<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AS</journal-id><journal-title-group><journal-title>Agricultural Sciences</journal-title></journal-title-group><issn pub-type="epub">2156-8553</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/as.2018.98075</article-id><article-id pub-id-type="publisher-id">AS-87056</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Earth&amp;Environmental Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Cloning and Expression Analysis of &lt;i&gt;RrGT1&lt;/i&gt; Gene Related to Anthocyanin Biosynthesis in &lt;i&gt;Rosa rugosa&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xiaoming</surname><given-names>Sui</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Pengyuan</surname><given-names>Zhang</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yu</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mingyuan</surname><given-names>Zhao</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xu</surname><given-names>Han</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lanyong</surname><given-names>Zhao</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Zongda</surname><given-names>Xu</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>College of Forestry, Shandong Agricultural University, Taian, China</addr-line></aff><aff id="aff2"><addr-line>Forestry Seedlings and Flower Department, Forestry Bureau of Shandong, Jinan, China</addr-line></aff><pub-date pub-type="epub"><day>09</day><month>08</month><year>2018</year></pub-date><volume>09</volume><issue>08</issue><fpage>1085</fpage><lpage>1096</lpage><history><date date-type="received"><day>8,</day>	<month>August</month>	<year>2018</year></date><date date-type="rev-recd"><day>28,</day>	<month>August</month>	<year>2018</year>	</date><date date-type="accepted"><day>31,</day>	<month>August</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Glycosylation modification fulfills an important role in increasing the stability and solubility of anthocyanin in plants. In this study, based on the transcriptional database of 
  <em>R. rugosa</em>, a gene with full length cDNA of 1161 bp, encoding 386 amino acids, designated as 
  <em>RrGT1</em>
  <em>,</em> was isolated from flowers of 
  <em>R. rugosa</em> ‘Zizhi’ and then functionally characterized. According to online software prediction, the molecular formula of the protein encoded by the 
  <em>RrGT1</em> gene is C
  <sub>1879</sub>H
  <sub>2964</sub>N
  <sub>494</sub>O
  <sub>556</sub>S
  <sub>14</sub>, the relative molecular mass is 41,820.02 Da, and the theoretical isoelectric point is pI = 5.03. The result of the 
  <em>RrGT1</em> protein 3D model construction showed that it had the highest homology with the UDP-glucose: anthocyanidin 3-O-glucosyltransferase protein model in the database (47.01%). Sequence alignments with the NCBI database showed that the
  <em> RrGT1</em> protein is a member of the GTB superfamily. Homology analysis revealed that the coding regions of 
  <em>RrGT1</em> was highly specific among different species, but still had typical conserved amino acid residues called PSPG that are crucial for 
  <em>RrGT1</em> enzyme activity. 
  <em>RrGT1</em> transcripts were detected in five flowering stages and seven tissues of 
  <em>R. rugosa</em> ‘Zizhi’, 
  <em>R. rugosa</em> ‘Fenzizhi’ and 
  <em>R. rugosa </em>‘Baizizhi’, and their expression patterns corresponded with the accumulation of anthocyanins. Therefore, we speculated that glycosylation of 
  <em>RrGT1</em> plays a crucial role in anthocyanin biosynthesis in 
