At present, the research about flower color of
Rosa rugosa is a very inno-vative and practical study. Glycosylation modification fulfills an important role in increasing the stability and solubility of anthocyanin in plants. In this study, based on the transcriptional database of
R. rugosa, a gene with full length cDNA of 1422bp, encoding 473 amino acids, designated as
RrGT2, were isolated from flowers of
R. rugosa ‘Zizhi’ and then functionally characterized. According to online software prediction, the molecular formula of the protein encoded by the
RrGT2 gene is C
2334H
3628N
602O
711S
18, the relative molecular mass is 52,075.17 Da, and the theoretical isoelectric point is pI = 4.76. The result of the
RrGT2 protein 3D model construction showed that it had the highest homology with the UDP-glycosyltransferase 74F2 protein model in the database (39.53%). Sequence alignments with the NCBI database showed that the
RrGT2 protein is a member of the GTB superfamily. Homology analysis revealed that the coding regions of
RrGT2 was highly specific among different species, but still had typical conserved amino acid residues called PSPG that are crucial for
RrGT2 enzyme activity.
RrGT2 transcripts were detected in five flowering stages and seven tissues of
R. rugosa ‘Zizhi’,
R. rugosa ‘Fenzizhi’ and
R. rugosa ‘Baizizhi’, and their expression patterns corresponded with the accumulation of antho-cyanins. Therefore, we speculated that glycosylation of
RrGT2 plays a crucial role in anthocyanin biosynthesis in
R. rugosa.
Rosa rugosa is an important ornamental plant which belongs to the genus Rosa in the family Rosaceae. It is native to China and is widely distributed in the world. Because of its unique fragrance, color, cold resistance and drought resistance, it has great development potential in garden application [1] . There are many varieties of roses, but most of them are traditional colors such as pink, purple, etc. A few varieties are white, lacking yellow, bright red, orange and compound color, etc. [2] . Therefore, how to innovate rose color has become the main goal of breeders. The analysis of the pigment composition of rose and the study of the expression characteristics of the key enzymes encoding genes that catalyze the synthesis of rose pigment are the important prerequisite for rose color oriented molecular breeding [3] . Anthocyanin determines the color of higher plant organs. Its biosynthesis pathway related structural genes (CHS, CHI, F3H, F3’H, DFR, ANS, 3GT etc.) and regulatory genes (MYB, mostly R2R3 MYB, BHLH and WD40 classes) have been cloned, sequenced and protein function studies in many plants, such as petunia, maize, snapdragon and so on. But less research has been done on R. rugosa.
Anthocyanins, derived from the anthocyanin biosynthesis pathway, are the largest group of water-soluble plant flavonoids found in organs of plants and crops [4] [5] . Anthocyanins are unstable in plants, mainly in the form of glycosides in the vacuole [6] . Anthocyanins play an important role in insect pollination, auxin transport, protection of leaves from ultraviolet radiation, inhibition of diseases and insect pests, etc. [7] . In addition, as a safe, non-toxic natural food pigment, anthocyanins also have anti-oxidation, anti-cancer and anti-arteriosclerosis functions [8] .
Anthocyanin biosynthesis pathway is one of the secondary metabolic pathways in plants. At present, the research on it has been more clear. Firstly, naringin was formed by the catalysis of CHS and CHI with coumaryl coenzyme A and malonyl Co A. Then flavonols were formed under the action of F3H. The next step is to form colored anthocyanins under the action of DFR and ANS. Finally, through glycosylation, methylation, acylation, hydroxylation and other modifications, a variety of anthocyanins with a stable structure were formed [9] . Flavonoid 3-0-glycosyltransferase (3GT) gene is a downstream gene in anthocyanin synthesis pathway. It can catalyze the glycosylation of UDP glucose to replace the 3 hydroxyl groups of anthocyanin and make anthocyanin glycosylation to produce colored and stable anthocyanins. And move the maximum absorption spectrum to the ultraviolet end, thus increasing the blue tone of anthocyanins [10] . Glycosylation can change the hydrophilicity, biochemical activity and subcellular localization of anthocyanins, which is beneficial to the transport and storage of anthocyanins in cells and organisms [11] .
