adjusted to 100 mL using distilled water. This was centrifuged and 0.1 mL supernatant was added into a test tube. A 5 mL of 1:100 dilution (1 mL of iodine solution: 100 mL of distilled water) of iodine solution was then added to the 0.1 mL of the supernatant. The volume of the mixture was adjusted to 10 mL using distilled water and the absorbance was taken at 680 nm. Analysis of cellulose was done according to the methods of Updegraff [<xref ref-type="bibr" rid="scirp.88214-ref24">24</xref>] .</p></sec><sec id="s2_13"><title>2.13. Production of Koji Enzyme Used for Hydrolysis</title><p>A 30 g portion of rice and 20 g of rice bran were steamed together. After steaming, it was allowed to cool to room temperature. Spores of the Aspergillus fumigatus on potato dextrose agar slants were harvested using normal saline and inoculated into the mixture of rice and rice bran. This was covered with muslin cloth and incubated at 30˚C for 72 hours with daily stirring for effective enzyme production. A 2.5 g of this koji was used as the source of enzyme throughout the experiment.</p></sec><sec id="s2_14"><title>2.14. Pretreatment and Hydrolysis of Cassava Pulp and Glucose Assay</title><p>A 20% (w/v) Cassava pulp was pre-treated by autoclaving at 121˚C, and pressure of 15 psi for 10 minutes. It was cooled to room temperature before hydrolysis. A 2.5 g of the koji enzyme from Aspergillus fumigatus was added to the pre-treated cassava pulp as enzyme for starch hydrolysis throughout the experiment. Cassava pulp without pretreatment (20% w/v) was used as the control. The pre-treated cassava pulp, as well as the control was incubated with koji at 42˚C for 48 hours. After 48 hours, the concentration of the reducing sugar (glucose) released was measured using HPLC.</p></sec><sec id="s2_15"><title>2.15. Ethanol Production from Cassava Pulp by Pichia kudriavzevii S26, K. marxianus NCYC 587, and NCYC2791</title><p>The pretreated cassava pulp (20% w/v) was supplemented with 2% polypeptone and 1% yeast extract before fermentation. Yeast strains (S26, NCYC587, and NCYC2791) were pre-cultured in YPD. The pre-cultured yeasts were inoculated into the pretreated cassava pulp (20% w/v) to a final OD of 0.6 at 600 nm. These cassava pulps were incubated at 30˚C and 42˚C. Samples for ethanol detection were taken at every 24 hour, and the concentration of ethanol was analyzed by HPLC (Prominence, Shimazu Seisakusho, Kyoto, Japan), using Aminex HPX87H (300 &#215; 7.8 mm) (BioRad, California, USA) as the column.</p></sec><sec id="s2_16"><title>2.16. Statistical Analysis</title><p>All the experiments were performed three times and the results were presented as mean &#177; SD. The data were subjected to Analysis of Variance (single classification) and where significance differences were observed, Least Significance Difference (LSD) was used to separate the means.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Ethanol Production at High Temperatures by the Best Isolates</title><p>A total of 500 colonies (100 colonies isolated from palm wine and 400 colonies isolated from spoilt fruits) were obtained. The results of ethanol production by the 10 best isolates, (<xref ref-type="table" rid="table1">Table 1</xref>) at 42˚C and 45˚C are shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>. With the exception of P71, all the isolates produced higher concentration of ethanol at 42˚C than at 45˚C. However, in some isolates such as P27 and S26, there was no significant difference in the concentration of ethanol produced at 42˚C and 45˚C (p &gt; 0.05). On the whole, isolates P27 and S26 produced high ethanol concentration (&gt;4%) from 10% glucose. S26 was selected for further studies because it showed more stable performance in terms of the concentrations of ethanol produced from glucose medium under high temperatures than P27 (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> The 10 best isolates and their isolation source</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >ISOLATE</th><th align="center" valign="middle" >ISOLATION SOURCE</th></tr></thead><tr><td align="center" valign="middle" >P83</td><td align="center" valign="middle" >Palm wine</td></tr><tr><td align="center" valign="middle" >S67</td><td align="center" valign="middle" >Spoilt fruit (soursop)</td></tr><tr><td align="center" valign="middle" >P27</td><td align="center" valign="middle" >Palm residue</td></tr><tr><td align="center" valign="middle" >P71</td><td align="center" valign="middle" >Palm