  <em>R. rugosa</em>.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Rosa rugosa&lt;/i&gt;</kwd><kwd> &lt;i&gt;RrGT1&lt;/i&gt; Gene</kwd><kwd> Clone</kwd><kwd> Gene Expression</kwd><kwd> Anthocyanin</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Rosa rugosa is an important ornamental plant which belongs to the genus Rosa in the family Rosaceae. It is native to China and is widely distributed in the world. Because of its unique fragrance, color, cold resistance and drought resistance, it has great development potential in garden application [<xref ref-type="bibr" rid="scirp.87056-ref1">1</xref>] . There are many varieties of roses, but most of them are traditional colors such as pink, purple, etc. A few varieties are white, lacking yellow, bright red, orange and compound color, etc. [<xref ref-type="bibr" rid="scirp.87056-ref2">2</xref>] . Therefore, how to innovate rose color has become the main goal of breeders. The analysis of the pigment composition of rose and the study of the expression characteristics of the key enzymes encoding genes that catalyze the synthesis of rose pigment are the important prerequisite for rose color oriented molecular breeding [<xref ref-type="bibr" rid="scirp.87056-ref3">3</xref>] . Anthocyanin determines the color of higher plant organs. Its biosynthesis pathway related structural genes (CHS, CHI, F3H, F3’H, DFR, ANS, 3GT etc.) and regulatory genes (MYB, mostly R2R3 MYB, BHLH and WD40 classes) have been cloned, sequenced and protein function studies in many plants, such as petunia, maize, snapdragon and so on. But less research has been done on R. rugosa.</p><p>Anthocyanins, derived from the anthocyanin biosynthesis pathway, are the largest group of water-soluble plant flavonoids found in organs of plants and crops [<xref ref-type="bibr" rid="scirp.87056-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.87056-ref5">5</xref>] . Anthocyanins are unstable in plants, mainly in the form of glycosides in the vacuole [<xref ref-type="bibr" rid="scirp.87056-ref6">6</xref>] . Anthocyanins play an important role in insect pollination, auxin transport, protection of leaves from ultraviolet radiation, inhibition of diseases and insect pests, etc. [<xref ref-type="bibr" rid="scirp.87056-ref7">7</xref>] . In addition, as a safe, non-toxic natural food pigment, anthocyanins also have anti-oxidation, anti-cancer and anti-arteriosclerosis functions [<xref ref-type="bibr" rid="scirp.87056-ref8">8</xref>] .</p><p>Anthocyanin biosynthesis pathway is one of the secondary metabolic pathways in plants. At present, the research on it has been clearer. Firstly, naringin was formed by the catalysis of CHS and CHI with coumaryl coenzyme A and malonyl Co A. Then flavonols were formed under the action of F3H. The next step is to form colored anthocyanins under the action of DFR and ANS. Finally, through glycosylation, methylation, acylation, hydroxylation and other modifications to form a variety of anthocyanins with a stable structure [<xref ref-type="bibr" rid="scirp.87056-ref9">9</xref>] . Flavonoid 3-0-glycosyltransferase (3GT) gene is a downstream gene in anthocyanin synthesis pathway. It can catalyze the glycosylation of UDP glucose to replace the 3 hydroxyl groups of anthocyanin and make anthocyanin glycosylation to produce colored and stable anthocyanins. And move the maximum absorption spectrum to the ultraviolet end, thus increasing the blue tone of anthocyanins [<xref ref-type="bibr" rid="scirp.87056-ref10">10</xref>] . Glycosylation can change the hydrophilicity, biochemical activity and subcellular localization of anthocyanins, which is beneficial to the transport and storage of anthocyanins in cells and organisms [<xref ref-type="bibr" rid="scirp.87056-ref11">11</xref>] .</p><p>Some studies have shown that the anthocyanin content of plants lacking 3GT also decreased significantly [<xref ref-type="bibr" rid="scirp.87056-ref12">12</xref>] . 3GT gene belongs to a glycosyltransferase (GTs) family 1, whose enzyme protein has a conserved domain of about 44 amino acids at its C-terminal, known as plant secondary product glycosyltransferase (PSPG) box. At present, 3GT has been cloned and analyzed in many plants such as Zea mays [<xref ref-type="bibr" rid="scirp.87056-ref13">13</xref>] , Vitis vinifera [<xref ref-type="bibr" rid="scirp.87056-ref14">14</xref>] , Gentiana trflora [<xref ref-type="bibr" rid="scirp.87056-ref15">15</xref>] , Petunia hybrida [<xref ref-type="bibr" rid="scirp.87056-ref16">16</xref>] and so on, which has laid a foundation for understanding the metabolic regulation of anthocyanin synthesis pathway.