Some studies have shown that the anthocyanin content of plants lacking 3GT also decreased significantly [12] . 3GT gene belongs to a glycosyltransferase (GTs) family 1, whose enzyme protein has a conserved domain of about 44 amino acids at its C-terminal, known as plant secondary product glycosyltransferase (PSPG) box. At present, 3GT has been cloned and analyzed in many plants such as Zea mays [13] , Vitis vinifera [14] , Gentiana trflora [15] , Petunia hybrida [16] and so on, which has laid a foundation for understanding the metabolic regulation of anthocyanin synthesis pathway.
At present, the studies on R. rugosa are mainly focused on morphological classification, geographical distribution, essential oil extraction and food quality evaluation, and there are few reports on the anthocyanin biosynthesis mechanism, so we don’t know exactly how it works. In this study, based on the R. rugosa transcriptome data, we cloned and identified RrGT2 gene from the petals of R. rugosa ‘Zizhi’ for the first time. We carried out detailed bioinformatics analysis, homology analysis and the temporal and spatial expression pattern analysis of the RrGT2 gene in order to provide some useful informations for the subsequent color improvement project in R. rugosa.
2. Materials and Methods2.1. Plant Materials
For R. rugosa, the plant materials were the same as the varieties used for transcriptome data determination. Three varieties (R. rugosa ‘Zizhi’, R. rugosa ‘Fenzizhi’ and R. rugosa ‘Baizizhi’) cultivated in Rose germplasm nursery of Shandong Agricultural University was used as the test material. All three varieties were crossed with Rosa davurica as female parent and Rosa rugosa Thunb. as male parent. We collected the petals at the budding stage, initial opening stage, half opening stage, full opening stage and wilting stage in the forenoon On sunny days from 20 April to 10 May 2017. Seven tissues (roots, stems, leaves, petals at the budding stage, sepals, stamens and pistil) of R. rugosa ‘Zizhi’ were collected at the same time. After quick freezing of liquid nitrogen, all samples collected with three replicates were put into −80˚C refrigerator for storage.
2.2. Extraction of Total RNA and Synthesis of the First-Strand cDNA
The extraction of total RNA is based on the specification of EASY spin plant RNA rapid extraction kit (Aidlab Biotech, Beijing, China). The integrity of RNA was detected by gel electrophoresis with 1.0% nondenatured agarose, the purity and concentration of RNA were detected by Nanodrop2000C ultramicro spectrophotometer (Thermo Fisher Scientific, Wilmington, Delaware, USA), and the qualified RNA was preserved at −80˚C. The first-strand cDNA was synthesized by referring to the steps of 5 × All-In-One RT MasterMix reverse transcription kit (ABM Company, Vancouver, Canada) and synthesized according to the requirements of RT-PCR and qRT-PCR.
2.3. Full-Length CDS Cloning of the RrGT2 Gene
3’RACE specific primers were designed based on the sequence information provided by the Rosa transcriptome data. The cDNA 3’terminal sequence of the target gene was amplified by 3’RACE technology. The known target gene sequence in transcriptome data and the 3’terminal sequence obtained by RACE technique were spliced with DNAMAN software to obtain the full-length cDNA sequence of the RrGT2 gene. According to the sequence obtained by splicing, the upstream primer RrGT2-F containing the starting codon of the RrGT2 gene and the downstream primer RrGT2-R containing the terminating codon (Table 1) were designed and amplified. The estimated length of amplification was 1422bp.
2.4. Bioinformatics Analysis of the RrGT2 Gene
Bioinformatics analysis softwares and tools were used to predict the physicochemical properties and structural functions of the protein encoded by the RrGT2 gene, which provided a reference for the future research and application of the gene. The basic physical and chemical properties of the protein encoded by the RrGT2 gene were analyzed by using Prot-Param tools in ExPasy (http://web.expasy.org/protparam/). The CD-Search function (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) on NCBI was used to predict the conserved domain in the protein encoded by the RrGT2 gene. The 3D structure of the RrGT2 protein was predicted by online tool SWISS-MODEL. DNAMAN software and Blast tool in NCBI were used to analyze the amino acid sequence of the RrGT2 gene. The phylogenetic tree is constructed by neighbor-joining method using MEGA5.0 software.
