<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJMB</journal-id><journal-title-group><journal-title>American Journal of Molecular Biology</journal-title></journal-title-group><issn pub-type="epub">2161-6620</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajmb.2018.84017</article-id><article-id pub-id-type="publisher-id">AJMB-87613</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Cloning, Expression, Purification, and Crystallization of &lt;i&gt;P. aeruginosa &lt;/i&gt;ICMP
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ruliang</surname><given-names>Pi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jiang</surname><given-names>Gu</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Guangwen</surname><given-names>Lu</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff3"><addr-line>West China Hospital Emergency Department (WCHED), State Key Laboratory of Biotherapy and Cancer Center, West China Hospital, Sichuan University, Chengdu, China</addr-line></aff><aff id="aff1"><addr-line>Chengdu Institute of biological Products Co., Ltd., Chengdu, China</addr-line></aff><aff id="aff2"><addr-line>National Engineering Research Center of Immunological Products, Department of Microbiology and Biochemical Pharmacy, College of Pharmacy, Third Military Medical University, Chongqing, China</addr-line></aff><pub-date pub-type="epub"><day>29</day><month>09</month><year>2018</year></pub-date><volume>08</volume><issue>04</issue><fpage>195</fpage><lpage>204</lpage><history><date date-type="received"><day>30,</day>	<month>July</month>	<year>2018</year></date><date date-type="rev-recd"><day>26,</day>	<month>September</month>	<year>2018</year>	</date><date date-type="accepted"><day>29,</day>	<month>September</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution-NonCommercial International License (CC BY-NC).http://creativecommons.org/licenses/by-nc/4.0/</license-p></license></permissions><abstract><p>
 
 
   
   Pseudomonas aeruginosa 
   (P. aeruginosa) is a common opportunistic human pathogen that can lead to severe diseases in immunocompromised patients. The insulin-cleaving membrane protease (ICMP) of P. aeruginosa plays a
    
   vital role in the pathogenesis of the bacterium and is therefore characterized as an important bacterial virulence factor. In addition, ICMP also serves as a founding member of the M75 peptidase family and represents a prototype of the imelysin/imelysin-like proteins. Despite of its functional importance in the pathogenesis of P. aeruginosa and of a root position as the prototypic imelysin/imelysin-like member, the structural features of the protein remain uninvestigated.
    Since preparation of homogeneous and crystallizable protein species is the prerequisite for structural studies by crystallography, we reported the successful expression, purification, and crystallization of P. aeruginosa ICMP in this study. The protein was over
   -
   expressed in Escherichia coli as a GST-fusion protein, cleaved to remove the fusion tag, and then purified to homogeneity. Diffractable crystals were obtained using the sitting-drop vapour-diffusion method. The crystals diffracted to 2.5 
   &amp;#197;
   
    
   resolution and belonged to space group P2<sub>1</sub>2<sub>1</sub>2<sub>1</sub>, with unit-cell parameters a = 54.47, b = 158.98, c = 162.84 &amp;#197;, α = β = γ = 90<sup>&#176;</sup>. Preliminary analysis of the diffraction data revealed high-quality crystallographic statistics with a Matthews coefficient of about 2.61 &amp;#197;
   <sup>3.</sup>
   Da
   <sup>-1</sup>
    and a solvent content of about 52.58%, indicating the presence of three ICMP molecules in the asymmetric unit. The current work therefore paved the way for future studies aiming to delineate the characteristics of ICMP at the atomic level. 