</p><p>At present, the studies on R. rugosa are mainly focused on morphological classification, geographical distribution, essential oil extraction and food quality evaluation, and there are few reports on the anthocyanin biosynthesis mechanism, so we don’t know exactly how it works. In this study, based on the R. rugosa transcriptome data, we cloned and identified RrGT1 gene from the petals of R. rugosa ‘Zizhi’ for the first time. We carried out detailed bioinformatics analysis, homology analysis and the temporal and spatial expression pattern analysis of the RrGT1 gene in order to provide some useful informations for the subsequent color improvement project in R. rugosa.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Plant Materials</title><p>For R. rugosa, three varieties (R. rugosa ‘Zizhi’, R. rugosa ‘Fenzizhi’ and R. rugosa ‘Baizizhi’) cultivated in Rose germplasm nursery of Shandong Agricultural University was used as the test material. We collected the petals at the budding stage, initial opening stage, half opening stage, full opening stage and wilting stage in the forenoon on sunny days from 20 April to 10 May 2017. Seven tissues (roots, stems, leaves, petals at the budding stage, sepals, stamens and pistil) of R. rugosa ‘Zizhi’ were collected at the same time. After quick freezing of liquid nitrogen, all samples collected with three replicates were put into −80˚C refrigerator for storage.</p></sec><sec id="s2_2"><title>2.2. Extraction of Total RNA and Synthesis of the First-Strand cDNA</title><p>The extraction of total RNA is based on the specification of EASY spin plant RNA rapid extraction kit (Aidlab Biotech, Beijing, China). The integrity of RNA was detected by gel electrophoresis with 1.0% nondenatured agarose, the purity and concentration of RNA were detected by Nanodrop2000C ultramicro spectrophotometer (Thermo Fisher Scientific, Wilmington, Delaware, USA), and the qualified RNA was preserved at −80˚C. The first-strand cDNA was synthesized by referring to the steps of 5&#215; All-In-One RT MasterMix reverse transcription kit (ABM Company, Vancouver, Canada) and synthesized according to the requirements of RT-PCR and qRT-PCR.</p></sec><sec id="s2_3"><title>2.3. Full-Length CDS Cloning of the RrGT1 Gene</title><p>3' RACE specific primers were designed based on the sequence information provided by the Rosa transcriptome data. The cDNA 3' terminal sequence of the target gene was amplified by 3' RACE technology. The known target gene sequence in transcriptome data and the 3' terminal sequence obtained by RACE technique were spliced with DNAMAN software to obtain the full-length cDNA sequence of the RrGT1 gene. According to the sequence obtained by splicing, the upstream primer RrGT1-F containing the starting codon of the RrGT1 gene and the downstream primer RrGT1-R containing the terminating codon were designed and amplified. The estimated length of amplification was 1161 bp.</p></sec><sec id="s2_4"><title>2.4. Bioinformatics Analysis of the RrGT1 Gene</title><p>Bioinformatics analysis softwares and tools were used to predict the physicochemical properties and structural functions of the protein encoded by the RrGT1 gene, which provided a reference for the future research and application of the gene. The basic physical and chemical properties of the protein encoded by the RrGT1 gene were analyzed by using Prot-Param tools in ExPasy (http://web.expasy.org/protparam/). The CD-Search function (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) on NCBI was used to predict the conserved domain in the protein encoded by the RrGT1 gene. The 3D structure of the RrGT1 protein was predicted by online tool SWISS-MODEL. DNAMAN software and Blast tool in NCBI were used to analyze the amino acid sequence of the RrGT1 gene. The phylogenetic tree is constructed by using MEGA5.0 software.</p></sec><sec id="s2_5"><title>2.5. qRT-PCR Detection</title><p>We analyzed the gene expression by qRT-PCR on a Bio-Rad CFX96<sup>TM</sup> Real-Time PCR instrument (Bio-Rad, Inc., USA). The qRT-PCR mixture (20 μL total volume) contained 10 μL of SYBR&#174; Premix Ex Taq<sup>TM</sup> (TaKaRa, Inc., Japan), 8.2 μL of ddH<sub>2</sub>O, 0.4 μL of each primer and 1 μL of cDNA. The PCR program was carried out with an initial step of 95˚C for 30 s; 40 cycles of 95˚C for 5 s, 60˚C for 30 s; and then, 95˚C for 10 s, 65˚C for 5 s and 95˚C for 5 s for the dissociation stage. Each gene was assessed with three biological replications. The relative expression levels of the genes were calculated by the 2<sup>−ΔΔCt</sup> method [<xref ref-type="bibr" rid="scirp.87056-ref17">17</xref>] .