<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">NS</journal-id><journal-title-group><journal-title>Natural Science</journal-title></journal-title-group><issn pub-type="epub">2150-4091</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ns.2018.1010038</article-id><article-id pub-id-type="publisher-id">NS-87808</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Chemistry&amp;Materials Science</subject><subject> Earth&amp;Environmental Sciences</subject><subject> Medicine&amp;Healthcare</subject><subject> Physics&amp;Mathematics</subject></subj-group></article-categories><title-group><article-title>
 
 
  Overexpression of the &lt;i&gt;Rosa rugosa RrGT1&lt;/i&gt; Gene Induces Anthocyanin Accumulation in Tobacco
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xiaoming</surname><given-names>Sui*</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mingyuan</surname><given-names>Zhao*</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xu</surname><given-names>Han</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lanyong</surname><given-names>Zhao#</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Zongda</surname><given-names>Xu#</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>College of Forestry, Shandong Agricultural University, Taian, China</addr-line></aff><pub-date pub-type="epub"><day>10</day><month>10</month><year>2018</year></pub-date><volume>10</volume><issue>10</issue><fpage>404</fpage><lpage>415</lpage><history><date date-type="received"><day>3,</day>	<month>September</month>	<year>2018</year></date><date date-type="rev-recd"><day>13,</day>	<month>October</month>	<year>2018</year>	</date><date date-type="accepted"><day>16,</day>	<month>October</month>	<year>2018;</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Rosa rugosa
   has always been an important plant in landscape application, and the improvements and innovations about its flower color are particularly important. Glycosylation modification fulfills an important role in increasing the stability and solubility of anthocyanin in plants. In this study, based on the transcriptional database of R. rugosa, a gene with full length cDNA of 1161
   
  bp, encoding 386 amino acids, designated as RrGT1, were isolated from flowers of R. rugosa 
  “
  Zizhi
  ”
   and then functionally characterized. Sequence alignments with the NCBI database show
   
  that the RrGT1 protein is a member of the GTB superfamily and has typical conserved amino acid residues called PSPG that are crucial for RrGT1 enzyme activity. RrGT1 transcripts were detected in five flowering stages and seven tissues of R. rugosa 
  “
  Zizhi
  ”
   and their expression patterns corresponded with the accumulation of anthocyanins. Additionally, the in vivo function of RrGT1 was investigated via its overexpression in tobacco. Transgenic tobacco plants expressing RrGT1 induced anthocyanin accumulation in flowers, indicating that RrGT1 could encode a functional glycosyltransferase (GT) protein for anthocyanin biosynthesis and could function in other species. Therefore, we speculated that glycosylation of RrGT1 play
  ed
   a crucial role in anthocyanin biosynthesis in R. rugosa.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Rosa rugosa&lt;/i&gt;</kwd><kwd> &lt;i&gt;RrGT1&lt;/i&gt; Gene</kwd><kwd> Gene Expression</kwd><kwd> Overexpression</kwd><kwd> Tobacco</kwd><kwd> Anthocyanin</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Rosa rugosa is an important ornamental plant which belongs to the genus Rosa in the family Rosaceae. It is native to China and is widely distributed in the world. Because of its unique fragrance, color, cold resistance and drought resistance, it has great development potential in garden application [ 1 ]. There are many varieties of roses, but most of them are traditional colors such as pink, purple, etc. A few varieties are white, lacking yellow, bright red, orange and compound color, etc. [ 2 ]. Therefore, how to innovate rose color has become the main goal of breeders. The analysis of the pigment composition of rose and the study of the expression characteristics of the key enzymes encoding genes that catalyze the synthesis of rose pigment are the important prerequisite for rose color oriented molecular breeding [ 3 ]. Anthocyanin determines the color of higher plant organs. Its biosynthesis pathway related structural genes (CHS, CHI, F3H, F3’H, DFR, ANS, 3GT etc.) and regulatory genes (MYB, mostly R2R3-MYB, BHLH and WD40 classes) have been cloned, sequenced and protein function studies in many plants, such as petunia, maize, snapdragon and so on [ 4 - 13 ]. But less research has been done on R. rugosa.