  
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Pseudomonas aeruginosa&lt;/i&gt;</kwd><kwd> ICMP</kwd><kwd> Metallopeptidase</kwd><kwd> Imelysin/Imelysin-Like Protein</kwd><kwd> Crystallographic Analysis</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Pseudomonas aeruginosa (P. aeruginosa) is an opportunistic human pathogen that often colonizes immunocompromised patients and one of the main bacterial pathogens which may cause severe lung deterioration in cystic fibrosis patients [<xref ref-type="bibr" rid="scirp.87613-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.87613-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.87613-ref3">3</xref>] . It is always classified as one of the top three most frequent gram-negative pathogens and is linked to the worst visual diseases [<xref ref-type="bibr" rid="scirp.87613-ref4">4</xref>] . Also, it has multidrug-resistance and the ability to develop new resistances during antibiotic treatment, so it becomes not controlled and eliminated [<xref ref-type="bibr" rid="scirp.87613-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.87613-ref6">6</xref>] .</p><p>Different extracellular virulence factors of P. aeruginosa like hemolysins, exoenzyme S, and exotoxin A play important roles in its pathogenesis [<xref ref-type="bibr" rid="scirp.87613-ref7">7</xref>] . An out member protein of P. aeruginosa, which was designated as the insulin-cleaving membrane protease (ICMP), was first characterized as a zinc peptidase [<xref ref-type="bibr" rid="scirp.87613-ref8">8</xref>] . This bacterial protein harbors the capacity of cleaving insulin B chain between Glu13-s-Ala14, Tyr16-s-Leu17, Phe25-s-Tyr26, and His10-s-Leu11, and is therefore characterized as a putative virulence factor of P. aeruginosa [<xref ref-type="bibr" rid="scirp.87613-ref8">8</xref>] . ICMP contains a conserved HXXE motif which was commonly observed in the MEROPS [<xref ref-type="bibr" rid="scirp.87613-ref9">9</xref>] metallopeptidase family, and has been shown to bind to zinc metal to perform its peptidase activity [<xref ref-type="bibr" rid="scirp.87613-ref8">8</xref>] . In MEROPS, ICMP serves as the founding member of the M75 peptidase family and represents a prototype of the imelysin/imelysin-like proteins [<xref ref-type="bibr" rid="scirp.87613-ref9">9</xref>] .</p><p>In addition to cleaving insulin during the pathogenesis of the bacterium, ICMP was also implicated as a virulence factor involved in iron uptake. As an essential nutrient for bacterial growth, iron is poorly soluble at physiological pH and toxic in the presence of O<sub>2</sub>. As a result, bacteria have evolved to contain complicated and versatile regulation systems on iron uptake and metabolism [<xref ref-type="bibr" rid="scirp.87613-ref10">10</xref>] . Like most bacterial pathogens, P. aeruginosa exhibits impressive capacity to retrieve iron from a variety of natural sources through a multiplicity of systems for the active transport of iron to infect the host and to multiply within tissues [<xref ref-type="bibr" rid="scirp.87613-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.87613-ref12">12</xref>] . ICMP genetically organized in an imelysin operon (PA4370-PA4373) is regulated by Fur (ferric uptake regulation) [<xref ref-type="bibr" rid="scirp.87613-ref13">13</xref>] . The genomic context of all previously characterized imelysins bears substantial similarity to iron-transporter EfeUOB which was characterized in Escherichia coli O157:H7 [<xref ref-type="bibr" rid="scirp.87613-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.87613-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.87613-ref16">16</xref>] . It is also a homologous protein to IrpA (iron regulated protein A) which has been experimentally demonstrated to be essential for growth under iron-deficient conditions in the cyanobacteria Synechococcus sp. [<xref ref-type="bibr" rid="scirp.87613-ref17">17</xref>] . Therefore, ICMP has an important role in iron uptake.