</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Cloning of RrGT1 and Sequence Analysis</title><p>We obtained the RrGT1 gene 3' terminal sequence of 277 bp length by using nested PCR method (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). The full-length sequence (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)) of the RrGT1 gene was cloned by full-length primers (<xref ref-type="table" rid="table1">Table 1</xref>) and confirmed by sequencing. The RrGT1 gene has a complete open reading frame from the starting codon ATG to the termination codon TAA, encodes a 386-amino acids protein and has a polyA tail. Sequence alignments with the NCBI database showed the RrGT1 protein is a member of the GTB superfamily and has a typical plant secondary product glycosyltransferases conserved domain consisting of 44 amino acid residues at the C-terminal. According to online software prediction, the</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used in the present study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer Name</th><th align="center" valign="middle" >Sequence (5' - 3')</th><th align="center" valign="middle" >Description</th></tr></thead><tr><td align="center" valign="middle" >3' RrGT1-F-outer</td><td align="center" valign="middle" >ATGTCTTGGTCCTCGCATTTC</td><td align="center" valign="middle" >3' RACE for RrGT1</td></tr><tr><td align="center" valign="middle" >3' RrGT1-F-inner</td><td align="center" valign="middle" >GAGGGGAAGAAGATGAGAGGTAAAG</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >B26</td><td align="center" valign="middle" >GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >RrGT1-F</td><td align="center" valign="middle" >ATGTCAGGAAATCCACTGGATGC</td><td align="center" valign="middle" >Full-length cDNA for RrGT1</td></tr><tr><td align="center" valign="middle" >RrGT1-R</td><td align="center" valign="middle" >TTAAGGCGAAGAAATCAAATCTACC</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >RrGAPDH-F</td><td align="center" valign="middle" >TTCTGCCTGCTCTCAATG</td><td align="center" valign="middle" >qRT-PCR for RrGAPDH</td></tr><tr><td align="center" valign="middle" >RrGAPDH-R</td><td align="center" valign="middle" >TGCCTTCTTCTCAAGTCTG</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >qRrGT1-F</td><td align="center" valign="middle" >GTATTTGCCAACACACTGAGTAA</td><td align="center" valign="middle" >qRT-PCR for RrGT1</td></tr><tr><td align="center" valign="middle" >qRrGT1-R</td><td align="center" valign="middle" >CTGCAGTGGTAATGAGAGGGAG</td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><p>molecular formula of the RrGT1 protein is C<sub>1879</sub>H<sub>2964</sub>N<sub>494</sub>O<sub>556</sub>S<sub>14</sub>, the relative molecular mass is 41,820.02 Da, and the theoretical isoelectric point is pI = 5.03.</p></sec><sec id="s3_2"><title>3.2. Protein 3D Model Construction</title><p>During the construction of the RrGT1 protein 3D model, templates search with BLAST and HHBlits has been performed against the SWISS-MODEL template library. It was found that it had the highest homology with the UDP-glucose:anthocyanidin 3-O-glucosyltransferase protein model in the database (47.01%), so the RrGT1 protein 3D model (<xref ref-type="fig" rid="fig2">Figure 2</xref>) was constructed on the basis of its model.</p></sec><sec id="s3_3"><title>3.3. Homology Analysis</title><p>Sequence alignment of multiple species amino acids (<xref ref-type="fig" rid="fig3">Figure 3</xref>) showed that the</p><p>RrGT1 protein has strong species specificity in the N-terminal region and PSPG conserved domain in the C-terminal region. Using MEGA5.0 software, phylogenetic tree (<xref ref-type="fig" rid="fig4">Figure 4</xref>) was constructed from 21 plant amino acids sequences including R. rugosa RrGT1. The results showed that the RrGT1 gene had the closest genetic relationship with the EsUF3GT gene, and its homology reached 59%, which indicated that GTs gene is highly specific among different species.