<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2018.87041</article-id><article-id pub-id-type="publisher-id">AiM-86325</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Analysis of Hyaluronidase Expression by qPCR in Egyptian Clinical Isolates of &lt;i&gt;Staphylococcus aureus&lt;/i&gt; and Its Correlation with Phenotypic Plate Assay
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Sarah</surname><given-names>A. Abdelkader</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mohammed</surname><given-names>El-Mowafy</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Eman</surname><given-names>Abdelmegeed</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ramadan</surname><given-names>Hassan</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Microbiology and Immunology, Faculty of Pharmacy, Mansoura University, Mansoura, Egypt</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>seven@mans.edu.eg(SAA)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>26</day><month>07</month><year>2018</year></pub-date><volume>08</volume><issue>07</issue><fpage>614</fpage><lpage>624</lpage><history><date date-type="received"><day>11,</day>	<month>May</month>	<year>2018</year></date><date date-type="rev-recd"><day>27,</day>	<month>July</month>	<year>2018</year>	</date><date date-type="accepted"><day>30,</day>	<month>July</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Hyaluronidase enzyme (HysA) is an extracellular enzyme that is considered to be an important virulence factor for Staphylococcus aureus. We screened the production of HysA enzyme in the spent media of Egyptian clinical isolates (32 isolates) via phenotypic plate assay. We found that 75% of the isolates (24 isolates) were able to produce HysA enzyme. We designed primers for qPCR analysis of hysA mRNA expression that was derived from the alignment of hysA gene sequences of 41 strains of S. aureus. The designed primers could be used for the amplification of hysA in 79.2% of the isolates (19 isolates) that were positive for HysA production as demonstrated by phenotypic plate assay. A significant positive correlation, as indicated by Pearson correlation analysis (r = 0.84 at P &lt; 0.001), was found between phenotypic plate assay and qPCR of mRNA expression of hysA in the investigated isolates of S. aureus. In conclusion, we analyzed for the first time hysA mRNA expression via qPCR in S. aureus. Additionally, our work showed a good agreement between the phenotypic assay of HysA production via plate assay and hysA expression in S. aureus. The qPCR analysis of this study could be used as a more reliable quantitative method for hysA expression analysis particularly in infected animal models of S. aureus.
 
</p></abstract><kwd-group><kwd>Hyaluronidase</kwd><kwd> qPCR</kwd><kwd> &lt;i&gt;Staphylococcus aureus&lt;/i&gt; </kwd><kwd> Virulence Factor</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Staphylococcus aureus is a Gram positive bacterium that causes a diverse range of both community-associated and hospital-acquired infections [<xref ref-type="bibr" rid="scirp.86325-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.86325-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.86325-ref3">3</xref>] . S. aureus contains various virulence factors that consist of both surface-associated proteins and secreted proteins including hemolysins, immunomodulators and a number of exoenzymes [<xref ref-type="bibr" rid="scirp.86325-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.86325-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.86325-ref6">6</xref>] .</p><p>Bacterial hyaluronidases (known as hyaluronate lyases) are a class of enzymes that degrade hyaluronic acid (HA) and to lower extent chondroitin and chondroitin sulfate [<xref ref-type="bibr" rid="scirp.86325-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.86325-ref8">8</xref>] . HA is a high molecular-weight polymer composed of alternating units of D-glucuronic acid and N-acetylglucosamine [<xref ref-type="bibr" rid="scirp.86325-ref9">9</xref>] . This polymer is a major component of the extracellular matrix of human tissues and it is abundant in the skin, skeletal tissue, umbilical cord, lungs, heart valves, brain, blood, liver and a number of other tissues [<xref ref-type="bibr" rid="scirp.86325-ref10">10</xref>] . Moreover, it plays important roles for inflammation, water homeostasis, in addition to being an immune regulator [<xref ref-type="bibr" rid="scirp.86325-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.86325-ref12">12</xref>] . Hyaluronidases have been found to be virulence factors that are involved in the invasion, and penetration of tissues in many of Gram positive bacteria [<xref ref-type="bibr" rid="scirp.86325-ref9">9</xref>] .