wine</td></tr><tr><td align="center" valign="middle" >S26</td><td align="center" valign="middle" >Spoilt fruit (soursop)</td></tr><tr><td align="center" valign="middle" >S65</td><td align="center" valign="middle" >Spoilt fruit (banana)</td></tr><tr><td align="center" valign="middle" >S2</td><td align="center" valign="middle" >Spoilt fruit (soursop)</td></tr><tr><td align="center" valign="middle" >S86</td><td align="center" valign="middle" >Spoilt fruit (guava)</td></tr><tr><td align="center" valign="middle" >S1</td><td align="center" valign="middle" >Spoilt fruit (soursop)</td></tr><tr><td align="center" valign="middle" >P5</td><td align="center" valign="middle" >Spoilt fruit (pineapple)</td></tr></tbody></table></table-wrap></sec><sec id="s3_2"><title>3.2. Characterization and Identification of the Isolate</title><p>Isolate S26 was able to assimilate up to 10 sugars (<xref ref-type="table" rid="table2">Table 2</xref>). It assimilated glycerol as carbon source but was not able to assimilate xylose (<xref ref-type="table" rid="table2">Table 2</xref>). This sugar assimilation pattern is a characteristic of Pichia kudriavzevii [<xref ref-type="bibr" rid="scirp.88214-ref25">25</xref>] .</p><p>Time courses of ethanol production by isolate S26 at various temperatures are shown in <xref ref-type="fig" rid="fig3">Figure 3</xref>. It produced the highest concentration of ethanol (4.3% w/v) at 30˚C and the concentration of ethanol decreased gradually as temperature increased. It is important to note that it was able to produce high concentration of ethanol (3.6% w/v) even at 45˚C, corresponding to ethanol yield of 70.6%. There was a significant decrease in the concentrations of ethanol produced by the isolate at 47˚C (p &lt; 0.05).</p><p>The effects of pH on ethanol production by the isolate at 30˚C and 42˚C are shown in <xref ref-type="fig" rid="fig4">Figure 4</xref>. As shown in <xref ref-type="fig" rid="fig3">Figure 3</xref>, at a pH of 6, the concentrations of ethanol produced at 30˚C and 42˚C were 4.3% and 3.7%, which correspond to ethanol yields of 84.3%, and 72.5%, respectively. At extreme pH values of 2 and</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Sugar assimilation profile of the isolate S26</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Sugars</th><th align="center" valign="middle" >Degree of assimilation</th></tr></thead><tr><td align="center" valign="middle" >GLUCOSE</td><td align="center" valign="middle" >+++</td></tr><tr><td align="center" valign="middle" >GLYCEROL</td><td align="center" valign="middle" >+++</td></tr><tr><td align="center" valign="middle" >2KG</td><td align="center" valign="middle" >−−−</td></tr><tr><td align="center" valign="middle" >ARABINOSE</td><td align="center" valign="middle" >−−+</td></tr><tr><td align="center" valign="middle" >XYLOSE</td><td align="center" valign="middle" >−−−</td></tr><tr><td align="center" valign="middle" >ADOLOSE</td><td align="center" valign="middle" >−++</td></tr><tr><td align="center" valign="middle" >XYLITOL</td><td align="center" valign="middle" >−++</td></tr><tr><td align="center" valign="middle" >GALACTOSE</td><td align="center" valign="middle" >+++</td></tr><tr><td align="center" valign="middle" >INOSITOL</td><td align="center" valign="middle" >−−−</td></tr><tr><td align="center" valign="middle" >SORBITOL</td><td align="center" valign="middle" >−++</td></tr><tr><td align="center" valign="middle" >MDG</td><td align="center" valign="middle" >−−−</td></tr><tr><td align="center" valign="middle" >NAG</td><td align="center" valign="middle" >−−−</td></tr><tr><td align="center" valign="middle" >CEL</td><td align="center" valign="middle" >−−−</td></tr><tr><td align="center" valign="middle" >LACTOSE</td><td align="center" valign="middle" >−−+</td></tr><tr><td align="center" valign="middle" >MALTOSE</td><td align="center" valign="middle" >−−+</td></tr><tr><td align="center" valign="middle" >SACROSE</td><td align="center" valign="middle" >+++</td></tr><tr><td align="center" valign="middle" >TRE</td><td align="center" valign="middle" >−−−</td></tr><tr><td align="center" valign="middle" >MLZ</td><td align="center" valign="middle" >−−−</td></tr><tr><td align="center" valign="middle" >RAF</td><td align="center" valign="middle" >−++</td></tr></tbody></table></table-wrap><p>+++ = high assimilation; −++ = moderate assimilation; −−+ = low assimilation, and −−− = no assimilation.</p><p>10, S26 was not able to produce ethanol.