</p></sec><sec id="s3_4"><title>3.4. Temporal and Spatial Expression Patterns of the RrGT1 Gene</title><p>The expression levels of the RrGT1 gene, which significantly differed, were assessed during five flowering stages. For R. rugosa ‘Zizhi’ (<xref ref-type="fig" rid="fig5">Figure 5</xref>(a)), the highest expression level was observed during the full opening stage, and the lowest was observed during the budding stage. For R. rugosa ‘Fenzizhi’ (<xref ref-type="fig" rid="fig5">Figure 5</xref>(b)), the highest expression level was observed during the budding stage, and the expression levels of other four stages were relatively low. And for R. rugosa ‘Baizizhi’ (<xref ref-type="fig" rid="fig5">Figure 5</xref>(c)), the expression level was also highest during the full opening stage but lowest during the half opening stage. The expression patterns of the RrGT1 gene in R. rugosa ‘Zizhi’ and R. rugosa ‘Baizizhi’ showed the same trend.</p><p>Then the expression levels of the RrGT1 gene in three varieties was compared in five flowering stages (<xref ref-type="fig" rid="fig5">Figure 5</xref>(d)). In the budding stage, R. rugosa ‘Fenzizhi’ &gt; R. rugosa ‘Baizizhi’ &gt; R. rugosa ‘Zizhi’, while in the initial opening , half opening ,full opening and wilting stage, the trends of gene expression in the three varieties were consistent: R. rugosa ‘Zizhi’ &gt; R. rugosa ‘Baizizhi’ &gt; R. rugosa ‘Fenzizhi’.</p><p>The expression levels of the RrGT1 gene, which also significantly differed, were assessed in seven different tissue types of R. rugosa ‘Zizhi’ (<xref ref-type="fig" rid="fig5">Figure 5</xref>(e)). The expression level in the leaves, stems and flower buds was relatively high but was relatively low in the other tissues.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Although many genes have been reported to regulate the formation of flower color, there are few reports of downstream structural genes such as GTs. The final formation of anthocyanins depends on the glycosylation of GTs, so it is very important to elucidate the function and influence of the RrGT1 gene in R. rugosa color formation. In this study, we successfully cloned RrGT1 gene with full length cDNA of 1161bp, encoding 386 amino acids from the petals of R. rugosa ‘Zizhi’. It was predicted that the molecular formula of the protein encoded by the RrGT1 gene is C<sub>1879</sub>H<sub>2964</sub>N<sub>494</sub>O<sub>556</sub>S<sub>14</sub>, the relative molecular mass is 41820.02 Da, the theoretical isoelectric point pI = 5.03, which belongs to GTB superfamily. During the construction of the RrGT1 protein 3D model, it was found that the RrGT1 protein had the highest homology with the existing UDP-glucose: anthocyanidin 3-O-glucosyltransferase protein model (47.01%), which suggested that the protein encoded by RrGT1 gene was related to the glycosylation of anthocyanin.</p><p>The evolutionary analysis of flavonoids GTs by Sawada et al. [<xref ref-type="bibr" rid="scirp.87056-ref18">18</xref>] showed that GTs, which catalyze the glycosylation of flavonoids in different positions (3-O, 5-O, 7-O), were formed into different evolutionary branches (F3Gly T, F5Gly T, F7Gly T) without restriction of species. It suggested that the region-specific of flavonoids GTs to glycosyl receptors (catalytic site specificity) was formed before species differentiation. In the course of evolution, the ability to utilize UDP-sugar (UDP-glucose, UDP-rhamnose, UDP-galactose) was obtained. Phylogenetic tree analysis showed that RrGT1 was linked to EsUF3GT of 3-O-glycosylation of flavonoids, suggesting that RrGT1 may be involved in the glycosylation process of 3-O positions of flavonoids.