</p><p>S. aureus is able to infect many tissues which contain high HA concentrations using HysA as a virulence factor [<xref ref-type="bibr" rid="scirp.86325-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.86325-ref14">14</xref>] . The expression of HysA by S. aureus can be assayed phenotypically by various methods e.g. plate assay [<xref ref-type="bibr" rid="scirp.86325-ref15">15</xref>] , turbidemetry [<xref ref-type="bibr" rid="scirp.86325-ref16">16</xref>] , viscometry [<xref ref-type="bibr" rid="scirp.86325-ref17">17</xref>] , colorimetry [<xref ref-type="bibr" rid="scirp.86325-ref18">18</xref>] and zymography [<xref ref-type="bibr" rid="scirp.86325-ref19">19</xref>] . The disadvantages of these classical methods are that they often lack sensitivity, and selectivity, and require large amounts of samples [<xref ref-type="bibr" rid="scirp.86325-ref10">10</xref>] . Despite the vital role of hyaluronidase for S. aureus as a virulence factor, no study has analyzed the hysA mRNA expression via qPCR which would be a more reliable and accurate method for quantitative analysis of hysA expression particularly in infected animal models of S. aureus. Therefore, our main aim in this study was to analyze the expression of hysA in S. aureus clinical isolates via qPCR and to correlate these results with the phenotypic plate assay. The qPCR analysis of hysA expression will be a more reliable and accurate method for quantitative analysis of the enzyme expression particularly in infected animal models of S. aureus.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Collection, Purification and Identification of S. aureus Isolates</title><p>32 isolates of S. aureus (S1-S32) were collected from different sources (wounds, burns, and throat) obtained from Mansoura university hospitals, Egypt. This work was done after approval of the administrative authorities (Research Ethics Committee) in the Faculty of Pharmacy, Mansoura University, Egypt. The isolates were purified and confirmed as S. aureus by Gram staining and biochemical reactions (Mannitol salt agar, catalase, and coagulase) and using S. aureus Newman as a reference strain [<xref ref-type="bibr" rid="scirp.86325-ref20">20</xref>] that was kindly provided by Dr. Mohammed Youssef Ali (Associate professor of microbiology and immunology, faculty of pharmacy, Mansoura university). All bacterial strains were stored in brain heart infusion (BHI) broth medium containing 20% glycerol at −80˚C, until further analyses were performed.</p></sec><sec id="s2_2"><title>2.2. Spent Media Preparation</title><p>Overnight cultures of different isolates in BHI broth were incubated at 37˚C with shaking at 200 rpm. Later, subculturing into fresh BHI broth medium (starting OD<sub>630 nm</sub> equivalent to 1.7 &#215; 10<sup>7</sup> CFU/ml) was performed with shaking at 200 rpm, and 37˚C. Samples (1 ml) were taken at the required time point, and centrifuged at 3200 x g for 5 min. Spent media (supernatant containing the produced HysA enzyme) were filter sterilized and stored at −80˚C till further analyses.</p></sec><sec id="s2_3"><title>2.3. Screening and Quantitative Assay of the Hyaluronidase-Producing S. aureus Isolates Using Plate Assay Method</title><p>The procedure of [<xref ref-type="bibr" rid="scirp.86325-ref8">8</xref>] was followed with minor modifications. Sterile glass plates (12 cm diameter) containing 1% agarose, 1% bovine serum albumin (BSA), and 0.4 mg/ml of HA (Sigma, H-1504) in 0.3 M sodium phosphate buffer (pH 5.3) were prepared. After solidification of the agarose medium, wells (7 mm diameter) were made aseptically, and 100 μl of spent media were added into each well.</p><p>Plates were incubated for 24 h at 37˚C before flooding with 2 M acetic acid. Clear zones were observed against a background of opaque precipitated BSA conjugated to the undigested HA and their diameters were measured in millimeters. Hyaluronidase (Sanofi, 1500 IU) was used as a standard positive control and for construction of standard curve after dissolving in 500 &#181;l BHI broth to obtain a final concentration of 3000 IU/ml, where two fold serial dilutions from the concentration 3000 IU/ml till 5.8 IU/ml were prepared in BHI broth. Later, 100 &#181;l from each dilution was examined for its hyaluronidase as indicated above. The standard curve was constructed from plotting of the logarithmic concentration of standard hyaluronidase (3000 - 5.8 IU/ml) and the clear zones of HA hydrolysis subtracted from the cup diameter (<xref ref-type="fig" rid="fig1"><xref ref-type="fig" rid="fig">Figure </xref>1</xref>). The hyaluronidase activity present in the spent medium of each isolate was expressed as IU/ml according to the standard hyaluronidase (<xref ref-type="fig" rid="fig1"><xref ref-type="fig" rid="fig">Figure </xref>1</xref>).