</p><p>Anthocyanins, derived from the anthocyanin biosynthesis pathway, are the largest group of water-soluble plant flavonoids found in organs of plants and crops [ 14 ] [ 15 ]. Anthocyanins are unstable in plants, mainly in the form of glycosides in the vacuole [ 16 ]. Anthocyanins play an important role in insect pollination, auxin transport, protection of leaves from ultraviolet radiation, inhibition of diseases and insect pests, etc. [ 17 ]. In addition, as a safe, non-toxic natural food pigment, anthocyanins also have anti-oxidation, anti-cancer and anti-arteriosclerosis functions [ 7 ].</p><p>Anthocyanin biosynthesis pathway is one of the secondary metabolic pathways in plants. At present, the research on it has been more clear. Firstly, naringin was formed by the catalysis of CHS and CHI with coumaryl coenzyme A and malonyl Co A. Then flavonols were formed under the action of F3H. The next step is to form colored anthocyanins under the action of DFR and ANS. Finally, through glycosylation, methylation, acylation, hydroxylation and other modifications to form a variety of anthocyanins with a stable structure [ 18 ]. Flavonoid 3-0-glycosyltransferase (3GT) gene is a downstream gene in anthocyanin synthesis pathway. It can catalyze the glycosylation of UDP glucose to replace the 3 hydroxyl groups of anthocyanin and make anthocyanin glycosylation to produce colored and stable anthocyanins. And move the maximum absorption spectrum to the ultraviolet end, thus increasing the blue tone of anthocyanins [ 19 ]. Glycosylation can change the hydrophilicity, biochemical activity and subcellular localization of anthocyanins, which is beneficial to the transport and storage of anthocyanins in cells and organisms [ 20 ].</p><p>Some studies have shown that the anthocyanin content of plants lacking 3GT also decreased significantly [ 21 ]. 3GT gene belongs to a glycosyltransferase (GTs) family 1, whose enzyme protein has a conserved domain of about 44 amino acids at its C-terminal, known as plant secondary product glycosyltransferase (PSPG) box. At present, 3GT has been cloned and analyzed in many plants such as Zea mays [ 22 ], Vitis vinifera [ 23 ], Gentiana trflora [ 24 ], Petunia hybrida [ 25 ] and so on, which has laid a foundation for understanding the metabolic regulation of anthocyanin synthesis pathway.</p><p>At present, the studies on R. rugosa are mainly focused on morphological classification, geographical distribution, essential oil extraction and food quality evaluation, and there are few reports on the anthocyanin biosynthesis mechanism, so we don’t know exactly how it works. In this study, based on the R. rugosa transcriptome data, we cloned and identified RrGT1 gene from the petals of R. rugosa “Zizhi”. Stable transformation of the RrGT1 gene in tobacco showed that its overexpression was positively correlated with the accumulation of anthocyanins. We hope that the results of our research can provide some useful informations for the subsequent color improvement project in R. rugosa.</p></sec><sec id="s2"><title>2. Materials and methods</title><sec id="s2_1"><title>2.1. Plant Materials</title><p>For R. rugosa, R. rugosa “Zizhi” plants cultivated in the Rosa germplasm nursery of Shandong Agricultural University were used as test material. We collected petals at the budding stage, initial opening stage, half opening stage, full opening stage and wilting stage as well as seven different tissue samples (roots, stems, leaves, petals at the budding stage, sepals, stamens and pistils) in the mornings of sunny days from 20 April to 10 May 2017. After flash freezing in liquid nitrogen, all samples, which were collected in triplicate, were put into a −80˚C refrigerator for storage.