</p><p>The alignment of amino acid sequences between RrGT1 and glycosyltransferases from the other 21 species indicated that RrGT1 possessed a common PSPG motif of the glycosyltransferases superfamily (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Previous studies have shown that the conserved region of PSPG is related to substrate recognition and catalytic activity of enzyme proteins [<xref ref-type="bibr" rid="scirp.87056-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.87056-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.87056-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.87056-ref22">22</xref>] . If the 44 amino acids of the PSPG domain are numbered, the amino acids at position 22, 23 and 44 play an important role in the selection of enzyme proteoglycan donors. The twenty-second position of tryptophan (Trp, W) can correctly locate UDP-glucose, while arginine (Arg, R) can make UDP-glucuronic acid locate correctly; the twenty-third position of serine (Ser, S) is highly conserved in UDP-glucurono-syltransferase [<xref ref-type="bibr" rid="scirp.87056-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.87056-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.87056-ref25">25</xref>] ; the forty-fourth glutamine (Gln, Q) and histidine (His, H) have strong conservatism in glucosyltransferase and galactotransferase respectively [<xref ref-type="bibr" rid="scirp.87056-ref22">22</xref>] . In the PSPG domain of the RrGT1 gene, the amino acids at position 22, 23 and 44 are cysteine (Cys, C), asparagine (Asn, N) and histidine (His, H), respectively. Therefore, we speculated that the RrGT1 gene is using UDP-glucose or galactose as the main glycosyl donor, but has no glucuronyltransferase activity.</p><p>The expression levels of the RrGT1 gene during flower development and in different tissues were investigated. It was found that the expression of the RrGT1 gene showed a different trend during different flowering periods in three R. rugosa varieties, indicating that the expression of the RrGT1 gene was developmentally regulated in the process of anthocyanin biosynthesis. Studies have shown that the accumulation of anthocyanin in red skinned sand pear, strawberries and litchi is positively correlated with the activity of UF3GT. Boss et al. [<xref ref-type="bibr" rid="scirp.87056-ref26">26</xref>] also detected the expression of UF3GT in the peels of red grape which accumulated anthocyanin, but not in other tissues of red grape and white grape without anthocyanin accumulation. Gong et al.’s [<xref ref-type="bibr" rid="scirp.87056-ref27">27</xref>] studies showed that the partial structural genes of Perilla frutescens anthocyanin metabolic pathway were only expressed in the leaves of red varieties, but not in green varieties or the expression in the green leaves was very low. About the tissue-specific expression in R. rugosa ‘Zizhi’, besides the high expression level in flowers, it is worth mentioning that the stems of R. rugosa ‘Zizhi’ are purple, which is consistent with the high expression level of the RrGT1 gene. In addition, RrGT1 was also highly expressed in the leaves, so we infer that RrGT1 is also involved in the glycosylation of secondary metabolites in leaves and plays an important role.</p><p>In conclusion, the cloning and expression analysis of the RrGT1 gene was beneficial to analyzing the molecular synthesis and regulation mechanism of anthocyanins, and also provided some important informations for the improvement of R. rugosa flower color in the future.</p></sec><sec id="s5"><title>Acknowledgements</title><p>This project was supported by the Agricultural Seed Project of Shandong Province ([<xref ref-type="bibr" rid="scirp.87056-ref2014">2014</xref>] No. 96).</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>The authors declare that they have no conflicts of interest.</p></sec><sec id="s7"><title>Cite this paper</title><p>Sui, X.M., Zhang, P.Y., Wang, Y., Zhao, M.Y., Han, X., Zhao, L.Y. and Xu, Z.D. (2018) Cloning and Expression Analysis of RrGT1 Gene Related to Anthocyanin Biosynthesis in Rosa rugosa. Agricultural Sciences, 9, 1085-1096. https://doi.org/10.4236/as.2018.98075</p></sec></body><back><ref-list><title>References</title><ref id="scirp.87056-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Li, M. (2006) Survey and Quality Evaluation of Shandong Rose Varieties. Shandong University of Traditional Chinese Medicine, Jinan.