2.5. qRT-PCR Detection
The gene expression was analyzed by qRT-PCR on a Bio-Rad CFX96TM Real-Time PCR instrument (Bio-Rad, Inc., USA). The qRT-PCR mixture (20 μL total volume) contained 10 μL of SYBR® Premix Ex Taq™ (TaKaRa, Inc., Japan), 8.2 μL of ddH2O, 0.4 μL of each primer and 1 μL of cDNA. The PCR program was carried out with an initial step of 95˚C for 30 s; 40 cycles of 95˚C for 5 s, 60˚C for 30 s; and then, 95˚C for 10 s, 65˚C for 5 s and 95˚C for 5 s for the dissociation stage. Each gene was assessed with three biological replications. The relative expression levels of the genes were calculated by the 2−ΔΔCt method [17] .
3. Results3.1. Cloning of RrGT2 and Sequence Analysis
We obtained the RrGT2 gene 3' terminal sequence of 236 bp length by nested PCR (Figure 1(a)). The full length CDS sequence (Figure 1(b)) of the RrGT2 gene was cloned by full-length primers (Table 1) and confirmed by sequencing. The RrGT2 gene has a complete ORF from the starting codon ATG to the termination codon TAA, encodes a 473-amino acids protein and has a polyA tail. Sequence alignments with the NCBI database showed the RrGT2 protein is a member of the GTB superfamily and has a typical plant secondary product glycosyltransferases conserved domain consisting of 44 amino acid residues at the
Primers used in the present study
Primer Name
Sequence(5’-3’)
Description
Annealing temperatures/˚C
3’RrGT2-F-outer
GCAGAGAGGAACTAGAAGAGCTTGGG
61.2
3’RrGT2-F-inner
GCCAAGTTGATAGAGGACATGTGG
60.4
B26
GACTCGAGTCGACATCGATTTTTTTTTTTTT
3’RACE for RrGT2
56
RrGT2-F
TTTT ATGACGCAACACCGCTTC
56
RrGT2-R
CTAGGCTGGCAAACAGCCA
Full-length cDNA for RrGT2
60
RrGAPDH-F
TTCTGCCTGCTCTCAATG
52.1
RrGAPDH-R
TGCCTTCTTCTCAAGTCTG
qRT-PCR for RrGAPDH
51.5
qRrGT2-F
GTTGTTGGATTCCGGACGTC
57.5
qRrGT2-R
CAAGCTCTTCTAGTTCCTCTCTGC
qRT-PCR for RrGT2
60.4
C-terminal. According to online software prediction, the molecular formula of the RrGT2 protein is C2334H3628N602O711S18, the relative molecular mass is 52075.17 Da, and the theoretical isoelectric point is pI = 4.76.
3.2. Protein 3D Model Construction
During the construction of the RrGT2 protein 3D model, templates search with BLAST and HHBlits has been performed against the SWISS-MODEL template library. It was found that it had the highest homology with the UDP- glycosyltransferase 74F2 protein model in the database (39.53%), so the RrGT2 protein 3D model (Figure 2) was constructed on the basis of its model.
3.3. Homology Analysis
Sequence alignment of multiple species amino acids (Figure 3) showed that the RrGT2 protein has strong species specificity in the N-terminal region and PSPG conserved domain in the C-terminal region. Using MEGA5.0 software,
phylogenetic tree (Figure 4) was constructed from 21 plant amino acids sequences including R. rugosa RrGT2. The results showed that the RrGT2 gene had the closest genetic relationship with FaUGT and FvGT, and its homology reached 89%.
3.4. Temporal and Spatial Expression Patterns of the RrGT2 Gene
The expression levels of the RrGT2 gene, which significantly differed, were assessed during five flowering stages. For R. rugosa ‘Zizhi’ (Figure 5(a)), the highest expression level was observed during the full opening stage, and the lowest was observed during the budding stage. For R. rugosa ‘Fenzizhi’ (Figure 5(b)), the highest expression level was observed during the wilting stage, and the lowest was observed during the budding stage. And for R. rugosa ‘Baizizhi’ (Figure 5(c)), the expression level was highest during the initial opening stage but lowest
also during the budding stage. The expression patterns of the RrGT2 gene in R. rugosa ‘Zizhi’, R. rugosa ‘Fenzizhi’ and R. rugosa ‘Baizizhi’ showed different trends.
Then the expression levels of the RrGT2 gene in three varieties was compared in five flowering stages (Figure 5(d)). In the budding stage, full opening stage and wilting stage, R. rugosa ‘Fenzizhi’ > R. rugosa ‘Baizizhi’ > R. rugosa Zizhi’, while in the initial opening stage and half opening stage, the trends of gene expression in the three varieties were consistent: R. rugosa ‘Baizizhi’ > R. rugosa ‘Fenzizhi’ > R. rugosa ‘Zizhi’.