</p><p>For tobacco, the wild type was used as transgenic material. After the disinfection of soaking tobacco seeds with 70% - 75% ethanol for 2 min, rinsing them with aseptic water once, soaking with 3.5% NaClO for 10 - 15 min, then rinsing with aseptic water for 5 times, the seeds were sown in Murashige and Skoog (MS) solid medium (without antibiotics). After 3 days of vernalization at 4˚C in darkness, the seeds were placed in a growth chamber (25˚C, 16 h/23˚C, 8 h day/night, 60% relative humidity) for approximately 30 days. The germless tobacco seedlings with good growth conditions were selected as follow-up experimental materials.</p></sec><sec id="s2_2"><title>2.2. Extraction of Total RNA and Synthesis of First-Strand cDNA</title><p>The total RNA was extracted via an EASY Spin Plant RNA Rapid Extraction Kit (Aidlab Biotech, Beijing, China) in accordance with the manufacturer’s specifications. The integrity of the RNA was measured by gel electrophoresis with 1.0% nondenatured agarose (<xref ref-type="fig" rid="fig1">Figure 1</xref>), the purity and concentration of the RNA were detected by a Nanodrop 2000 C ultra-microspectrophotometer (Thermo Fisher Scientific, Wilmington, Delaware, USA), and the qualified RNA was preserved at −80˚C. First-strand cDNA was synthesized via a 5&#215; All-In-One RT MasterMix Reverse Transcription Kit (ABM Company, Vancouver, Canada) in accordance with both the manufacturer’s protocol and the requirements of RT-PCR and qRT-PCR.</p></sec><sec id="s2_3"><title>2.3. Full-Length CDS Cloning of the RrGT1 Gene</title><p>3’RACE specific primers were designed based on the sequence information provided by the R. rugosa transcriptome data. The cDNA 3’terminal sequence of the target gene was amplified by 3’RACE technology. The known target gene sequence in transcriptome data and the 3’terminal sequence obtained by RACE technique were spliced with DNAMAN software to obtain the full-length cDNA sequence of the RrGT1 gene. According to the sequence obtained by splicing, the upstream primer RrGT1-F containing the starting codon of the RrGT1 gene and the downstream primer RrGT1-R containing the terminating codon were designed and amplified. The estimated length of amplification was 1161bp.</p></sec><sec id="s2_4"><title>2.4. Tobacco Stable Transformation</title><p>The plasmids of a pCAMBIA1304 vector and RrGT1 gene with restriction sites (SpeI and BstEII) were extracted and digested by double enzymes. The digestion products were then ligated with DNA ligase and transformed into Agrobacterium tumefaciens.</p><p>A. tumefaciens mediated leaf disks transformation [ 26 ] was used to transform tobacco. Firstly, the leaves of the cultured tobacco sterile seedlings were pruned to the appropriate size. A. tumefaciens infection was carried out after 2 days of pre culture. Acetosyringone (AS) was added to the infective liquid, and the pCAMBIA1304 empty carrier was used as the control. After infection, the plants were subjected to a dark treatment for 2 days, after which they were allowed to be cultured in a growth chamber (25˚C, 16 h/23˚C, 8 h day/night, 60% relative humidity). Differentiation culture and rooting culture were carried out on MS medium supplemented with related hormones and antibiotics. Hygromycin (Hyg) was used to screen resistant seedlings. The plantlets with good growth potential were transplanted into small flowerpots with substrate after seedling refining, and the original growth environment was maintained.</p></sec><sec id="s2_5"><title>2.5. qRT-PCR Detection</title><p>We analyzed the gene expression by qRT-PCR on a Bio-Rad CFX96<sup>TM</sup> Real-Time PCR instrument (Bio-Rad, Inc., USA). The qRT-PCR mixture (total volume of 20 μL) contained 10 μL of SYBR<sup>&#210;</sup> Premix Ex Taq<sup>TM</sup> (TaKaRa, Inc., Japan), 8.2 μL of ddH<sub>2</sub>O, 0.4 μL of each primer and 1 μL of cDNA. The PCR program consisted of an initial step of 95˚C for 30 s; 40 cycles of 95˚C for 5 s and 60˚C for 30 s; and then a dissociation stage of 95˚C for 10 s, 65˚C for 5 s and 95˚C for 5 s. Each gene was assessed via three biological replicates. The relative expression levels of the genes were calculated by the 2<sup>−ΔΔCt</sup> method [ 27 ].