</p><p>Despite of the functional importance of ICMP in the pathogenesis of P. aeruginosa, the high resolution structure of this protein, however, remains unknown thus far. Several previous studies have reported the structures of imelysin/imelysin-like proteins, including the imelysin-like protein from Psychrobacter arcticus (IPPA), the permuted imelysin from Bacteroides ovatus (PIBO) [<xref ref-type="bibr" rid="scirp.87613-ref18">18</xref>] , and the alginate-binding protein from Sphingomonas sp. A1 (Algp7) [<xref ref-type="bibr" rid="scirp.87613-ref19">19</xref>] . These structures have revealed an all-helical fold with sterically conserved HXXE motif-residues [<xref ref-type="bibr" rid="scirp.87613-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.87613-ref19">19</xref>] . However, no peptidase activity could be detected for these imelysin-like proteins [<xref ref-type="bibr" rid="scirp.87613-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.87613-ref19">19</xref>] . It is obvious that ICMP exhibits very little sequence identities to these proteins (15.30% to IPPA, 12.89% to PIBO, and 11.43% to Algp7). Therefore, it is an interesting scientific question that how the ICMP-structure differs from those of other imelysin/imelysin-like proteins represented by IPPA, PIBO, and Algp7. In light of its significant role in the pathogenesis of P. aeruginosa, we set out to determine the structure of ICMP, aiming to delineate the mechanism of ICMP catalysis and to facilitate the structure-directed drug design. In the present study, we reported the cloning, expression, purification, and crystallization of ICMP. A data set was collected to 2.5 &#197; resolution using the synchrotron radiation. The preliminary crystallographic analysis of the diffraction data was also conducted.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Cloning, Expression and Purification of ICMP</title><p>The ICMP protein from P. aeruginosa PAO1 (NP_253060.1) [<xref ref-type="bibr" rid="scirp.87613-ref20">20</xref>] , which contains 446 residues, was selected for the crystallographic studies in this report. To facilitate soluble expression of the ICMP protein, the predicted N-terminal lipoprotein signal peptide (residues 1 to 19) and a small hydrophobic region directly following this lipoprotein signal (residues 20 to 48) were not included in the expression construct. The resultant DNA fragment encoding ICMP amino acids 49 - 446 was then cloned into the pGEX-6P-1 (GE Healthcare) vector via the BamH I and XhoI enzymes. The recombinant protein expressed from this vector therefore, it contains a GST tag followed by a PreScission Protease (PSP) cleavage site at the N-terminus of ICMP. The recombinant plasmid was transformed into Escherichia coli BL21 (DE3) for protein expression. In brief, the transformants were grown at 37˚C overnight on a Luria-Bertani (LB) agar plate containing 100 mg/l ampicillin. A single colony was inoculated into 50 ml LB medium containing 100 mg/l ampicillin and incubated overnight. This pre-culture was then transferred into fresh LB medium supplemented with ampicillin at the ratio of 1:100, and further grown at 37˚C until the culture density (OD600) reached approximately 0.6. Isopropyl-β-D-thiogalactopyranoside (IPTG; Sigma) was then added to the cell culture to a final concentration of 0.1 mM, and the cells were further incubated at 37˚C for about 10 h to induce the expression of the protein.</p><p>For protein purification, the cells were harvested by centrifugation at 5000 g for 10 min at 4˚C, and resuspended in ice-cold buffer consisting of 20 mM Tris-HCl and 150 mM NaCl, pH 8.0. The cell pellet was disrupted using an ultrasonic cell crusher. Cell debris was removed by centrifugation at 16,000 g for 30 min at 4˚C. The crude protein extract was mixed with the GST resin (GE Healthcare) at 4˚C for about 2 h. The resin was then washed with five-column volumes of the buffer composed of 20 mM Tris-HCl, pH 8.0, 150 mM NaCl. After washing, the protein was released from the GST-tag by on-column cleavage at 16˚C for about 2 h with 10 units PSP enzyme/mg fusion protein. The subsequent eluate containing the target protein was then collected, and applied to a Superdex 200 Increase 10/300 GL column (GE Healthcare) pre-equilibrated with a buffer composed of 20 mM Tris-HCl, pH 8.0, 150 mM NaCl at 4˚C to further remove the impurities. The pooled ICMP protein was further concentrated by centrifugation at 4˚C using an Amicon Ultra-15 centrifugal filter device (10 kDa cutoff; Millipore) to 10 mg/ml before using for crystallization screenings. The ICMP-production information is summarized in <xref ref-type="table" rid="table1">Table 1</xref>.