The expression levels of the RrGT2 gene, which also significantly differed, were assessed in seven different tissue types of R. rugosa ‘Zizhi’ (Figure 5(e)). The order of relative expression levels of the RrGT2 gene in seven tissues was: sepal > leaf > stem > root > flower at the budding stage > pistil > stamen.
4. Discussion
Although many genes have been reported to regulate the formation of flower color, there are few reports of downstream structural genes such as GTs. The final formation of anthocyanins depends on the glycosylation of GTs, so it is very important to elucidate the function and influence of the RrGT2 gene in R. rugosa color formation. In this study, we successfully cloned RrGT2 gene with full length cDNA of 1422bp, encoding 473 amino acids from the petals of R. rugosa ‘Zizhi’. It was predicted that the molecular formula of the protein encoded by the RrGT2 gene is C2334H3628N602O711S18, the relative molecular mass is 52,075.17 Da, the theoretical isoelectric point pI = 4.76, which belongs to GTB superfamily. During the construction of the RrGT2 protein 3D model, it was found that the RrGT2 protein had the highest homology with the existing UDP-glycosyltransferase 74F2 protein model protein model (39.53%), which confirmed the function of the RrGT2 gene to some extent.
The evolutionary analysis of flavonoids GTs by Sawada et al. [18] showed that GTs, which catalyze the glycosylation of flavonoids in different positions
(3-O, 5-O, 7-O), were formed into different evolutionary branches (F3Gly T, F5Gly T, F7Gly T) without restriction of species. It suggested that the region-specific of flavonoids GTs to glycosyl receptors (catalytic site specificity) was formed before species differentiation. In the course of evolution, the ability to utilize UDP-sugar (UDP-glucose, UDP-rhamnose, UDP-galactose) was obtained. Phylogenetic tree analysis showed that RrGT2 was linked to FaUGT and
FvGT of 3-O-glycosylation of flavonoids, suggesting that RrGT2 may be involved in the glycosylation process of 3-O positions of flavonoids.
The alignment of amino acid sequences between RrGT2 and glycosyltransferases from the other 21 species indicated that RrGT2 possessed a common PSPG motif of the glycosyltransferases superfamily (Figure 3). Previous studies have shown that the conserved region of PSPG is related to substrate recognition and catalytic activity of enzyme proteins [19] [20] [21] [22] . If the 44 amino acids of the PSPG domain are numbered, the amino acids at position 22, 23 and 44 play an important role in the selection of enzyme proteoglycan donors. The twenty-second position of tryptophan (Trp, W) can correctly locate UDP-glucose, while arginine (Arg, R) can make UDP-glucuronic acid locate correctly; the twenty-third position of serine (Ser, S) is highly conserved in UDP-glucurono- syltransferase [23] [24] [25] ; the forty-fourth glutamine (Gln, Q) and histidine (His, H) have strong conservatism in glucosyltransferase and galactotransferase respectively [22] . In the PSPG domain of the RrGT2 gene, the amino acids at position 22, 23 and 44 are tryptophan (Trp, W), asparagine (Asn , N) and glutamine (Gln, Q), respectively. Therefore, we speculated that the RrGT2 gene is using UDP-glucose as the main glycosyl donor, but has no glucuronyltransferase activity.
The expression levels of the RrGT2 gene during flower development and in different tissues were investigated. It was found that the expression of the RrGT2 gene showed a different trend during different flowering periods in three R. rugosa varieties, indicating that the expression of the RrGT2 gene was developmentally regulated in the process of anthocyanin biosynthesis. Studies have shown that the accumulation of anthocyanin in red skinned sand pear, strawberries and litchi is positively correlated with the activity of UF3GT. Boss et al. [26] also detected the expression of UF3GT in the peels of red grape which accumulated anthocyanin, but not in other tissues of red grape and white grape without anthocyanin accumulation. Gong et al’s [27] studies showed that the partial structural genes of Perilla frutescens anthocyanin metabolic pathway were only expressed in the leaves of red varieties, but not in green varieties or the expression in the green leaves was very low. About the tissue-specific expression in R. rugosa ‘Zizhi’, it is worth mentioning that the stems of R. rugosa ‘Zizhi’ are purple, which is consistent with the relatively high level of expression of the RrGT2 gene. But for the relatively low level of expression in flowers, this did not mean that the RrGT2 gene had no effect on flower color formation. We believe that this was the result of comparing flowers at the budding stage as tissue types. Because in the budding stage, the expression of the RrGT2 gene was lowest, but in other stages was very high. In addition, RrGT2 was also highly expressed in the sepals and leaves, so we infer that RrGT2 is also involved in the glycosylation of secondary metabolites in sepals and leaves and plays an important role.