</p></sec><sec id="s2_6"><title>2.6. Total Anthocyanin Extractions and HPLC Analysis</title><p>All samples (0.1 g fresh weight) were homogenized in liquid nitrogen, after which they were extracted with 5 mL of an acidic methanol solution (70:0.1:29.9, v/v/v; CH<sub>3</sub>OH:HCl:H<sub>2</sub>O) at 4˚C in darkness for 24 h and then sonicated for 30 min [ 28 ]. After centrifugation, each extract was passed through a membrane filter (0.22 mm). The extraction and measurement of all samples were followed by the protocol described using a UV-Visible Spectrophotometer (UV2600, Shimadzu). The aqueous phase was used to determine the absorbance at 530 nm and 657 nm. The total anthocyanin contents were quantified via the following equation: Q<sub>Anthocyanins</sub> = (A<sub>530</sub> − 0.25 &#215; A<sub>657</sub>) &#215; M<sup>−1</sup>, where Q<sub>Anthocyanins</sub><sub> </sub>is the amount of anthocyanins, A<sub>530</sub> and A<sub>657</sub> are the absorptions at the indicated wavelengths, and M is the weight of the plant material in grams used for extraction.</p></sec></sec><sec id="s3"><title>3 Results</title><sec id="s3_1"><title>3.1. Cloning of RrGT1 and Sequence Analysis</title><p>In the early stage, we screened out the RrGT1 gene by comparing the differentially expressed genes in anthocyanin pathway in the R. rugosa transcriptome data of our laboratory. We obtained the RrGT1 gene 3' terminal sequence of 277 bp length by using nested PCR method (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)). The full-length sequence (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)) of the RrGT1 gene was cloned by full-length primers (<xref ref-type="table" rid="table1">Table 1</xref>) and confirmed by sequencing. The RrGT1 gene has a complete open reading frame from the starting codon ATG to the termination codon TAA, encodes a 386-amino acids protein and has a polyA tail (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Sequence alignments with the NCBI database showed the RrGT1 protein is a member of the GTB superfamily and has a typical plant secondary product glycosyltransferases conserved domain called PSPG consisting of 44 amino acid residues at the C-terminal.</p></sec><sec id="s3_2"><title>3.2. Temporal and Spatial Expression Patterns of the RrGT1 Gene</title><p>The expression levels of the RrGT1 gene in R. rugosa “Zizhi”, which significantly differed, were assessed during five flowering stages (<xref ref-type="fig" rid="fig4">Figure 4</xref>(a)). The highest expression level was observed during the full opening stage, and the lowest was observed during the budding stage.</p><p>The expression levels of the RrGT1 gene in R. rugosa “Zizhi”, which also significantly differed, were assessed in seven different tissue types (<xref ref-type="fig" rid="fig4">Figure 4</xref>(b)). The expression level in the leaves, stems and flower buds was relatively high but was relatively low in the other tissues.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used in the present study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer Name</th><th align="center" valign="middle" >Sequence(5'-3')</th><th align="center" valign="middle" >Description</th></tr></thead><tr><td align="center" valign="middle" >3'RrGT1-F-outer 3'RrGT1-F-inner B26 RrGT1-F RrGT1-R p-RrGT1-F p-RrGT1-R CpR-F CpR-R RrGAPDH-F RrGAPDH-R qRrGT1-F qRrGT1-R NtACT-F NtACT-R</td><td align="center" valign="middle" >ATGTCTTGGTCCTCGCATTTC GAGGGGAAGAAGATGAGAGGTAAAG GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT ATGTCAGGAAATCCACTGGATGC TTAAGGCGAAGAAATCAAATCTACC ACTAGTATGTCAGGAAATCCACTGGATGC GGTGACCTTAAGGCGAAGAAATCAAATCTACC ATGGTAGATCTGACTAGTATGTCAGG CGAGCTGGTGACCTTAAGGC TTCTGCCTGCTCTCAATG TGCCTTCTTCTCAAGTCTG GTATTTGCCAACACACTGAGTAA CTGCAGTGGTAATGAGAGGGAG AGGGTTTGCTGGAGATGATG CGGGTTAAGAGGTGCTTCAG</td><td align="center" valign="middle" >3′RACE for RrGT1 Full-length cDNA for RrGT1 Generation for pCAMBIA1304-RrGT1 Confirmation for pCAMBIA1304-RrGT1 qRT-PCR for RrGAPDH qRT-PCR for RrGT1 qRT-PCR for NtACT</td></tr></tbody></table></table-wrap><p>Restriction enzyme site are underlined.