</p><p>The effect of ethanol and acetic acid on the growth of the isolate is shown in <xref ref-type="fig" rid="fig5">Figure 5</xref>. The isolate was able to grow on YPD supplemented with 6% ethanol as well as the one supplemented with 70 mM acetic acid. It also exhibited higher tolerance to acetic acid and ethanol than NCYC587 and NCYC2791 (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p><p>While NCYC2791 was not able to grow on YPD containing 70 mM acetic acid, our isolate (S26) grew very well even when diluted to 10<sup>−4</sup> (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p><p>Phylogenetic tree for the isolate was constructed from the sequence and blast search result by using MEGA6 software (<xref ref-type="fig" rid="fig6">Figure 6</xref>). The isolate (S26) was grouped with the clade of Pichia kudriavzevii. This result agreed with the data on sugar assimilation (<xref ref-type="table" rid="table2">Table 2</xref>). Consequently, the isolate, S26, was identified as Pichia kudriavzevii, and it was registered as LC375240 at Genebank.</p></sec><sec id="s3_3"><title>3.3. Ethanol Production from Cassava Pulp</title><p>The starch and cellulose contents of dried cassava pulp from Nigeria Starch Mill, Iheala were 48.6% &#177; 4.0% and 21.5% &#177; 2.0% respectively. The cassava pulp (20% w/v) was pre-treated by autoclaving at 121˚C for 20 minutes and hydrolyzed using Aspergillus fumigatus koji. After 24 hours of hydrolysis, the concentration of glucose increased from 0.69 &#177; 0.05 to 10.09 &#177; 0.05 while the concentration of starch decreased from 9.66 &#177; 0.2 to 0.56 &#177; 0.02 (<xref ref-type="table" rid="table3">Table 3</xref>). Besides, little sugar was detected in cassava pulp without pretreatment (data not shown). The results of Simultaneous Saccharification and Fermentation of 20% cassava pulp using koji and each of the yeast strains (S26, NCYC587, NCYC2791) are shown in <xref ref-type="fig" rid="fig7">Figure 7</xref>. S26 produced higher concentration of ethanol at 42˚C (4.2% &#177; 0.03%) than at 30˚C (3.0% &#177; 0.06%). A comparison of ethanol production ability of S26 with those of known thermotolerant strains of Kluyveromyces marxianus is shown in <xref ref-type="fig" rid="fig8">Figure 8</xref>. All the three strains (S26, K. marxianus NCYC587 and NCYC2791) produced higher ethanol concentrations of 4.2%, 4.0% and 3.7%, respectively, at 42˚C than at 30˚C. These correspond to ethanol yields of 82.3%, 78.4% and 72.5%, respectively (<xref ref-type="fig" rid="fig8">Figure 8</xref>). These results demonstrated that the new isolate (S26) has a great potential for ethanol production from cassava pulp at high temperatures.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Pichia kudriavzevii which is able to grow and produce ethanol within a temperature</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Effect of autoclaving for 10 minutes and hydrolysis using Aspergillus fumigatus koji on the composition of 20% (w/v) cassava pulp</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Components</th><th align="center" valign="middle" >Initial</th><th align="center" valign="middle" >24 h after hydrolysis</th></tr></thead><tr><td align="center" valign="middle" >Starch</td><td align="center" valign="middle" >9.66 &#177; 0.2</td><td align="center" valign="middle" >0.56 &#177; 0.02</td></tr><tr><td align="center" valign="middle" >Cellulose</td><td align="center" valign="middle" >1.64 &#177; 0.03</td><td align="center" valign="middle" >0.49 &#177; 0.01</td></tr><tr><td align="center" valign="middle" >Glucose</td><td align="center" valign="middle" >0.69 &#177; 0.05</td><td align="center" valign="middle" >10.09 &#177; 0.05</td></tr></tbody></table></table-wrap><p>range of 30˚C and 47˚C was isolated in this study. This conforms the previous reports that many thermo-tolerant strains of this yeast grow well at temperatures as high as 45˚C to 52˚C and can efficiently ferment and produce ethanol at temperatures of between 38˚C and 45˚C [<xref ref-type="bibr" rid="scirp.88214-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref27">27</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref28">28</xref>] .