</p></sec><sec id="s2_4"><title>2.4. Primer Design via Multiple Sequence Alignment for Detection of Hyaluronidase Expression by Quantitative Real-Time-PCR (qPCR)</title><p>Hyaluronidase DNA sequences of 41 S. aureus strains were obtained from the GenBank database and aligned by using the multisequence alignment tool (Clustal omega) that is provided by EMBL-EBI website (<xref ref-type="fig" rid="fig">Figure </xref>S1). For qPCR analysis for hyaluronidase expression, forward (Hyalq-F) and reverse (Hyalq-R) primers (<xref ref-type="table" rid="table1">Table 1</xref>) were precisely designed from the conserved regions of the aligned sequences and with the consideration of the optimum GC% (40% - 60%).</p></sec><sec id="s2_5"><title>2.5. RNA Isolation, cDNA Synthesis, and qPCR</title><p>For qPCR analysis of hysA expression, the optimum time for RNA extraction was investigated by measurement of HysA activity in the spent media and the OD630nm at different time points (3, 5, 9, 24 h). For such optimization, two</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >Sequence (5’-3’)</th><th align="center" valign="middle" >Relevance</th><th align="center" valign="middle" >Amplicon size (bp)</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle" >Hyalq-F</td><td align="center" valign="middle" >GGTGCTTATGGCGTTGTACT</td><td align="center" valign="middle"  rowspan="2"  >qPCR of hysA expression</td><td align="center" valign="middle"  rowspan="2"  >163</td><td align="center" valign="middle"  rowspan="2"  >This study</td></tr><tr><td align="center" valign="middle" >Hyalq-R</td><td align="center" valign="middle" >CGTGATAAATCCATCATTTCACC</td></tr><tr><td align="center" valign="middle" >GyrB-F</td><td align="center" valign="middle" >CCAGGTAAATTAGCCGATTGC</td><td align="center" valign="middle"  rowspan="2"  >qPCR of gyrB expression</td><td align="center" valign="middle"  rowspan="2"  >121</td><td align="center" valign="middle"  rowspan="2"  >[<xref ref-type="bibr" rid="scirp.86325-ref21">21</xref>]</td></tr><tr><td align="center" valign="middle" >GyrB-R</td><td align="center" valign="middle" >AAATCGCCTGCGTTCTAGAG</td></tr></tbody></table></table-wrap><p>F: Foward primer, R: Reverse primer.</p><p>strains were selected as representative samples; Newman, and S10.</p><p>Cell pellets were harvested from aliquots of 1.5 ml at each specified time for RNA isolation and centrifuged at 3200 x g and 4˚C for 5 min. Glass beads (150 mg, 0.25 - 0.5 mm diameter) [Roth, Carlsruhe, Germany] and 300 &#181;l of triazole reagent (Zymo research) were added to the cell pellet. The mixture was subjected to alternating intervals of vortexing (30 sec) and immersion in ice (30 sec) for total of 10 min. Later, freezing at −80˚C (3 min) and thawing at 37˚C (3 min) was performed 3 times. The disrupted cells were centrifuged at 3200 x g and 4˚C for 5 min. RNA was precipitated according to the protocol of the triazole reagent company for isolation of RNA by traizole method. The precipitated RNA was dried, dissolved in 20 &#181;l RNAase free water, and stored at −80˚C till further analysis. The quality of RNA was checked by agarose gel electrophoresis and RNA concentration was determined using nanodrop.</p><p>The synthesis of cDNA from the purified RNA of different isolates was performed using the Quantitect Reverse Transcription kit (Qiagen, Hilden, Germany) according to the manufacturers’ instructions. Real-time PCR was performed in 20 μl reaction volumes using the Rotor-Gene Q (Qiagen) and 5x HOT FIREPol EvaGreen HRM Mix according to the manufacturers’ instructions. Each reaction volume contained 4 μl 5x HOT FIREPol EvaGreen HRM, 0.5 μl forward (250 nM final), 0.5 μl reverse primer (250 nM final), 13 μl sterile water (PCR grade), and 2 μl of template cDNA. The gene encoding GyrB was used as a reference gene and amplified using the GyrB-F and GyrB-R primers (<xref ref-type="table" rid="table1">Table 1</xref>). Negative control reactions without cDNA template were included in each PCR run. Additionally, strain S32 was included in each run as a control for the strains that were negative for HysA production by phenotypic assay. The PCR was performed using the following conditions: initial activation at 95˚C for 12 min, followed by 40 cycles of denaturation (95˚C for 12 sec), annealing (59˚C for 20 sec), and extension (72˚C for 20 sec).