</p></sec><sec id="s3_3"><title>3.3. Construction and Verification of Recombinant Expression Vector pCAMBIA1304-RrGT1</title><p>The empty vector and target gene were digested separately (<xref ref-type="fig" rid="fig5">Figure 5</xref>(a)) and linked together according to the pre-designed vector recombination technique route. In order to verify whether the recombination was successful, we designed a pair of specific primers (<xref ref-type="table" rid="table1">Table 1</xref>) to detect the transformation results by</p><p>PCR, and the results showed positive (<xref ref-type="fig" rid="fig5">Figure 5</xref>(b)). In order to eliminate the possibility of false positivity and to further verify whether the target gene had been mutated or deleted during the recombination, we identified the target gene by double enzyme digestion and sequencing. The results of double enzyme digestion (<xref ref-type="fig" rid="fig5">Figure 5</xref>(c)) showed that the recombinant vector was cut into two distinct fragments: one part of the original vector and the other part of the target gene. The plasmid of the empty vector was used as the control. The sequencing results also showed that there was no base mutation and deletion in the target gene fragment of the embedded vector. The results above showed that the recombinant expression vector pCAMBIA1304-RrGT1 was constructed successfully.</p></sec><sec id="s3_4"><title>3.4. Overexpression of the RrGT1 Gene Enhanced Anthocyanin Accumulation in Tobacco</title><p>The RrGT1 gene was ectopically expressed in tobacco using the binary vector pCAMBIA1304-RrGT1. Six independent transgenic tobacco lines that overexpressed the RrGT1 gene were obtained from Hyg-resistance selection and were cultured under the same conditions. PCR analysis confirmed the presence of the transformed RrGT1 gene in all transgenic lines, and the absence of endogenous RrGT1 in control group (wild-type) and empty vector group (plant was transformed with empty pCAMBIA1304 vector) tobacco plants. After RT-PCR (<xref ref-type="fig" rid="fig6">Figure 6</xref>(a)) and qRT-PCR (<xref ref-type="fig" rid="fig6">Figure 6</xref>(b)) tests, we excluded three false-positive lines, and the three identified transgenic lines, T1, T4, and T6, were used for further experiments.</p><p>Interestingly, there is no substantial difference in morphology between the transgenic plants and wild-type. However, transgenic tobacco lines harboring RrGT1 were affected in flower color, with a remarkable deepening of petal pigmentation compared with the control group and empty vector group tobacco</p><p>plants (<xref ref-type="fig" rid="fig6">Figure 6</xref>(c)). This change in the corolla color of transgenic tobacco was already visible prior to anthesis. To confirm that the deeper flower color was attributed from an increased pigment levels synthesized from the anthocyanin pathway, the total anthocyanins were determined. In the transgenic tobacco lines T1, T4, and T6, anthocyanin contents were improved to 2.58-, 2.03-, and 1.67-fold, respectively, as compared to the control group and empty vector group tobacco plants (<xref ref-type="fig" rid="fig6">Figure 6</xref>(e)). Notably, the expression of RrGT1 in transgenic tobacco correlated with the pigmentation enhancement observed in the petals.</p></sec><sec id="s3_5"><title>3.5. The Expression Patterns of RrGT1 in Transgenic Tobacco</title><p>The expression patterns of the RrGT1 gene in three transgenic tobacco lines were analyzed by qRT-PCR (<xref ref-type="fig" rid="fig6">Figure 6</xref>(d)). The expression levels of RrGT1, which significantly differed, were assessed in four different tissue types. The expression level in the leaves and flowers was relatively high but was relatively low in the stems and roots. Of all the tissue types of the three transgenic lines, the highest gene expression was T1, followed by T4, and the lowest was T6.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Although many genes have been reported to regulate the formation of flower color, there are few reports of downstream structural genes such as GTs. The final formation of anthocyanins depends on the glycosylation of GTs, so it is very important to elucidate the function and influence of the RrGT1 gene in R. rugosa color formation. In this study, we successfully cloned RrGT1 gene with full length cDNA of 1161 bp, encoding 386 amino acids from the petals of R. rugosa “Zizhi”.