</p></sec><sec id="s2_2"><title>2.2. ICMP Crystallization</title><p>The initial screening trial was carried out using the commercial crystallization kits (Hampton Research) via the sitting-drop vapour-diffusion method at 18˚C. The experiments were performed such that 1 μl protein solution at 10 mg/ml</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Protein-production information</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Source organism</th><th align="center" valign="middle" >Pseudomonas aeruginosa</th></tr></thead><tr><td align="center" valign="middle" >DNA source</td><td align="center" valign="middle" >Genomic DNA</td></tr><tr><td align="center" valign="middle" >Forward primer<sup>†</sup></td><td align="center" valign="middle" >CGGGATTCAAGGTCGACGAGGC</td></tr><tr><td align="center" valign="middle" >Reverse primer<sup>†</sup></td><td align="center" valign="middle" >CCGCTCGAGTCAGAACTCGTGGTCGGCG</td></tr><tr><td align="center" valign="middle" >Expression vector</td><td align="center" valign="middle" >pGEX-6P-1</td></tr><tr><td align="center" valign="middle" >Expression host</td><td align="center" valign="middle" >E. coli BL21(DE3)</td></tr><tr><td align="center" valign="middle" >Complete amino-acid sequence of ICMP</td><td align="center" valign="middle" >MTRMPLATASLLALAISLAGCGDDKKAEAPATPAASTQPAASAAAPAAKVDEAAAKAVIKNYADLAEATFADALSTAKDLQKAIDAFLAKPDAETLKAAKEAWFAARTPYSQSEAFRFGNAIIDDWEGQVNAWPLDEGLIDYVAKDYQHALGNPGATANIVANTEIQVGEDKIDVKEITGEKLASLNELGGSEANVATGYHAIEFLLWGQDLNGTGPGAGNRPATDYAQGKDCTGGHCDRRAAYLKAVTDLLVSDLEYMAGQWKAGVADNYRAKLEAEPVDTGLRKMFFGMGSLSLGELAGERMKVALEANSTEDEHDCFSDDTHHTLFFNGKSIRNIYLGEYKRIDGSVVKGPSLADLVAKADAAANDTLKADLADTEAKLQAIVDSAEKDGVHFDQMIAPDNKDGQQKIRDAIAALVKQTGAIEQAAGKLGIQDLKPDNADHEF</td></tr><tr><td align="center" valign="middle" >Complete amino-acid sequence of the expression construct produced after PSP digestion</td><td align="center" valign="middle" >GPLGSKVDEAAAKAVIKNYADLAEATFADALSTAKDLQKAIDAFLAKPDAETLKAAKEAWFAARTPYSQSEAFRFGNAIIDDWEGQVNAWPLDEGLIDYVAKDYQHALGNPGATANIVANTEIQVGEDKIDVKEITGEKLASLNELGGSEANVATGYHAIEFLLWGQDLNGTGPGAGNRPATDYAQGKDCTGGHCDRRAAYLKAVTDLLVSDLEYMAGQWKAGVADNYRAKLEAEPVDTGLRKMFFGMGSLSLGELAGERMKVALEANSTEDEHDCFSDDTHHTLFFNGKSIRNIYLGEYKRIDGSVVKGPSLADLVAKADAAANDTLKADLADTEAKLQAIVDSAEKDGVHFDQMIAPDNKDGQQKIRDAIAALVKQTGAIEQAAGKLGIQDLKPDNADHEF</td></tr></tbody></table></table-wrap><p><sup>†</sup>The BamHI and XhoI sites are underlined. The ICMP signal peptide and its following small hydrophobic region, which are excluded from the expression construct, are indicated in green and red, respectively. Those vector-derived residues that retain at the N-terminus of ICMP after PSP-digestion are marked in blue.</p><p>was firstly mixed with 1 μl reservoir solution, and then equilibrated against 70 μl reservoir solution in 48-well double-sample sitting-drop crystallization plates. The plates were kept at 18˚C for about one week for the crystals to grow, and the identified conditions were then optimized. Further optimization of the crystallization conditions was then conducted by preparing reservoir solutions with gradually decreased precipitant concentrations. Crystals of good quality were finally obtained in a condition consisting of 1.6 M sodium citrate tri-basic dihydrate at pH 6.5. Crystallization information is summarized in <xref ref-type="table" rid="table2">Table 2</xref>.</p></sec><sec id="s2_3"><title>2.3. Data Collection and Processing</title><p>For data collection, a single crystal was picked up using a nylon loop, immersed into a cryoprotectant solution consisting of the reservoir solution supplemented with 20% glycerol for about 30 s, and then flash-cooled at −173˚C. The diffraction data were collected using the synchrotron radiation at the Shanghai Synchrotron Radiation Facility (SSRF) beamline BL18U1. The collected data were then processed with HKL2000 [<xref ref-type="bibr" rid="scirp.87613-ref21">21</xref>] for indexing, integration, and scaling. Detailed statistics on data collection are summarized in <xref ref-type="table" rid="table3">Table 3</xref>.