In conclusion, the cloning and expression analysis of the RrGT2 gene was beneficial to analyzing the molecular synthesis and regulation mechanism of anthocyanins, and also provided some important informations for the improvement of R. rugosa flower color in the future.
Acknowledgements
This project was supported by the Agricultural Seed Project of Shandong Province ([2014] No. 96).
Conflicts of Interest
The authors declare that they have no conflicts of interest.
Cite this paper
Sui, X.M., Wang, Y., Zhao, M.Y., Han, X., Zhao, L.Y. and Xu, Z.D. (2018) Cloning and Expression Analysis of RrGT2 Gene Related to Anthocyanin Biosynthesis in Rosa rugosa. American Journal of Plant Sciences, 9, 2008-2019. https://doi.org/10.4236/ajps.2018.910146
NOTESReferencesLi, M. (2006) Survey and Quality Evaluation of Shandong Rose Varieties. Shandong University of Traditional Chinese Medicine.Feng, L.G., Shao, D.W., Sheng, L.X., et al. (2009) Study on Investigation and Morphological Variation of Wild Rosa rugosa in China. Journal of Shandong Agricultural University (Natural Science Edition), 40, 484-488.Chen, S.-M., Zhu, X.-R., Chen, F.D., et al. (2010) Expression Characteristics of Anthocyanin Structural Genes in Different Flower Color Chrysanthemum Cultivars. Journal of Northwest plants, No. 3, 453-458.Kim, S.H., Lee, J.R., Hong, S.T., et al. (2003) Molecular Cloning and Analysis of Anthocyanin Biosynthesis Genes Preferentially Expressed in Apple Skin. Plant Science, 165, 403-413. https://doi.org/10.1016/S0168-9452(03)00201-2Martens, S., Preuß, A. and Matern, U. (2010) Multifunctional Flavonoid Dioxygenases: Flavonol and Anthocyanin Biosynthesis in Arabidopsis thaliana L. Phytochemistry, 71, 1040-1049. https://doi.org/10.1016/j.phytochem.2010.04.016Ge, C.L., Huang, C.H. and Xu, X.B. (2012) Research on Anthocyanins Biosynthesis in Fruit. Acta Horticulturae Sinica, 39, 1655-1664.Forkmann, G. (2010) Flavonoids as flower Pigments: The Formation of the Natural Spectrum and Its Extension by Genetic Engineering. Plant Breeding, 106, 1-26. https://doi.org/10.1111/j.1439-0523.1991.tb00474.xSpringob, K., Nakajima, J.I., Yamazaki, M., et al. (2003) Recent Advances in the Biosynthesis and Accumutation of Anthocyanins. Natural Product Reports, 20, 288-303. https://doi.org/10.1039/b109542kYonekura-Sakakibara, K., Nakayama, T., Yamazaki, M., et al. (2009) Modification and Stabilization of Anthocyanins. Springer, New York, 169-190.Zheng Z.L. ,et al. (1994)Flower Color Gene Engineering of Flower Crops Northern Horticulture 3, 37-38.Vogt, T. and Jones, P. (2000) Glycosyltransferases in Plant Natural Product Synthesis: Characterization of a Supergene Family. Trends in Plant Science, 5, 380-386. https://doi.org/10.1016/S1360-1385(00)01720-9Tohge, T., Nishiyama, Y., Hirai, M.Y., et al. (2005) Functional Genomics by Integrated Analysis of Metabolome and Transcriptome of Arabidopsis Plants Over-Expressing an MYB Transcription Factor. Plant Journal, 42, 218-235. https://doi.org/10.1111/j.1365-313X.2005.02371.xGoto, T., Kondo, T., Tamura, H., et al. (1982) Structure of Gentiodelphin, an Acylated Anthocyanin Isolated from Gentiana makinoi, that Is Stable in Dilute Aqueous Solution. Tetrahedron Letters, 23, 3695-3698. https://doi.org/10.1016/S0040-4039(00)88660-8Hall, D., Yuan, X.X., Murata, J., et