</p><p>Using 20% cassava pulp supplemented with 1% yeast extract and 2% peptone at 42˚C, the isolate produced 42 g/l ethanol representing an ethanol yield of 0.21 g-ethanol/g-cassava pulp using Simultaneous Saccharification and Fermentation method. This was 82.4% of theoretical ethanol yield. At 30˚C under the same conditions, the isolate produced 30 g/l ethanol representing an ethanol yield of 0.15 g/g of cassava pulp and 58.8% theoretical ethanol yield. It is interesting to note that the ethanol yield was even higher at 42˚C than at 30˚C. This could be because 42˚C is closer to the optima temperature for the saccharifing and hydrolytic enzymes and highlights the significance of this study. The temperature inside fermentation tank increases gradually during fermentation but even without temperature control, it does not usually rise above 45˚C. Thus with a thermotolerant yeast which can efficiently produce ethanol within a wide range of temperature (between 35˚C and 45˚C) means that ethanol production can be done without temperature control. In other words, the P. kudriavzevii, S26 (LC375240) isolated in this study has a great potential for commercial ethanol production. This strain produced even higher concentration of ethanol at 42˚C than at 30˚C (<xref ref-type="fig" rid="fig3">Figure 3</xref> and <xref ref-type="fig" rid="fig7">Figure 7</xref>). When conventional yeast, Saccharomyces cerevisiae, was cultivated consecutively at high temperature, the morphological shape of the cells became elongated [<xref ref-type="bibr" rid="scirp.88214-ref29">29</xref>] . This morphological alteration was observed also observed in P. kudriavzevii when it was used for continuous ethanol fermentation under high temperature [<xref ref-type="bibr" rid="scirp.88214-ref30">30</xref>] . The sporadic filamentous cells might be a requirement for tolerance or acquired acclimation in the fermentation system at high temperatures.</p><p>The ethanol yields obtained in this study are higher than those reported in some previous works. For example, Kaewkrajay et al. [<xref ref-type="bibr" rid="scirp.88214-ref19">19</xref>] reported that P. kudriavzevii PBB511-1 produced 37.0 g/l ethanol with 40% of theoretical yield in a cassava starch hydrolysate medium containing reducing sugar (180 g/l), (NH<sub>4</sub>)<sub>2</sub>SO<sub>4</sub> (0.5 g/l), KH<sub>2</sub>PO<sub>4</sub> (0.5 g/l), MgSO<sub>4</sub>・7H<sub>2</sub>O (0.5 g/l), and yeast extract (1.0 g/l) at 45˚C. Yuangsaard et al. [<xref ref-type="bibr" rid="scirp.88214-ref18">18</xref>] reported that P. kudriavzevii DMKU 3-ET15 (isolated from traditional fermented pork sausage) could produce ethanol from cassava starch hydrolysate medium composed of 18% glucose, 0.05% (NH<sub>4</sub>)<sub>2</sub>SO<sub>4</sub>, 0.09% yeast extract, 0.05% KH<sub>2</sub>PO<sub>4</sub>, and 0.05% MgSO<sub>4</sub>・7H<sub>2</sub>O but at 45˚C, only 4% (w/v) ethanol, (42% of theoretical yield) was produced. Dhaliwal et al. [<xref ref-type="bibr" rid="scirp.88214-ref17">17</xref>] reported isolation of P. kudriavzevii from sugarcane juice which at 40˚C, produced 71.9 g/l of ethanol and a productivity of 4.0 (g/l・h) from sugarcane juice composed of 14% (w/v) sucrose, 2% (w/v) glucose, and 1% (w/v) fructose. Oberoi et al. [<xref ref-type="bibr" rid="scirp.88214-ref28">28</xref>] reported isolation of a thermo-tolerant P. kudriavzevii HOP-1 which produced 24.25 g/l of ethanol, corresponding to 82% of the theoretical ethanol yield on glucan basis from 1% sodium hydroxide-treated rice straw via simultaneous saccharification and fermentation at 40˚C. However, some reports have also shown that higher ethanol concentrations and yields can be obtained with P. kudriavzevii species. For example, Yuangsaard et al. [<xref ref-type="bibr" rid="scirp.88214-ref18">18</xref>] reported an ethanol theoretical yield of 85.4% using P. kudriavzevii DMKU 3-ET15 (isolated from traditional fermented pork sausage) at 40˚C. On the whole, the final ethanol concentrations and yields depend, not only on the strain, but also on fermentation conditions, especially the nature of substrate. Cassava pulp, which is generated in large quantities in Nigeria and poses a lot of environmental problem was used in this study. The starch content of the pulp (48%) was lower than those reported in other works [<xref ref-type="bibr" rid="scirp.88214-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.88214-ref31">31</xref>] . However, the cellulose content (21.5%) was higher than the value reported by Rattanachomsri et al. [<xref ref-type="bibr" rid="scirp.88214-ref9">9</xref>] and Virunanon et al. [<xref ref-type="bibr" rid="scirp.88214-ref31">31</xref>] . They reported a cellulose contents of 15.6% and 4.11% respectively. Generally, the starch and cellulose contents of cassava pulp depend on the variety of cassava, the age of the cassava and the processing method. Nevertheless, the present study has demonstrated that cassava pulp is a good substrate for ethanol production.