</p><p>Melting curves were analyzed to check PCR specificity, and the absence of primer dimers. The PCR efficiency (E) of each primer pair was determined by making dilution series (undiluted, 1/5, 1/10, 1/50, and 1/100) using cDNA of S. aureus strain Newman as a template. The cDNA sample of S. aureus strain Newman was used as a calibrator sample in all qPCR runs to minimize run-to-run variations. The threshold cycle (CT) values were calculated by the Rotor-Gene Q software, and exported to Excel for relative quantification analysis. To ensure the accuracy of amplification, all generated amplicons were separated by agarose gel electrophoresis in a 2% agarose gel, stained with ethidium bromide, and visualized on a UV transilluminator.</p></sec><sec id="s2_6"><title>2.6. Statistical Analysis</title><p>Results were statistically analyzed using Excel program. The values for either concentration/OD630nm (Phenotypic assay) or the fold of change in RNA expression (Genotypic assay) were calculated as the average mean &#177; SD of 3 independent experiments. The correlation between the phenotypic production of HysA, as indicated by plate assay, and the qPCR analysis of hysA expression, was performed using the Pearson correlation analysis test.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Phenotypic Screening of HysA Production by the Clinical Isolates of S. aureus via Plate Assay</title><p>Twenty four strains (S1-S24) out of 32 strains were able to produce HysA as indicated by the clear zones obtained from the plate assay. The concentration of hyaluronidase in the spent media was obtained from the standard curve of hyaluronidase enzyme (<xref ref-type="fig" rid="fig1"><xref ref-type="fig" rid="fig">Figure </xref>1</xref>), which was then normalized to the OD<sub>630 nm</sub> of each individual culture (Concentration/OD<sub>630 nm</sub>). The highest HysA producing strain was S10, followed by Newman as indicated in <xref ref-type="table" rid="table2">Table 2</xref>.</p></sec><sec id="s3_2"><title>3.2. qPCR Analysis of hysA mRNA Expression in the HysA Producing Clinical Isolates of S. aureus</title><p>As indicated in <xref ref-type="fig" rid="fig">Figure </xref>2, the highest production of HysA was detected after 3 h cultivation of subcultures of the strains; Newman and S10. Therefore, for qPCR analysis of hysA mRNA expression, the RNA was isolated from the subcultures of the HysA producing isolates of S. aureus after 3 h cultivation.</p><p>The efficiency of amplification of hysA and gyrB genes were 1.7 and 1.87 respectively, as determined by the software of Rotor gene Q. To correct for the difference between amplification efficiencies of both genes, the Paffl method [<xref ref-type="bibr" rid="scirp.86325-ref22">22</xref>] was used in this study to determine the relative expression of hysA gene in different isolates using Newman as a calibrator strain. The fold of change (FC) in expression of hysA in different clinical isolates relative to hysA expression by Newman is shown as mean &#177; SD of three independent experiments (<xref ref-type="table" rid="table2">Table 2</xref>).</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Phenotypic assay of HysA production and qPCR analysis of expression of hysA from different isolates of S. aureus. The values for either Concentration/OD<sub>630</sub><sub> </sub><sub>nm</sub> or the fold of change are the average mean &#177; SD of 3 independent experiments</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  colspan="5"  >Strains producing HysA and their hysA expression could be detected by qPCR</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >Strain</td><td align="center" valign="middle"  colspan="2"  >Phenotypic assay</td><td align="center" valign="middle"  colspan="2"  >Genotypic assay</td></tr><tr><td align="center" valign="middle" >Rank</td><td align="center" valign="middle" >Concentration/OD<sub>630</sub><sub> </sub><sub>nm</sub> (Mean &#177; SD)</td><td align="center" valign="middle" >Fold of change (Mean &#177; SD)</td><td align="center" valign="middle" >Rank</td></tr><tr><td align="center" valign="middle" >S10</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >938.38 &#177; 94.22</td><td align="center" valign="middle" >127.86 &#177; 3.315</td><td align="center" valign="middle" >1</td></tr><tr><td align="center" valign="middle" >Newman</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >397.00 &#177; 4.24</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >3</td></tr><tr><td align="center" valign="middle" >S5</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >322.29 &#177; 52.03</td><td align="center" valign="middle" >0.631 &#177; 0.023</td><td align="center" valign="middle" >4</td></tr><tr><td align="center" valign="middle" >S8</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >295.50 &#177; 21.92</td><td align="center" valign="middle" >0.579 &#177; 0.028</td><td align="center" valign="middle" >5</td></tr><tr><td align="center" valign="middle" >S3</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >273.65 &#177; 75.87</td><td align="center" valign="middle" >0.025 &#177; 