</mixed-citation></ref><ref id="scirp.87056-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Feng, L.G., Shao, D.W., Sheng, L.X., et al. (2009) Study on Investigation and Morphological Variation of Wild Rosa rugosa in China. Journal of Shandong Agricultural University, 40, 484-488.</mixed-citation></ref><ref id="scirp.87056-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Chen, S.-M., Zhu, X.-R., Chen, F.D., et al. (2010) Expression Characteristics of Anthocyanin Structural Genes in Different Flower Color Chrysanthemum Cultivars. Journal of Northwest Plants, No. 3, 453-458.</mixed-citation></ref><ref id="scirp.87056-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Kim, S.H., Lee, J.R., Hong, S.T., et al. (2003) Molecular Cloning and Analysis of Anthocyanin Biosynthesis Genes Preferentially Expressed in Apple Skin. Plant Science, 165, 403-413. https://doi.org/10.1016/S0168-9452(03)00201-2</mixed-citation></ref><ref id="scirp.87056-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Martens, S., Preu&amp;beta;, A. and Matern, U. (2010) Multifunctional Flavonoid Dioxygenases: Flavonol and Anthocyanin Biosynthesis in Arabidopsis thaliana L. Phytochemistry, 71, 1040-1049. https://doi.org/10.1016/j.phytochem.2010.04.016</mixed-citation></ref><ref id="scirp.87056-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Ge, C.L., Huang, C.H. and Xu, X.B. (2012) Research on Anthocyanins Biosynthesis in Fruit. Acta Horticulturae Sinica, 39, 1655-1664.</mixed-citation></ref><ref id="scirp.87056-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Forkmann, G. (1991) Flavonoids as Flower Pigments: The Formation of the Natural Spectrum and Its Extension by Genetic Engineering. Plant Breeding, 106, 1-26. https://doi.org/10.1111/j.1439-0523.1991.tb00474.x</mixed-citation></ref><ref id="scirp.87056-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Springob, K., Nakajima, J.I., Yamazaki, M., et al. (2003) Recent Advances in the Biosynthesis and Accumutation of Anthocyanins. Natural Product Reports, 20, 288-303. https://doi.org/10.1039/b109542k</mixed-citation></ref><ref id="scirp.87056-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Yonekura-Sakakibara, K., Nakayama, T., Yamazaki, M., et al. (2009) Modification and Stabilization of Anthocyanins. Springer, New York, 169-190.</mixed-citation></ref><ref id="scirp.87056-ref10"><label>10</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Zheng</surname><given-names> Z.L. </given-names></name>,<etal>et al</etal>. (<year>1994</year>)<article-title>Flower Color Gene Engineering of Flower Crops</article-title><source> Northern Horticulture</source><volume> 3</volume>,<fpage> 37</fpage>-<lpage>38</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.87056-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Vogt, T. and Jones, P. (2000) Glycosyltransferases in Plant Natural Product Synthesis: Characterization of a Supergene Family. Trends in Plant Science, 5, 380-386. https://doi.org/10.1016/S1360-1385(00)01720-9</mixed-citation></ref><ref id="scirp.87056-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Tohge, T., Nishiyama, Y., Hirai, M.Y., et al. (2005) Functional Genomics by Integrated Analysis of Metabolome and Transcriptome of Arabidopsis Plants Over-Expressing an MYB Transcription Factor. The Plant Journal, 42, 218-235. https://doi.org/10.1111/j.1365-313X.2005.02371.x</mixed-citation></ref><ref id="scirp.87056-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Goto, T., Kondo, T., Tamura, H., et al. (1982) Structure of Gentiodelphin, an Acylated Anthocyanin Isolated from Gentiana makinoi, That Is Stable in Dilute Aqueous Solution. Tetrahedron Letters, 23, 3695-3698. https://doi.org/10.1016/S0040-4039(00)88660-8</mixed-citation></ref><ref id="scirp.87056-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Hall, D., Yuan, X.X., Murata, J., et al. (2012) Molecular Cloning and Biochemical Characterization of the UDP-Glucose: Flavonoid 3-0-Glucosyltransferase from Concord Grape (Vitis labrusca). Phytochemistry, 74, 90-99. https://doi.org/10.1016/j.phytochem.2011.10.007</mixed-citation></ref><ref id="scirp.87056-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Tanaka, Y., Yoshikazu, K., Fukuchi-Mlizutani, M., et al. (1996) Molecular and