al. (2012) Molecular Cloning and Biochemical Characterization of the UDP-Glucose: Flavonoid 3-0-Glucosyltransferase from Concord Grape (Vitis labrusca). Phytochemistry, 74, 90-99. https://doi.org/10.1016/j.phytochem.2011.10.007Tanaka, Y., Yoshikazu, K., Fukuchi-Mlizutani, M., et al. (1996) Molecular and Biochemical Characterization of Three Anthocyanin Synthetic Enzymes from Gentiana triflora. Plant & Cell Physiology, 37, 711-716. https://doi.org/10.1093/oxfordjournals.pcp.a029004Yamazaki, M., Yamagishi, E., Gong, Z.Z., et al. (2002) Two Flavonoid Glucosyltransferases from Petunia hybrida: Molecular Cloning, Biochemical Properties and Developmentally Regulated Expression. Plant Molecular Biology, 48, 401-411. https://doi.org/10.1023/A:1014043214943Schmittgen, T.D. and Livak, K.J. (2008) Analyzing Real-Time PCR Data by the Comparative C(T) Method. Nature Protocols, 3, 1101-1108. https://doi.org/10.1038/nprot.2008.73Sawada, S., Suzuki, H., Ichimaida, F., et al. (2005) UDP-Glucuronic Acid: Anthocyanin Glucuronosyltransferase from Red Daisy (Bellis perennis) Flowers. The Journal of Biological Chemistry, 280, 899-906. https://doi.org/10.1074/jbc.M410537200Gachon, C.M., Meurinne, M.L. and Saindrenan, P. (2005) Plant Secondary Metabolism Glycosyltransferases: The Emerging Functional Analysis. Trends in Plant Science, 10, 542-549. https://doi.org/10.1016/j.tplants.2005.09.007Sakakibara, K.Y. and Hanada, K. (2011) An Evolutionary View of Functional Diversity in Family 1 Glycosyltransferases. The Plant Journal, 66, 182-193. https://doi.org/10.1111/j.1365-313X.2011.04493.xWang, X.Q. (2009) Structure, Mechanism and Engineering of Plant Natural Product Glycosyltransferases. FEBS Letters, 583, 3303-3309. https://doi.org/10.1016/j.febslet.2009.09.042Kubo, A., Arai, Y., Nagashima, S., et al. (2004) Alteration of Sugar Donor Specificities of Plant Glycosyltransferases by a Single Point Mutation. Archives of Biochemistry and Biophysics, 429, 198-203. https://doi.org/10.1016/j.abb.2004.06.021Shao, H., He, X.Z., Achnine, L., et al. (2005) Crystal Structures of a Multifunctional Triterpene/Flavonoid Glycosyltransferase from Medicago truncatula. Plant Cell, 17, 3141-3154. https://doi.org/10.1105/tpc.105.035055Li, L.N., Modolo, L.V., Trevino, L.E., et al. (2007) Crystal Structure of Medicago truncatula UGT85H2-Insights into the Trusctural Basis of a Multifunctional (iso) Flavonoid Glycosyltransferase. Journal of Molecular Biology, 370, 951-963. https://doi.org/10.1016/j.jmb.2007.05.036Modolo, L.V., Li, L.N., Pan, H.Y., et al. (2009) Crystal Structures of Glycosyltransferase UGT/8G1 Reveal the Molecular Basis for Glycosylation and Deglycosylation of (iso) Flavonoids. Journal of Molecular Biology, 392, 1292-1302. https://doi.org/10.1016/j.jmb.2009.08.017Boss, P.K., Davies, C. and Robinson, S.P. (1996) Expression of Anthocyanin Biosynthesis Pathway Genes in Red and White Grapes. Plant Molecular Biology, 32, 565-569. https://doi.org/10.1007/BF00019111Gong, Z.Z., Yamazaki, M., Sugiyama, M., et al. (1997) Cloning and Molecular Analysis of Structural Genes Involved in Anthocyanin Biosynthesis and Expressed in a Forma-Specific Manner in Perilla frutescens. Plant Molecular Biology, 35, 915-927. https://doi.org/10.1023/A:1005959203396