</p><p>The expression levels of the RrGT1 gene during flower development and in different tissues were investigated. It was found that the expression of the RrGT1 gene showed a different trend during different flowering periods in R. rugosa “Zizhi”, indicating that the expression of the RrGT1 gene was developmentally regulated in the process of anthocyanin biosynthesis. Studies have shown that the accumulation of anthocyanin in red skinned sand pear, strawberries and litchi is positively correlated with the activity of UF3GT. Boss et al. [ 29 ] also detected the expression of UF3GT in the peels of red grape which accumulated anthocyanin, but not in other tissues of red grape and white grape without anthocyanin accumulation. Gong et al.’s [ 30 ] studies showed that the partial structural genes of Perilla frutescens anthocyanin metabolic pathway were only expressed in the leaves of red varieties, but not in green varieties or the expression in the green leaves was very low. About the tissue-specific expression in R. rugosa “Zizhi”, besides the high expression level in flowers, it is worth mentioning that the stems of R. rugosa “Zizhi” are purple, which is consistent with the high expression level of the RrGT1 gene. In addition, RrGT1 was also highly expressed in the leaves, so we infer that RrGT1 is also involved in the glycosylation of secondary metabolites in leaves and plays an important role.</p><p>To investigate the function of the RrGT1 gene in anthocyanin biosynthesis in vivo, RrGT1 was first transferred into tobacco, which resulted in flower coloration enhancement of transgenic tobacco plants. It was found that the anthocyanins contents in the flowers of the three transgenic tobacco lines increased in varying degrees after the determination of the total anthocyanins contents. Therefore, it can be preliminarily confirmed that this result was caused by the overexpression of the RrGT1 gene. And it also indicated that RrGT1 could encode a functional glycosyltransferase (GT) protein for anthocyanin biosynthesis. In addition, after analyzing the tissue-specific expression of various transgenic tobacco lines, we found that the RrGT1 gene was highly expressed not only in flowers but also in leaves. This phenomenon was consistent with the results of tissue specific expression analysis in the R. rugosa “Zizhi”. Therefore, we speculated that the RrGT1 gene may play an important role in the regulation of the growth and development of leaves even the whole plants in addition to the anthocyanin biosynthesis pathway. So, the results of the transgenic experiment proved that the exogenous RrGT1 enzymes can also affect the synthesis of anthocyanins in different species. In other words, the function of RrGT1 in anthocyanin biosynthesis and other aspects can be exchanged among different plant species.</p><p>In conclusion, we cloned the the RrGT1 gene from R. rugosa “Zizhi” and proved by overexpression in tobacco that it could affect anthocyanin accumulation and thus the flower color. We believed that this research was beneficial to analyzing the molecular synthesis and regulation mechanism of anthocyanins, and also provided some important informations for the improvement of R. rugosa flower color in the future.</p></sec><sec id="s5"><title>Fund</title><p>This project was supported by the Agricultural Seed Project of Shandong Province ([<xref ref-type="bibr" rid="scirp.87808-ref2014">2014</xref>] No. 96).</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.</p></sec><sec id="s7"><title>Abbreviations</title><p>cDNA, complementary DNA;</p><p>RACE, rapid amplification of cDNA ends;</p><p>CDS, coding DNA sequence;</p><p>PCR, polymerase chain reaction;</p><p>qRT-PCR, quantitative real-time polymerase chain reaction;</p><p>HPLC, high-performance liquid chromatography.</p></sec><sec id="s8"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.87808-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Li, M. (2006) Survey and Quality Evaluation of Shandong Rose Varieties. Shandong University of Traditional Chinese Medicine, Jinan.