Biochemical Characterization of Three Anthocyanin Synthetic Enzymes from Gentiana triflora. Plant and Cell Physiology, 37, 711-716. https://doi.org/10.1093/oxfordjournals.pcp.a029004</mixed-citation></ref><ref id="scirp.87056-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Yamazaki, M., Yamagishi, E., Gong, Z.Z., et al. (2002) Two Flavonoid Glucosyltransferases from Petunia hybrida: Molecular Cloning, Biochemical Properties and Developmentally Regulated Expression. Plant Molecular Biology, 48, 401-411. https://doi.org/10.1023/A:1014043214943</mixed-citation></ref><ref id="scirp.87056-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Schmittgen, T.D. and Livak, K.J. (2008) Analyzing Real-Time PCR Data by the Comparative C (T) Method. Nature Protocols, 3, 1101-1108. https://doi.org/10.1038/nprot.2008.73</mixed-citation></ref><ref id="scirp.87056-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Sawada, S., Suzuki, H., Ichimaida, F., et al. (2005) UDP-Glucuronic Acid: Anthocyanin Glucuronosyltransferase from Red Daisy (Bellis perennis) Flowers. The Journal of Biological Chemistry, 280, 899-906. https://doi.org/10.1074/jbc.M410537200</mixed-citation></ref><ref id="scirp.87056-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Gachon, C.M., Meurinne, M.L. and Saindrenan, P. (2005) Plant Secondary Metabolism Glycosyltransferases: The Emerging Functional Analysis. Trends in Plant Science, 10, 542-549. https://doi.org/10.1016/j.tplants.2005.09.007</mixed-citation></ref><ref id="scirp.87056-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Sakakibara, K.Y. and Hanada, K. (2011) An Evolutionary View of Functional Diversity in Family 1 Glycosyltransferases. The Plant Journal, 66, 182-193. https://doi.org/10.1111/j.1365-313X.2011.04493.x</mixed-citation></ref><ref id="scirp.87056-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Wang, X.Q. (2009) Structure, Mechanism and Engineering of Plant Natural Product Glycosyltransferases. FEBS Letters, 583, 3303-3309. https://doi.org/10.1016/j.febslet.2009.09.042</mixed-citation></ref><ref id="scirp.87056-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Kubo, A., Arai, Y., Nagashima, S., et al. (2004) Alteration of Sugar Donor Specificities of Plant Glycosyltransferases by a Single Point Mutation. Archives of Biochemistry and Biophysics, 429, 198-203. https://doi.org/10.1016/j.abb.2004.06.021</mixed-citation></ref><ref id="scirp.87056-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Shao, H., He, X.Z., Achnine, L., et al. (2005) Crystal Structures of a Multifunctional Triterpene/Flavonoid Glycosyltransferase from Medicago Truncatula. Plant Cell, 17, 3141-3154. https://doi.org/10.1105/tpc.105.035055</mixed-citation></ref><ref id="scirp.87056-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Li, L.N., Modolo, L.V., Trevino, L.E., et al. (2007) Crystal Structure of Medicago truncatula UGT85H2—Insights into the Trusctural Basis of a Multifunctional (Iso) Flavonoid Glycosyltransferase. Journal of Molecular Biology, 370, 951-963. https://doi.org/10.1016/j.jmb.2007.05.036</mixed-citation></ref><ref id="scirp.87056-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Modolo, L.V., Li, L.N., Pan, H.Y., et al. (2009) Crystal Structures of Glycosyltransferase UGT/8G1 Reveal the Molecular Basis for Glycosylation and Deglycosylation of (Iso) Flavonoids. Journal of Molecular Biology, 392, 1292-1302. https://doi.org/10.1016/j.jmb.2009.08.017</mixed-citation></ref><ref id="scirp.87056-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Boss, P.K., Davies, C. and Robinson, S.P. (1996) Expression of Anthocyanin Biosynthesis Pathway Genes in Red and White Grapes. Plant Molecular Biology, 32, 565-569. https://doi.org/10.1007/BF00019111</mixed-citation></ref><ref id="scirp.87056-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Gong, Z.Z., Yamazaki, M., Sugiyama, M., et al. (1997) Cloning and Molecular Analysis of Structural Genes Involved in Anthocyanin Biosynthesis and Expressed in a Forma-Specific Manner in Perilla Frutescens. Plant Molecular Biology, 35, 915-927. https://doi.org/10.1023/A:1005959203396</mixed-citation></ref></ref-list></back></article>