</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><p>The ICMP protein of P. aeruginosa was initially identified as an outer membrane protein [<xref ref-type="bibr" rid="scirp.87613-ref8">8</xref>] . This protein contains a predicted N-terminal signal peptide consisting of residues 1 - 19 followed by a small region extending from residue 20 to 48 with a majority of hydrophobic amino acids (<xref ref-type="table" rid="table1">Table 1</xref>). To facilitate soluble expression of the ICMP protein, these N-terminal residues were removed from the protein-expression construct. Subsequently, the Pseudomonas ICMP with amino acids 49 - 446 was expressed as a recombinant protein with an N-terminal GST tag in E. coli (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). As expected, the fusion protein is largely expressed in the soluble form, which could be easily purified via affinity chromatography (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). After removal of the GST fusion tag, the target protein was further purified by gel-filtration, in which, the ICMP protein was eluted as a symmetric peak at about 15 ml on a calibrated Superdex 200 Increase 10/300 GL</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Crystallization</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Method</th><th align="center" valign="middle" >Sitting-drop vapour diffusion</th></tr></thead><tr><td align="center" valign="middle" >Plate type</td><td align="center" valign="middle" >48-well plates</td></tr><tr><td align="center" valign="middle" >Temperature (˚C)</td><td align="center" valign="middle" >18</td></tr><tr><td align="center" valign="middle" >Protein concentration (mg∙ml<sup>−1</sup>)</td><td align="center" valign="middle" >10</td></tr><tr><td align="center" valign="middle" >Buffer composition of protein solution</td><td align="center" valign="middle" >20 mM Tris-HCl at pH 8.0, 150 mM NaCl</td></tr><tr><td align="center" valign="middle" >Composition of reservoir solution<sup>†</sup></td><td align="center" valign="middle" >1.6 M sodium citrate tribasic dehydrate at pH 6.5.</td></tr><tr><td align="center" valign="middle" >Volume and ratio of drop</td><td align="center" valign="middle" >1.0 μl, 1:1 ratio of protein: reservoir solution</td></tr><tr><td align="center" valign="middle" >Volume of reservoir</td><td align="center" valign="middle" >70 μl</td></tr></tbody></table></table-wrap><p><sup>†</sup>The condition for ICMP crystallization.</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Data collection and processing</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Diffraction source</th><th align="center" valign="middle" >SSRF-BL18U1</th></tr></thead><tr><td align="center" valign="middle" >Wavelength (&#197;)</td><td align="center" valign="middle" >0.97780</td></tr><tr><td align="center" valign="middle" >Detector</td><td align="center" valign="middle" >Pilatus</td></tr><tr><td align="center" valign="middle" >Crystal-to-detector distance (mm)</td><td align="center" valign="middle" >300</td></tr><tr><td align="center" valign="middle" >Rotation range per image (˚)</td><td align="center" valign="middle" >1</td></tr><tr><td align="center" valign="middle" >Total rotation range (˚)</td><td align="center" valign="middle" >360</td></tr><tr><td align="center" valign="middle" >Exposure time per image (s)</td><td align="center" valign="middle" >0.6</td></tr><tr><td align="center" valign="middle" >Space group</td><td align="center" valign="middle" >P212121</td></tr><tr><td align="center" valign="middle" >Unit-cell parameters (&#197;)</td><td align="center" valign="middle" >a = 54.47, b = 158.98, c = 162.84</td></tr><tr><td align="center" valign="middle" >Resolution range (&#197;)</td><td align="center" valign="middle" >50 - 2.50 (2.50 - 2.59)</td></tr><tr><td align="center" valign="middle" >Total No. of reflections</td><td align="center" valign="middle" >539899</td></tr><tr><td align="center" valign="middle" >No. of unique reflections</td><td align="center" valign="middle" >53128</td></tr><tr><td align="center" valign="middle" >Completeness (%)</td><td align="center" valign="middle" >99.5 (98.6)</td></tr><tr><td