</mixed-citation></ref><ref id="scirp.87808-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Feng, L.G., Shao, D.W., Sheng, L.X., et al. (2009) Study on Investigation and Morphological Variation of Wild Rosa rugosa in China. Journal of Shandong Agricultural University (Natural Science Edition), 40, 484-488.</mixed-citation></ref><ref id="scirp.87808-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Chen, S.M., Zhu, X.R., Chen, F.D., et al. (2010) Expression Characteristics of Anthocyanin Structural Genes in Different Flower Color Chrysanthemum Cultivars. Journal of Northwest Plants, 3, 453-458.</mixed-citation></ref><ref id="scirp.87808-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Aizza, L.C. and Domelas, M.C. (2011) A Genomic Approach to Study Anthocyanin Synthesis and Flower Pigmentation in Passion Flowers. Journal of Nucleic Acids, 5, 371517.</mixed-citation></ref><ref id="scirp.87808-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Mehdy, M.C. and Lamb, C.J. (1988) Chalcone Isomerase cDNA Cloning and mRNA Induction by Fungal Elicitor, Wounding and Infection. Plant Physiology, 86, 182-186. https://doi.org/10.1104/pp.86.1.182</mixed-citation></ref><ref id="scirp.87808-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Liu, J., Feng, Q.F. and Zhang, J. (2005) Dihydroflavonol 4-Reductase Gene (DFR) and Flower Color Modulation. Plant Physiology Communications, 41, 715-719.</mixed-citation></ref><ref id="scirp.87808-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Springob, K., Nakajima, J.I., Yamazaki, M., et al. (2003) Recent Advances in the Biosynthesis and Accumutation of Anthocyanins. Natural Product Reports, 20, 288-303. https://doi.org/10.1039/b109542k</mixed-citation></ref><ref id="scirp.87808-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Rosati, C., Cadic, A., Duron, M., et al. (1999) Molecular Characterization of the Anthocyanidin Synthase Gene in Forsythia × Intermedia Reveals Organ-Specific Expression during Flower Development. Plant Science, 149, 73-79. https://doi.org/10.1016/S0168-9452(99)00146-6</mixed-citation></ref><ref id="scirp.87808-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Guo, F.D., Wang, X.Z., Wang, X.J., et al. (2011) Metabolic Regulation of Plants Anthocyanin. Chinese Bulletin of Life Sciences, 23, 938-944.</mixed-citation></ref><ref id="scirp.87808-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Ludwig, S.R., Habera, L.F., Dellaporta, S.L., et al. (1989) Lc, a Member of the Maize R Gene Family Responsible for Tissue-Specific Anthocyanin Production, Encodes a Protein Similar to Transcriptional Activators and Contains the myc-Homology Region. Proceedings of the National Academy of Sciences of the USA, 86, 7092-7096.  
https://doi.org/10.1073/pnas.86.18.7092</mixed-citation></ref><ref id="scirp.87808-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Carey, C.C., Strahle, J.T., Selinger, D.A., et al. (2004) Mutations in the Pale Aleurone Color1 Regulatory Gene of the Zea mays Anthocyanin Pathway Have Distinct Phenotypes Relative to the Functionally Similar Transparent Testa GLABRA1 Gene in Arabidopsis thaliana. The Plant Cell, 16, 450-464. https://doi.org/10.1105/tpc.018796</mixed-citation></ref><ref id="scirp.87808-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Grotewold, E. (2006) The Genetics and Biochemistry of Floral Pigments. Annual Review of Plant Biology, 57, 761-780. https://doi.org/10.1146/annurev.arplant.57.032905.105248</mixed-citation></ref><ref id="scirp.87808-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Allan, A.C., Hellens, R.P. and Laing, W.A. (2008) MYB Transcription Factors That Colour Our Fruit. Trends in Plant Science, 13, 99-102. https://doi.org/10.1016/j.tplants.2007.11.012</mixed-citation></ref><ref id="scirp.87808-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Kim, S.H., Lee, J.R., Hong, S.T., et al. (2003) Molecular Cloning and Analysis of Anthocyanin Biosynthesis Genes Preferentially Expressed in Apple skin. Plant Science, 165, 403-413.  
https://doi.org/10.1016/S0168-9452(03)00201-2</mixed-citation></ref><ref id="scirp.87808-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Martens, S., Preu&amp;szlig, A. and Matern, U. (2010) Multifunctional Flavonoid Dioxygenases: Flavonol and Anthocyanin Biosynthesis in Arabidopsis thaliana L. Phytochemistry, 71, 1040-1049.  