</p><p>Nigeria remains the world largest producer of cassava and in 2016, she produced a total of 57,134,478 tons. With the technology currently used to produce cassava starch in Nigeria, 400 kg of pulp is produced per ton of cassava tubers (on wet weight basis) and assuming 60% water content of the pulp, 160 kg of dry pulp is produced per ton of cassava tubers. If only 20% of cassava tubers (11,426,895 tons of cassava tubers) is processed into starch, 1,828,303 tons of dry pulp will be produced. With the current yield of 0.21 g-ethanol/g-pulp and assuming ethanol density of 0.789 mL/g, 266 L of anhydrous ethanol will be produced per ton of dry pulp. Thus, it is estimated that 486,328,598 L of ethanol will be produced from the pulp generated from 20% of cassava produced in Nigeria. Currently, Nigerian local refineries are producing only about 8 million liters of Premium motor spirit (PMS) per day. This requires only 800,000 liters of ethanol per day (292,000,000 L per annum) to make E10 (90% gasoline: 10% ethanol) and can be supplied by converting pulp from only 12% of cassava produced in Nigeria. Cassava pulp, being a waste, is usually exposed to many kinds of microorganisms and thus contains high levels of organic acids (lactic acid or acetic acid). These organic acids inhibit ethanol fermentation [<xref ref-type="bibr" rid="scirp.88214-ref32">32</xref>] . However, our isolated P. kudriavezevii can grow on YPD supplemented with 70 mM acetic acid even at 10<sup>−4</sup> dilution. It has also been known that P. kudriavezevii has high tolerance to organic acids, and it was able to produce ethanol from YPD medium containing 50 mM acetic acid [<xref ref-type="bibr" rid="scirp.88214-ref33">33</xref>] . Therefore, P. kudriavzevii, S26 a robust yeast for ethanol production without proper sterilization of cassava pulp.</p><p>It is also important to note that the isolate obtained in the present study gave higher ethanol yield than those of the typed ethanol-fermenting thermo-tolerant strains of Kluveromyces maxianus from the National Collection of Yeast Cultures Institute in the United Kingdom (NCYC 2791 and NCYC 587) under the same culture conditions. This yeast strain thus hold a good potential for large scale bio-ethanol production in tropical areas like Nigeria as they will help reduce the cost of cooling during fermentation, save time, reduce contamination and thus reduce the cost of producing bio-ethanol.</p></sec><sec id="s5"><title>5. Conclusion</title><p>A thermo-tolerant ethanol-fermenting strain of Pichia kudriavzevii S26 (LC375240) was isolated from decaying fruits in Nigeria. The potential of the isolate in producing ethanol from cassava pulp was evaluated. Under optimum temperature of 42˚C, the isolate was able to produce 0.21 g-ethanol/g-cassava pulp. It is estimated that with this strain, the amount of ethanol needed to produce E10 from all the PMS locally refined in Nigeria can be produced from cassava pulp generated from only 12% of cassava tubers produced in Nigeria by Starch Mills. Higher ethanol yields can be obtained by optimizing the pretreatment of cassava pulps to enhance effective conversion of all the starch and non-starch contents of the pulp to fermentable sugars.</p></sec><sec id="s6"><title>Acknowledgements</title><p>This work was supported by a grant from the Ministry of Agriculture, Forestry, and Fisheries of Japan (Development of climate change mitigation technology through effective utilization of agro processing residues). The authors wish to acknowledge the Japan International Research Centre for Agricultural Science (JIRCAS) for funding this work.</p></sec><sec id="s7"><title>Conflicts of Interest</title><p>There is no conflict of interests.</p></sec><sec id="s8"><title>Cite this paper</title><p>Ndubuisi, I.A., Nweze, J.E., Onoyima, N.J., Yoshinori, M. and Ogbonna, J.C. (2018) Ethanol Production from Cassava Pulp by a Newly Isolated Thermotolerant Pichia kudriavzevii LC375240. Energy and Power Engineering, 10, 457-474. https://doi.org/10.4236/epe.2018.1010029</p></sec></body><back><ref-list><title>References</title><ref id="scirp.88214-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Ogbonna, J.C., Tomiyama, S., Lui, Y.C. and Tanaka H. (1997) Efficient Production of Ethanol by Cells Immobilized in Loofa (Luffa Cylindrica) Sponge. Journal of Fermentation and Bioengineering, 84, 271-274.  