align="center" valign="middle" >Average mosaicity (˚)</td><td align="center" valign="middle" >0.300</td></tr><tr><td align="center" valign="middle" >CC1/2</td><td align="center" valign="middle" >0.890</td></tr><tr><td align="center" valign="middle" >Multiplicity</td><td align="center" valign="middle" >10.2 (10.1)</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >18.0 (3.0)</td></tr><tr><td align="center" valign="middle" >R<sub>meas</sub><sup>†</sup> (%)</td><td align="center" valign="middle" >13.3 (66.0)</td></tr></tbody></table></table-wrap><p><sup>† R m e a s = ∑ h k l { N ( h k l ) / [ N ( h k l ) − 1 ] } 1 / 2 ∑ i | I i ( h k l ) − 〈 I ( h k l ) 〉 | / ∑ h k l ∑ i I i ( h k l ) </sup>.</p><p>column (GE) (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)), corresponding to a protein with a molecular weight (MW) of about 44 kDa. Taking into account that the theoretical MW of ICMP is approximately 43.1 kDa, the purified protein therefore exists mainly as a monomer in solution. The final purity of ICMP was demonstrated to be greater than 99% on 15% SDS-PAGE (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). The yield of pure ICMP protein was about 4 mg per litre of cell culture.</p><p>The initial crystallization screening trials for ICMP were carried out by using kits from Hampton Research. The purified protein could be crystallized within a week, and protein crystals were obtained under several conditions. After optimization, good-quality crystals (<xref ref-type="fig" rid="fig2">Figure 2</xref>) were finally selected from a condition consisting of 1.6 M sodium citrate tribasic dihydrate at pH 6.5. A single crystal of approximately 0.08 &#180; 0.08 &#180; 0.06 mm in size diffracted to 2.5 &#197; resolution (<xref ref-type="fig" rid="fig3">Figure 3</xref>). The data-processing statistics are summarized in <xref ref-type="table" rid="table3">Table 3</xref>. The space group of the crystal was P2<sub>1</sub>2<sub>1</sub>2<sub>1</sub> and the unit-cell parameters were a = 54.47, b = 158.98, c = 162.84 &#197;, α = β = γ = 90˚. Overall, the diffraction data were of good</p><p>quality, with an Rmeas of about 0.136 for all resolution shells from 50 to 2.5 &#197;. The Matthews coefficient [<xref ref-type="bibr" rid="scirp.87613-ref22">22</xref>] for the crystal was calculated to be 2.61 &#197;<sup>3</sup>∙Da<sup>−1</sup> with an estimated solvent content of about 52.58%, which indicates the presence of three ICMP molecules in the crystallographic asymmetric unit. The initial molecular-replacement calculations were carried out using the program AmoRe [<xref ref-type="bibr" rid="scirp.87613-ref23">23</xref>] with the structures of IPPA (PDB code 3pf0) [<xref ref-type="bibr" rid="scirp.87613-ref18">18</xref>] , IPBO (PDB code 3oyv) [<xref ref-type="bibr" rid="scirp.87613-ref18">18</xref>] , or Algp7 (PDB code 3at7) [<xref ref-type="bibr" rid="scirp.87613-ref19">19</xref>] as the search model. Nevertheless, no distinct translational peaks were observed, which indicates that it is unlikely to solve the structure of ICMP by molecular-replacement. We are currently preparing the selenomethionine derivative proteins, aiming to determine its structure utilizing the anomalous diffraction signal of the selenium atoms.</p><p>It is notable that preparation of homogeneous and crystallizable proteins is the prerequisite for structural studies by crystallography. In the current study, we managed to obtain the ICMP protein that meets such a criterion by deleting its signal peptide and a small N-terminal region full of hydrophobic residues (commonly detrimental to soluble expression of a protein) and by using a GST-fusion tag (normally beneficial to protein solubility) which could be easily removed afterwards by PSP enzyme digestion. In virtue of the significant role of ICMP in the pathogenesis of P. aeruginosa, the current work therefore has laid the foundation for future structural studies on ICMP and paved the way for delineating the characteristics of the protein at the atomic level.</p></sec><sec id="s4"><title>Acknowledgements</title><p>We thank the staff of BL18U1 beamline at National Center for Protein Sciences Shanghai and Shanghai Synchrotron Radiation Facility (Shanghai, People’s Republic of China) for assistance during data collection.