0.042</td><td align="center" valign="middle" >17</td></tr><tr><td align="center" valign="middle" >S9</td><td align="center" valign="middle" >6</td><td align="center" valign="middle" >270.16 &#177; 64.83</td><td align="center" valign="middle" >0.326 &#177; 0.027</td><td align="center" valign="middle" >8</td></tr><tr><td align="center" valign="middle" >S7</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >236.37 &#177; 19.28</td><td align="center" valign="middle" >0.363 &#177; 0.041</td><td align="center" valign="middle" >7</td></tr><tr><td align="center" valign="middle" >S6</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >219.50 &#177; 14.85</td><td align="center" valign="middle" >2.243 &#177; 0.604</td><td align="center" valign="middle" >2</td></tr><tr><td align="center" valign="middle" >S2</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >215.62 &#177; 23.46</td><td align="center" valign="middle" >0.264 &#177; 0.113</td><td align="center" valign="middle" >9</td></tr><tr><td align="center" valign="middle" >S20</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >212.16 &#177; 17.20</td><td align="center" valign="middle" >0.175 &#177; 0.004</td><td align="center" valign="middle" >12</td></tr><tr><td align="center" valign="middle" >S4</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >201.30 &#177; 15.99</td><td align="center" valign="middle" >0.413 &#177; 0.424</td><td align="center" valign="middle" >6</td></tr><tr><td align="center" valign="middle" >S13</td><td align="center" valign="middle" >12</td><td align="center" valign="middle" >180.49 &#177; 9.34</td><td align="center" valign="middle" >0.190 &#177; 0.083</td><td align="center" valign="middle" >11</td></tr><tr><td align="center" valign="middle" >S1</td><td align="center" valign="middle" >13</td><td align="center" valign="middle" >145.31 &#177; 7.51</td><td align="center" valign="middle" >0.145 &#177; 0.050</td><td align="center" valign="middle" >13</td></tr><tr><td align="center" valign="middle" >S12</td><td align="center" valign="middle" >14</td><td align="center" valign="middle" >135.98 &#177; 43.94</td><td align="center" valign="middle" >0.226 &#177; 0.134</td><td align="center" valign="middle" >10</td></tr><tr><td align="center" valign="middle" >S23</td><td align="center" valign="middle" >15</td><td align="center" valign="middle" >107.50 &#177; 17.68</td><td align="center" valign="middle" >0.005 &#177; 0.0006</td><td align="center" valign="middle" >19</td></tr><tr><td align="center" valign="middle" >S21</td><td align="center" valign="middle" >16</td><td align="center" valign="middle" >107.30 &#177; 10.32</td><td align="center" valign="middle" >0.036 &#177; 0.0078</td><td align="center" valign="middle" >16</td></tr><tr><td align="center" valign="middle" >S11</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >99.15 &#177; 12.93</td><td align="center" valign="middle" >0.001 &#177; 0.0003</td><td align="center" valign="middle" >20</td></tr><tr><td align="center" valign="middle" >S22</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" >74.87 &#177; 10.08</td><td align="center" valign="middle" >0.038 &#177; 0.001</td><td align="center" valign="middle" >15</td></tr><tr><td align="center" valign="middle" >S19</td><td align="center" valign="middle" >19</td><td align="center" valign="middle" >72.65 &#177; 3.33</td><td align="center" valign="middle" >0.013 &#177; 0.002</td><td align="center" valign="middle" >18</td></tr><tr><td align="center" valign="middle" >S18</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >52.64 &#177; 10.42</td><td align="center" valign="middle" >0.137 &#177; 0.049</td><td align="center" valign="middle" >14</td></tr><tr><td align="center" valign="middle"  colspan="5"  >Strains producing HysA and their hysA expression could not be detected by qPCR</td></tr><tr><td align="center" valign="middle" >Strain</td><td align="center" valign="middle"  colspan="4"  >Concentration/OD<sub>630</sub><sub> </sub><sub>nm</sub> (Mean &#177; SD)</td></tr><tr><td align="center" valign="middle" >S14</td><td align="center" valign="middle"  colspan="4"  >66.8 &#177; 15.77</td></tr><tr><td align="center" valign="middle" >S15</td><td align="center" valign="middle"  colspan="4"  >30.1 &#177; 6.52</td></tr><tr><td align="center" valign="middle" >S16</td><td align="center" valign="middle"  colspan="4"  >20.2 &#177; 5.43</td></tr><tr><td align="center" valign="middle" >S17</td><td align="center" valign="middle"  colspan="4"  >9.1 &#177; 2.22</td></tr><tr><td align="center" valign="middle" >S24</td><td align="center" valign="middle"  colspan="4"  >63 &#177; 14.34</td></tr></tbody></table></table-wrap></sec></sec><sec id="s4"><title>4. Discussion</title><p>Few reports have focused on the study of hyaluronidase production by S. aureus, despite the importance of hyaluronidase enzyme as a virulence factor for Gram positive cocci [<xref ref-type="bibr" rid="scirp.86325-ref9">9</xref>] . Such reports were interested in either phenotypic screening of the enzyme production by different species of Staphylococcus [<xref ref-type="bibr" rid="scirp.86325-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.86325-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.86325-ref25">25</xref>] , or investigation of its role in the virulence of S. aureus [<xref ref-type="bibr" rid="scirp.86325-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.86325-ref14">14</xref>] .