https://doi.org/10.1016/S0922-338X(97)82069-7</mixed-citation></ref><ref id="scirp.88214-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Ogbonna, J.C., Mashima, H. and Tanaka, H. (2001) Scale up of Fuel Ethanol Production from Sugar Beet Juice Using Loofa Sponge Immobilized Bioreactor. Bioresource Technology, 76, 1-8. https://doi.org/10.1016/S0960-8524(00)00084-5</mixed-citation></ref><ref id="scirp.88214-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Roble, N.D., Ogbonna, J.C. and Tanaka, H. (2003) A Novel Circulating Loop Bioreactors with Cells Immobilized in Loofa (Luffa cylindrica) Sponge for Bioconversion of Raw Cassava Starch to Ethanol. Applied Microbiology and Biotechnology, 60, 671-678. https://doi.org/10.1007/s00253-002-1119-0</mixed-citation></ref><ref id="scirp.88214-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Shetty, J.K., Chotani, G., Duan, G. and Bates, D. (2007) Cassava as an Alternative Feedstock in the Production of Transportation Fuel. International Sugar Journal, 109, 663-677.</mixed-citation></ref><ref id="scirp.88214-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Kosugi, A., Akihiko, K., Mitsuyoshi, U., Yoshinori, M., Pilanee, V., Warunee, T., Takamitsu, A. and Yutaka, M. (2009) Production of Ethanol from Cassava Pulp via Fermentation with a Surface-Engineered Yeast Strain Displaying Glucoamylase. Renewable Energy, 34, 1354-1358. https://doi.org/10.1016/j.renene.2008.09.002</mixed-citation></ref><ref id="scirp.88214-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Lin, H.J., Xian, L., Zhang, Q.J., Luo, X.M., Xu, Q.S., Yang, Q., Duan, C.J., Liu, J.L., Tang, J.L. and Feng, J.X. (2011). Production of Raw Cassava Starch-Degrading Enzyme by Penicillium and Its Use in Conversion of Raw Cassava Flour to Ethanol. Journal of Industrial Microbiology and Biotechnology, 38, 733-742.  
https://doi.org/10.1007/s10295-010-0910-7</mixed-citation></ref><ref id="scirp.88214-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Sidra, P., Aman, A., Iqbal, S., Siddiqui, N.N. and Ali, S. (2014) Saccharification and Liquefaction of Cassava Starch: An Alternative Source for the Production of Bioethanol Using Amylolytic Enzymes by Double Fermentation Process. BMC Biotechnology, 14, 49. https://doi.org/10.1186/1472-6750-14-49</mixed-citation></ref><ref id="scirp.88214-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Ogbonna, C.N. and Okoli, E.C. (2013) Economic Feasibility of On-Farm Fuel Ethanol Production from Cassava Tubers in Rural Communities. African Journal of Biotechnology, 12, 5618-5626.</mixed-citation></ref><ref id="scirp.88214-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Rattanachomsri, U., Sutipa, T., Lily, E. and Verawat, C. (2009) Simultaneous Non-Thermal Saccharification of Cassava Pulp by Multi-Enzyme Activity and Ethanol Fermentation by Candida Tropicalis. Journal of Bioscience and Bioengineering, 107, 488-493. https://doi.org/10.1016/j.jbiosc.2008.12.024</mixed-citation></ref><ref id="scirp.88214-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Apiwatanapiwat, W., Yoshinori, M., Kosugi, A., Ryosuke, Y., Akihiko, K., Takamitsu, A., Prapassorn, R. and Yutaka, M. (2011) Direct Ethanol Production from Cassava Pulp Using a Surface-Engineered Yeast Strain Co-Displaying Two Amylases, Two Cellulases, and β-Glucosidase. Applied Microbiology and Biotechnology, 90, 377-384. https://doi.org/10.1007/s00253-011-3115-8</mixed-citation></ref><ref id="scirp.88214-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Sriroth, K., Rungsima, C., Sunee, C., Kuakoon, P. and Christopher, G.O. (2000) Processing of Cassava Waste for Improved Biomass Utilization. Bioresource Technology, 71, 63-69. https://doi.org/10.1016/S0960-8524(99)00051-6</mixed-citation></ref><ref id="scirp.88214-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Ubalua, A.O. (2007) Cassava Wastes: Treatment Options and Value Addition Alternatives. African Journal of Biotechnology, 6, 2065-2073.  