</p></sec><sec id="s5"><title>Funding Information</title><p>This work was financially supported by the National Key R&amp;D Program of China (Grant No. 2016YFC1200305), the National Natural Science Foundation-Outstanding Youth Foundation (Grant No. 81522026), the Sichuan Outstanding Youth Science &amp; Technology Funding (Grant No. 2016JQ0001), and the Outstanding Youth Foundation of Sichuan University (Grant No. 2016SCU04B01).</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare no conflicts of interest regarding the publication of this paper.</p></sec><sec id="s7"><title>Cite this paper</title><p>Pi, R.L., Gu, J. and Lu, G.W. (2018) Cloning, Expression, Purification, and Crystallization of P. aeruginosa ICMP. American Journal of Molecular Biology, 8, 195-204. https://doi.org/10.4236/ajmb.2018.84017</p></sec></body><back><ref-list><title>References</title><ref id="scirp.87613-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Navaza, J. (1994) AMoRe: An Automated Package for Molecular Replacement. Acta Crystallographica Section A, 50, 157-163. https://doi.org/10.1107/S0108767393007597</mixed-citation></ref><ref id="scirp.87613-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Matthews, B.W. (1968) Solvent Content of Protein Crystals. Journal of Molecular Biology, 33, 491-497. https://doi.org/10.1016/0022-2836(68)90205-2</mixed-citation></ref><ref id="scirp.87613-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Otwinowski, Z. and Minor, W. (1997) Processing of X-Ray Diffraction Data Collected in Oscillation Mode. Methods in Enzymology. Nucleic Acids Research, 276, 307-326.</mixed-citation></ref><ref id="scirp.87613-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Winsor, G.L., Van Rossum, T., Lo, R., Khaira, B., Whiteside, M.D., Hancock, R.E. and Brinkman, F.S. (2009) Pseudomonas Genome Database: Facilitating User-Friendly, Comprehensive Comparisons of Microbial Genomes. Nucleic Acids Research, 37, 483-488. https://doi.org/10.1093/nar/gkn861</mixed-citation></ref><ref id="scirp.87613-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Maruyama, Y., Ochiai, A., Mikami, B., Hashimoto, W. and Murata, K. (2011) Crystal Structure of Bacterial Cell-Surface Alginate-Binding Protein with an M75 Peptidase Motif. Biochemical and Biophysical Research Communications, 405, 411-416. https://doi.org/10.1016/j.bbrc.2011.01.043</mixed-citation></ref><ref id="scirp.87613-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Xu, Q., Rawlings, N., Farr, C., Chiu, H., Grant, J., Jaroszewski, L., Klock, H., Knuth, M., Miller, M., Weekes, D., Elsliger, M., Deacon, A., Godzik, A., Lesley, S. and Wilson, I. (2011) Structural and Sequence Analysis of Imelysin-Like Proteins Implicated in Bacterial Iron Uptake. PLoS ONE, 6, 1-12. https://doi.org/10.1371/journal.pone.0021875</mixed-citation></ref><ref id="scirp.87613-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Reddy, K.J., Bullerjahn, G.S., Sherman, D.M. and Sherman, L.A. (1988) Cloning, Nucleotide Sequence, and Mutagenesis of a Gene (irpA) Involved in Iron-Deficient Growth of the Cyanobacterium Synechococcus sp. Strain PCC7942. Journal of Bacteriology, 170, 4466-4476. https://doi.org/10.1128/jb.170.10.4466-4476.1988</mixed-citation></ref><ref id="scirp.87613-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Rajasekaran, M.B., Nilapwar, S., Andrews, S.C. and Watson, K.A. (2010) EfeO-Cupredoxins: Major New Members of the Cupredoxin Superfamily with Roles in Bacterial Iron Transport. BioMetals, 23, 1-17. https://doi.org/10.1007/s10534-009-9262-z</mixed-citation></ref><ref id="scirp.87613-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Cao, J., Woodhall, M.R., Alvarez, J., Cartron, M.L. and Andrews, S.C. (2007) EfeUOB (YcdNOB) Is a Tripartite, Acid-Induced and CpxAR-Regulated, Low-pH Fe2+ Transporter That Is Cryptic in Escherichia coli K-12 But Functional in E. coli O157:H7. Molecular Microbiology, 65, 857-875. https://doi.org/10.1111/j.1365-2958.2007.05802.x</mixed-citation></ref><ref id="scirp.87613-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Grosse, C., Scherer, J., Koch, D., Otto, M., Taudte, N. and Grass, G. (2006) A New Ferrous Iron