https://doi.org/10.1016/j.phytochem.2010.04.016</mixed-citation></ref><ref id="scirp.87808-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Ge, C.L., Huang, C.H. and Xu, X.B. (2012) Research on Anthocyanins Biosynthesis in Fruit. Acta Horticulturae Sinica, 39, 1655-1664.</mixed-citation></ref><ref id="scirp.87808-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Forkmann, G. (2010) Flavonoids as Flower Pigments: The Formation of the Natural Spectrum and Its Extension by Genetic Engineering. Plant Breeding, 106, 1-26. https://doi.org/10.1111/j.1439-0523.1991.tb00474.x</mixed-citation></ref><ref id="scirp.87808-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Yonekura-Sakakibara, K., Nakayama, T., Yamazaki, M., et al. (2009) Modification and Stabilization of Anthocyanins. Springer, New York, 169-190.</mixed-citation></ref><ref id="scirp.87808-ref19"><label>19</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Zheng</surname><given-names> Z.L. </given-names></name>,<etal>et al</etal>. (<year>1994</year>)<article-title>Flower Color Gene Engineering of Flower Crops</article-title><source> Northern Horticulture</source><volume> 3</volume>,<fpage> 37</fpage>-<lpage>38</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.87808-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Vogt, T. and Jones, P. (2000) Glycosyltransferases in Plant Natural Product Synthesis: Characterization of a Supergene Family. Trends in Plant Science, 5, 380-386. https://doi.org/10.1016/S1360-1385(00)01720-9</mixed-citation></ref><ref id="scirp.87808-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Tohge, T., Nishiyama, Y., Hirai, M.Y., et al. (2005) Functional Genomics by Integrated Analysis of Metabolome and Transcriptome of Arabidopsis Plants Over-Expressing an MYB Transcription Factor. The Plant Journal, 42, 218-235. https://doi.org/10.1111/j.1365-313X.2005.02371.x</mixed-citation></ref><ref id="scirp.87808-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Goto, T., Kondo, T., Tamura, H., et al. (1982) Structure of Gentiodelphin, an Acylated Anthocyanin Isolated from Gentiana makinoi, That Is Stable in Dilute Aqueous Solution. Tetrahedron Letters, 23, 3695-3698.  
https://doi.org/10.1016/S0040-4039(00)88660-8</mixed-citation></ref><ref id="scirp.87808-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Hall, D., Yuan, X.X., Murata, J., et al. (2012) Molecular Cloning and Biochemical Characterization of the UDP-Glucose: Flavonoid 3-0-Glucosyltransferase from Concord Grape (Vitis labrusca). Phytochemistry, 74, 90-99. https://doi.org/10.1016/j.phytochem.2011.10.007</mixed-citation></ref><ref id="scirp.87808-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Tanaka, Y., Yoshikazu, K., Fukuchi-Mlizutani, M., et al. (1996) Molecular and Biochemical Characterization of Three Anthocyanin Synthetic Enzymes from Gentiana triflora. Plant and Cell Physiology, 37, 711-716.  
https://doi.org/10.1093/oxfordjournals.pcp.a029004</mixed-citation></ref><ref id="scirp.87808-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Yamazaki, M., Yamagishi, E., Gong, Z.Z., et al. (2002) Two Flavonoid Glucosyltransferases from Petunia hybrida: Molecular Cloning, Biochemical Properties and Developmentally Regulated Expression. Plant Molecular Biology, 48, 401-411. https://doi.org/10.1023/A:1014043214943</mixed-citation></ref><ref id="scirp.87808-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Horsch, R., Fry, J.E., Hoffmann, N.L., et al. (1985) A Simple and General Method for Transferring Genes into Plants. Science, 227, 1229-1232. https://doi.org/10.1126/science.227.4691.1229</mixed-citation></ref><ref id="scirp.87808-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Schmittgen, T.D. and Livak, K.J. (2008) Analyzing Real-Time PCR Data by the Comparative C(T) Method. Nature Protocols, 3, 1101. https://doi.org/10.1038/nprot.2008.73</mixed-citation></ref><ref id="scirp.87808-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Yang, Q., Yuan, T. and Sun, X.B. (2015) Preliminary Studies on the Changes of Flower Color during the Flowering Period in Two Tree Peony Cultivars. Acta Horticulturae Sinica, 42, 930-938.</mixed-citation></ref><ref id="scirp.87808-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Boss, P.K., Davies, C. and Robinson, S.P. (1996) Expression of Anthocyanin Biosynthesis Pathway Genes in Red and White Grapes. Plant Molecular Biology, 32, 565-569. https://doi.org/10.1007/BF00019111</mixed-citation></ref><ref id="scirp.87808-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Gong, Z.Z., Yamazaki, M., Sugiyama, M., et al. (1997) Cloning and Molecular Analysis of Structural Genes Involved in Anthocyanin Biosynthesis and Expressed in a Forma-Specific Manner in Perilla frutescens. Plant Molecular Biology, 35, 915-927. https://doi.org/10.1023/A:1005959203396</mixed-citation></ref></ref-list></back></article>