https://doi.org/10.5897/AJB2007.000-2319</mixed-citation></ref><ref id="scirp.88214-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Food and Agriculture Organization of the United Nations (2016) Report on Cassava Production in the World, FAO-STAT 2016. http://www.fao.org/home/en/</mixed-citation></ref><ref id="scirp.88214-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Apiwatanapiwat, W., Prapassorn, R., Pilanee, V., Warunee, T., Kosugi, A., Takamitsu, A., Yutaka, M. and Yoshinori, M. (2013) Ethanol Production at High Temperature from Cassava Pulp by a Newly Isolated Kluyveromyces marxianus Strain, TISTR 5925. Aims Energy, 1, 3-16. https://doi.org/10.3934/energy.2013.1.3</mixed-citation></ref><ref id="scirp.88214-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Banerjee, S., Sandeep, M., Ramkrishna, S., Balendu, G., Devanand, S., Tapan, C. and Pandey, R. (2010) Commercializing Lignocellulosic Bioethanol: Technology Bottlenecks and Possible Remedies. Biofuels, Bioproducts and Biorefining, 4, 77-93.  
https://doi.org/10.1002/bbb.188</mixed-citation></ref><ref id="scirp.88214-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Abdel-Banat, B.M., Hoshida, H., Ano, A., Noklang, S. and Akada, R. (2010) High Temperature Fermentation: How Can Processes for Ethanol Production at High Temperatures Become Superior to the Traditional Process Using Mesophilic Yeast? Applied Microbiology and Biotechnology, 85, 861-867.  
https://doi.org/10.1007/s00253-009-2248-5</mixed-citation></ref><ref id="scirp.88214-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Dhaliwal, S.S., Oberoi, H.S., Sandhu, S.K., Nanda, D., Kumar, D. and Uppal, S.K. (2011) Enhanced Ethanol Production from Sugarcane Juice by Galactose Adaptation of a Newly Isolated Thermotolerant Strain of Pichia kudriavzevii. Bioresource Technology, 102, 5968-5975. https://doi.org/10.1016/j.biortech.2011.02.015</mixed-citation></ref><ref id="scirp.88214-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Napatchanok, Y., Yongmanitchai, W., Yamada, M. and Limtong, S. (2013) Selection and Characterization of a Newly Isolated Thermotolerant Pichia kudriavzevii Strain for Ethanol Production at High Temperature from Cassava Starch Hydrolysate. Antonie van Leeuwenhoek, 103, 577-588.  
https://doi.org/10.1007/s10482-012-9842-8</mixed-citation></ref><ref id="scirp.88214-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Chutima, K., Dethoup, T. and Limtong, S. (2014) Ethanol Production from Cassava Using a Newly Isolated Thermotolerant Yeast Strain. Science Asia, 40, 268-277.  
https://doi.org/10.2306/scienceasia1513-1874.2014.40.268</mixed-citation></ref><ref id="scirp.88214-ref20"><label>20</label><mixed-citation publication-type="book" xlink:type="simple">Johannes, T.W, Woodyer, R.D. and Zhao, H. (2006) High-Throughput Screening Methods Developed for Oxidoreductases, In: Reymond, J.-L., Ed., Enzyme Assays: High-Throughput Screening, Genetic Selection and Fingerprinting, Wiley-VCH Verlag GmbH &amp; Co. KGaA, Weinheim, 77-93.</mixed-citation></ref><ref id="scirp.88214-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Saitou, N. and Nei, M. (1987) The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Molecular Biology and Evolution, 4, 406-425.</mixed-citation></ref><ref id="scirp.88214-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Tamura, K., Nei, M. and Kumar, S. (2004) Prospects for Inferring Very Large Phylogenies by Using the Neighbor-Joining Method. Proceedings of the National Academy of Sciences, 101, 11030-11035. https://doi.org/10.1073/pnas.0404206101</mixed-citation></ref><ref id="scirp.88214-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. (2013) MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution, 30, 2725-2729. https://doi.org/10.1093/molbev/mst197</mixed-citation></ref><ref id="scirp.88214-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Updegraff, M.D. (1969) Semimicro Determination of Cellulose in Biological Materials. Analytical Biochemistry, 32, 420-424.  