Uptake Transporter, EfeU (YcdN), from Escherichia coli. Molecular Microbiology, 62, 120-131. https://doi.org/10.1111/j.1365-2958.2006.05326.x</mixed-citation></ref><ref id="scirp.87613-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Cornelis, P., Matthijs, S. and Van Oeffelen, L. (2009) Iron Uptake Regulation in Pseudomonas aeruginosa. BioMetals, 22, 15-22. https://doi.org/10.1007/s10534-008-9193-0</mixed-citation></ref><ref id="scirp.87613-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Poole, K. and McKay, G.A. (2003) Iron Acquisition and Its Control in Pseudomonas aeruginosa: Many Roads Lead to Rome. Frontiers in Bioscience, 8, 661-686.https://doi.org/10.2741/1051</mixed-citation></ref><ref id="scirp.87613-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Cornelis, P. and Dingemans, J. (2013) Pseudomonas aeruginosa Adapts Its Iron Uptake Strategies in Function of the Type of Infections. Frontiers in Cellular and Infection Microbiology, 3, 75. https://doi.org/10.3389/fcimb.2013.00075</mixed-citation></ref><ref id="scirp.87613-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Andrews, S.C., Robinson, A.K. and Rodriguez-Quinones, F. (2003) Bacterial Iron Homeostasis. FEMS Microbiology Reviews, 27, 215-237.https://doi.org/10.1016/S0168-6445(03)00055-X</mixed-citation></ref><ref id="scirp.87613-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Rawlings, N.D., Barrett, A.J. and Bateman, A. (2010) MEROPS: The Peptidase Database. Nucleic Acids Research, 38, 227-233. https://doi.org/10.1093/nar/gkp971</mixed-citation></ref><ref id="scirp.87613-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Fricke, B., Parchmann, O., Kruse, K., Rucknagel, P., Schierhorn, A. and Menge, S. (1999) Characterization and Purification of an Outer Membrane Metalloproteinase from Pseudomonas aeruginosa with Fibrinogenolytic Activity. Biochimica et Biophysica Acta, 1454, 236-250. https://doi.org/10.1016/S0925-4439(99)00040-X</mixed-citation></ref><ref id="scirp.87613-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Liu, P.V. (1974) Extracellular Toxins of Pseudomonas aeruginosa. Journal of Infectious Diseases, 130, S94-S99. https://doi.org/10.1093/infdis/130.Supplement.S94</mixed-citation></ref><ref id="scirp.87613-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Wei, Q., Tarighi, S., Dotsch, A., Haussler, S., Musken, M., Wright, V., Camara, M., Williams, P., Haenen, S., Boerjan, B., Bogaerts, A., Vierstraete, E., Verleyen, P., Schoofs, L., Willaert, R., De Groote, V., Michiels, J., Vercammen, K., Crabbe, A. and Cornelis, P. (2011) Phenotypic and Genome-Wide Analysis of an Antibiotic Resistant Small Colony Variant (SCV) of Pseudomonas aeruginosa. PLoS ONE, 6, 1-14.https://doi.org/10.1371/journal.pone.0029276</mixed-citation></ref><ref id="scirp.87613-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Wagenlehner, F.M. and Naber, K.G. (2006) Current Challenges in the Treatment of Complicated Urinary Tract Infections and Prostatitis. Clinical Microbiology and Infection, 12, 67-80. https://doi.org/10.1111/j.1469-0691.2006.01398.x</mixed-citation></ref><ref id="scirp.87613-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Fick, R. (1993) Pseudomonas aeruginosa: The Opportunist. 1-6.</mixed-citation></ref><ref id="scirp.87613-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Jeremy, G. and Martin, W. (2013) Why Is Pseudomonas aeruginosa a Common Cause of Infection in Individuals with Cystic Fibrosis? Future Microbiology, 8, 697-699. https://doi.org/10.2217/fmb.13.40</mixed-citation></ref><ref id="scirp.87613-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Folkesson, A., Jelsbak, L., Yang, L., Johansen, H.K., Ciofu, O., Hoiby, N. and Molin, S. (2012) Adaptation of Pseudomonas aeruginosa to the Cystic Fibrosis Airway: An Evolutionary Perspective. Nature Reviews Microbiology, 10, 841-851.https://doi.org/10.1038/nrmicro2907</mixed-citation></ref><ref id="scirp.87613-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Flores, G., Stavola, J.J. and Noel, G.L. (1993) Bacteremia due to Pseudomonas aeruginosa in Children with AIDS. Clinical Infectious Diseases, 16, 706-708.https://doi.org/10.1093/clind/16.5.706</mixed-citation></ref></ref-list></back></article>