</p><p>In this work, we performed phenotypic analysis for HysA production by different clinical isolates using a plate assay. The plate assay showed that 75% of the isolates (24 out of 32 isolates) were able to produce hyaluronidase. In previous studies such percent was either 91.2% [<xref ref-type="bibr" rid="scirp.86325-ref23">23</xref>] , 93% [<xref ref-type="bibr" rid="scirp.86325-ref25">25</xref>] or 99.5% [<xref ref-type="bibr" rid="scirp.86325-ref24">24</xref>] .</p><p>The previous studies on genotypic analysis of hysA in S. aureus were restricted on either the detection of the gene by Southern blot [<xref ref-type="bibr" rid="scirp.86325-ref25">25</xref>] , DNA microarray [<xref ref-type="bibr" rid="scirp.86325-ref26">26</xref>] or semiquantitative analysis via Northern blot [<xref ref-type="bibr" rid="scirp.86325-ref8">8</xref>] . None of the previous studies tried to perform genotypic analysis of hysA expression via qPCR. Therefore, we were interested in quantitative detection of hysA mRNA expression via qPCR.</p><p>We determined the concentration/OD<sub>630 nm</sub> for HysA production at different time points for S10 and Newman strains (the 2 highest strains producing HysA as indicated from our preliminary investigations). As shown in <xref ref-type="fig" rid="fig">Figure </xref>2, the maximum productivity of the cells in both strains was found to be after 3 h of cultivation of the subcultures. Consequently, the optimum time for RNA extraction in this study was considered to be after 3 h cultivation in the early exponential phase of growth. We designed forward and reverse primers in the conserved regions of hysA after alignment of the gene sequences of 41 strains of S. aureus from the Genbank (<xref ref-type="fig" rid="fig">Figure </xref>S1). The primers were used for the qPCR analysis of the mRNA expression of hysA in the isolates that were found to produce the enzyme after plate assay (24 out of 32). The ability of the designed primers to amplify hysA was investigated through both the analysis of the expected amplicons via agarose gel electrophoresis and the amplification plots after performing qPCR in the Rotor-Gene Q. Our results showed that the designed primers successfully amplified the hysA gene in 79.2% of the HysA producing isolates (19 out of 24 isolates) as demonstrated in <xref ref-type="table" rid="table2">Table 2</xref>. The last 19 isolates (target isolates) together with the Newman strain were used to investigate the correlation between the phenotypic assay via plate assay and the quantitative genotypic assay using qPCR. The reason that 5 isolates were associated with HysA production in the plate assay and could not be amplified by the designed primers, might be the presence of mutations in the conserved regions at which the primers bind in the hysA gene.</p><p>Previous studies correlated the measured phenotypic character for different genes and their genetic expression in different organisms e.g. antimicrobial resistance genes [<xref ref-type="bibr" rid="scirp.86325-ref27">27</xref>] and virulence genes [<xref ref-type="bibr" rid="scirp.86325-ref28">28</xref>] in Pseudomonas aeruginosa, genes regulating metabolite concentrations in the yeast Saccharomyces cerevisiae [<xref ref-type="bibr" rid="scirp.86325-ref29">29</xref>] , and scoC gene in Bacillus subtilis [<xref ref-type="bibr" rid="scirp.86325-ref30">30</xref>] . Similarly, we studied the correlation between phenotypic plate assay and qPCR analysis for the hysA gene in the 19 target isolates using Pearson’s correlation coefficient. A Pearson correlation coefficient (r) of 0.841 was calculated between the replicates of concentration/OD<sub>630 nm</sub> for HysA production and the fold of change in hysA mRNA expression for each isolate. The calculated r indicates a significant positive agreement between plate assay method and the quantitative assay of mRNA expression using qPCR at either P &lt; 0.05 (Critical r value = 0.444) or P &lt; 0.001 (Critical r value = 0.679).