https://doi.org/10.1016/S0003-2697(69)80009-6</mixed-citation></ref><ref id="scirp.88214-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Kurtzman, C.P. and Fell, J.W. (1998) The Yeasts: A Taxonomic Study. Elsevier Science, Amsterdam, 77-100.</mixed-citation></ref><ref id="scirp.88214-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Ballesteros, M., Oliva, J.M., Negro, M.J., Manzanares, P. and Ballesteros, I. (2004) Ethanol from Lignocellulosic Materials by a Simultaneous Saccharification and Fermentation Process (SFS) with Kluyveromyces marxianus CECT 10875. Process Biochemistry, 39, 1843-1848. https://doi.org/10.1016/j.procbio.2003.09.011</mixed-citation></ref><ref id="scirp.88214-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Limtong, S., Sringiew, C. and Yongmanitchai, W. (2007) Production of Fuel Ethanol at High Temperature from Sugar Cane Juice by a Newly Isolated Kluyveromyces marxianus. Bioresource Technology, 98, 3367-3374.  
https://doi.org/10.1016/j.biortech.2006.10.044</mixed-citation></ref><ref id="scirp.88214-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Oberoi, H., Singh, N., Babbar, S., Kaur, S., Sandeep, S.D., Kaur, U., Chadha, B.S. and Bhargav, V.K. (2012) Ethanol Production from Alkali-Treated Rice Straw via Simultaneous Saccharification and Fermentation Using Newly Isolated Thermotolerant Pichia kudriavzevii HOP-1. Journal of Industrial Microbiology and Biotechnology, 39, 557-566. https://doi.org/10.1007/s10295-011-1060-2</mixed-citation></ref><ref id="scirp.88214-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Ceccato-Antonini, S.R. (2008) Biotechnological Implication of Filamentation in Saccharomyces cerevisiae. Biotechnology Letters, 30, 1151-1161.  
https://doi.org/10.1007/s10529-008-9681-x</mixed-citation></ref><ref id="scirp.88214-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Gallardo, J.C.M., Souza, C.S., Cicarelli, R.M.B., Oliveira, K.F., Morais, M.R. and Laluce, C. (2011) Enrichment of a Continuous Culture of Saccharomyces cerevisiae with the Yeast Issatchenkia orientalis in the Production of Ethanol at Increasing Temperatures. Journal of Industrial Microbiology and Biotechnology, 38, 405-414.  
https://doi.org/10.1007/s10295-010-0783-9</mixed-citation></ref><ref id="scirp.88214-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Chompunuch, V., Ouephanit, C., Burapatana, V. and Chulalaksananukul, W. (2013) Cassava Pulp Enzymatic Hydrolysis Process as a Preliminary Step in Bio-Alcohols Production from Waste Starchy Resources. Journal of Cleaner Production, 39, 273-279. https://doi.org/10.1016/j.jclepro.2012.07.055</mixed-citation></ref><ref id="scirp.88214-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Rugthaworn, P., Murata, Y., Machida, M., Apiwatanapiwat, W., Hirooka, A., Thanapase, W., Dangjarean, H., Ushiwaka, S., Morimitsu, K., Kosugi, A., Arai, T. and Vaithanomsat, P. (2014) Growth Inhibition of Thermotolerant Yeast, Kluyveromyces marxianus, in Hydrolysates from Cassava Pulp. Applied Biochemistry and Biotechnology, 173, 197-208. https://doi.org/10.1007/s12010-014-0906-2</mixed-citation></ref><ref id="scirp.88214-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Nwuche, C.O., Murata, Y., Nweze, J.E., Ndubuisi, I.A., Ohmae, H., Saito, M. and Ogbonna, J.C. (2018) Bioethanol Production under Multiple Stress Condition by a New Acid and Temperature Tolerant Saccharomyces cerevisiae Strain LC 269108 Isolated from Rotten Fruits. Process Biochemistry, 67, 105-112.  
https://doi.org/10.1016/j.procbio.2018.01.016</mixed-citation></ref></ref-list></back></article>