</p></sec><sec id="s5"><title>5. Conclusion</title><p>In conclusion, we established for the first time a protocol and primers for the qPCR analysis of the hysA mRNA expression in S. aureus. Moreover, our work showed the agreement between the phenotypic assay of HysA production via plate assay and hysA expression in S. aureus. Future work will be done to correlate the virulence of S. aureus in infected animal models and the hysA expression analysis using the qPCR protocol of this study.</p></sec><sec id="s6"><title>Funding</title><p>This work received no specific grant from any funding agency.</p></sec><sec id="s7"><title>Conflict of Interest</title><p>The authors declare that they have no conflict of interest.</p></sec><sec id="s8"><title>Cite this paper</title><p>Abdelkader, S.A., El-Mowafy, M., Abdelmegeed, E. and Hassan, R. (2018) Analysis of Hyaluronidase Expression by qPCR in Egyptian Clinical Isolates of Staphylococcus aureus and Its Correlation with Phenotypic Plate Assay. Advances in Microbiology, 8, 614-624. https://doi.org/10.4236/aim.2018.87041</p></sec><sec id="s9"><title>Supplementary Materials Description</title></sec></body><back><ref-list><title>References</title><ref id="scirp.86325-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Styers, D., Sheehan, D.J., Hogan, P. and Sahm, D.F. (2006) Laboratory-Based Surveillance of Current Antimicrobial Resistance Patterns and Trends among Staphylococcus aureus: 2005 Status in the United States. Annals of Clinical Microbiology and Antimicrobials, 5, 2. &lt;br /&gt;https://doi.org/10.1186/1476-0711-5-2</mixed-citation></ref><ref id="scirp.86325-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Hoerr, V., Franz, M., Pletz, M.W., Diab, M., Niemann, S., Faber, C., Doenst, T., Schulze, P.C., Deinhardt-Emmer, S. and Loffler, B. (2018) S. aureus Endocarditis: Clinical Aspects and Experimental Approaches. International Journal of Medical Microbiology. &lt;br /&gt;https://doi.org/10.1016/j.ijmm.2018.02.004</mixed-citation></ref><ref id="scirp.86325-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Heriot, G.S., Tong, S.Y., Cheng, A.C. and Liew, D. (2018) What Risk of Endocarditis Is Low Enough to Justify the Omission of Transoesophageal Echocardiography in Staphylococcus aureus Bacteraemia? A Narrative Review. Clinical Microbiology and Infection. &lt;br /&gt;https://doi.org/10.1016/j.cmi.2018.03.027</mixed-citation></ref><ref id="scirp.86325-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Lacey, K.A., Geoghegan, J.A. and McLoughlin, R.M. (2016) The Role of Staphylococcus aureus Virulence Factors in Skin Infection and Their Potential as Vaccine Antigens. Pathogens, 5, 22.</mixed-citation></ref><ref id="scirp.86325-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Powers, M.E. and Bubeck Wardenburg, J. (2014) Igniting the Fire: Staphylococcus aureus Virulence Factors in the Pathogenesis of Sepsis. PLoS Pathogens, 10, e1003871. &lt;br /&gt;https://doi.org/10.1371/journal.ppat.1003871</mixed-citation></ref><ref id="scirp.86325-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Kong, C., Chee, C.F., Richter, K., Thomas, N., Abd Rahman, N. and Nathan, S. (2018) Suppression of Staphylococcus aureus Biofilm Formation and Virulence by a Benzimidazole Derivative, UM-C162. Scientific Reports, 8, 2758.  
&lt;br /&gt;https://doi.org/10.1038/s41598-018-21141-2</mixed-citation></ref><ref id="scirp.86325-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Stern, R. and Jedrzejas, M.J. (2006) Hyaluronidases: Their Genomics, Structures, and Mechanisms of Action. Chemical Reviews, 106, 818-839.  
&lt;br /&gt;https://doi.org/10.1021/cr050247k</mixed-citation></ref><ref id="scirp.86325-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Hart, M.E., Tsang, L.H., Deck, J., Daily, S.T., Jones, R.C., Liu, H., Hu, H., Hart, M.J. and Smeltzer, M.S. (2013) Hyaluronidase Expression and Biofilm Involvement in Staphylococcus aureus UAMS-1 and Its sarA, agr and sarA agr Regulatory Mutants. Microbiology, 159, 782-791. &lt;br /&gt;https://doi.org/10.1099/mic.0.065367-0</mixed-citation></ref><ref id="scirp.86325-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Hynes, W.L. and Walton, S.L. (2000) Hyaluronidases of Gram-Positive Bacteria. FEMS Microbiology Letters, 183, 201-207.  
&lt;br /&gt;https://doi.org/10.1111/j.1574-6968.2000.tb08958.x</mixed-citation></ref><ref id="scirp.86325-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Girish, K.S. and Kemparaju, K. (2007) The Magic Glue Hyaluronan and Its Eraser Hyaluronidase: A Biological Overview. Life Science, 80, 1921-1943.  
&lt;br /&gt;https://doi.org/10.1016/j.lfs.2007.02.037</mixed-citation></ref><ref id="scirp.86325-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Jiang, D., Liang, J. and Noble, P.W. (2011) Hyaluronan as an Immune Regulator in Human Diseases. Physiological Reviews, 91, 221-264.  
&lt;br /&gt;https://doi.org/10.1152/physrev.00052.2009</mixed-citation></ref><ref id="scirp.86325-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Sonoda, M., Harwood, F.L., Amiel, M.E., Moriya, H., Temple, M., Chang, D.G., Lottman, L.M., Sah, R.L. and Amiel, D. (2000) The Effects of Hyaluronan on Tissue Healing after Meniscus Injury and Repair in a Rabbit Model. The American Journal of Sports Medicine, 28, 90-97. &lt;br /&gt;https://doi.org/10.1177/03635465000280012801</mixed-citation></ref><ref id="scirp.86325-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Lowy, F.D. (1998) Staphylococcus aureus Infections. The New England Journal of Medicine, 339, 520-532. &lt;br /&gt;https://doi.org/10.1056/NEJM199808203390806</mixed-citation></ref><ref id="scirp.86325-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Makris, G., Wright, J.D., Ingham, E. and Holland, K.T. (2004) The Hyaluronate Lyase of Staphylococcus aureus—A Virulence Factor? Microbiology, 150, 2005-2013.  
&lt;br /&gt;https://doi.org/10.1099/mic.0.26942-0</mixed-citation></ref><ref id="scirp.86325-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Smith, R.F. and Willett, N.P. (1968) Rapid Plate Method for Screening Hyaluronidase and Chondroitin Sulfatase-Producing Microorganisms. Journal of Applied Microbiology, 16, 1434-1436.</mixed-citation></ref><ref id="scirp.86325-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Joslyn, D.A. and Galbraith, M. (1947) A Turbidimetric Method for the Assay of Antibiotics. Journal of Bacteriology, 54, 26.</mixed-citation></ref><ref id="scirp.86325-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Vercruysse, K.P., Lauwers, A.R. and Demeester, J.M. (1995) Absolute and Empirical Determination of the Enzymatic Activity and Kinetic Investigation of the Action of Hyaluronidase on Hyaluronan Using Viscosimetry. Biochemical Journal, 306, 153-160. &lt;br /&gt;https://doi.org/10.1042/bj3060153</mixed-citation></ref><ref id="scirp.86325-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Muckenschnabel, I., Bernhardt, G., Spruss, T., Dietl, B. and Buschauer, A. (1998) Quantitation of Hyaluronidases by the Morgan-Elson Reaction: Comparison of the Enzyme Activities in the Plasma of Tumor Patients and Healthy Volunteers. Cancer Letters, 131, 13-20. &lt;br /&gt;https://doi.org/10.1016/S0304-3835(98)00196-7</mixed-citation></ref><ref id="scirp.86325-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Steiner, B. and Cruce, D. (1992) A Zymographic Assay for Detection of Hyaluronidase Activity on Polyacrylamide Gels and Its Application to Enzymatic Activity Found in Bacteria. Analytical Biochemistry, 200, 405-410.  
&lt;br /&gt;https://doi.org/10.1016/0003-2697(92)90487-R</mixed-citation></ref><ref id="scirp.86325-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Duthie, E.S. and Lorenz, L.L. (1952) Staphylococcal Coagulase; Mode of Action and Antigenicity. Journal of General Microbiology, 6, 95-107.</mixed-citation></ref><ref id="scirp.86325-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Duquenne, M., Fleurot, I., Aigle, M., Darrigo, C., Borezée-Durant, E., Derzelle, S., Bouix, M., Deperrois-Lafarge, V. and Delacroix-Buchet, A. (2010) Tool for Quantification of Staphylococcal Enterotoxin Gene Expression in Cheese. Applied and Environmental Microbiology, 76, 1367-1374. &lt;br /&gt;https://doi.org/10.1128/AEM.01736-09</mixed-citation></ref><ref id="scirp.86325-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Pfaffl, M.W. (2001) A New Mathematical Model for Relative Quantification in Real-Time RT-PCR. Nucleic Acids Research, 29, e45.  
&lt;br /&gt;https://doi.org/10.1093/nar/29.9.e45</mixed-citation></ref><ref id="scirp.86325-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Choudhuri, K.K. and Chakrabarty, A.N. (1969) Hyaluronate Lyase Activity of Staphylococci. Indian Journal of Experimental Biology, 7, 183-185.</mixed-citation></ref><ref id="scirp.86325-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Essers, L. and Radebold, K. (1980) Rapid and Reliable Identification of Staphylococcus aureus by a Latex Agglutination Test. Journal of Clinical Microbiology, 12, 641-643.</mixed-citation></ref><ref id="scirp.86325-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Hart, M.E., Hart, M.J. and Roop, A.J. (2009) Genotypic and Phenotypic Assessment of Hyaluronidase among Type Strains of a Select Group of Staphylococcal Species. International Journal of Microbiology, 2009, Article ID: 614371.  
&lt;br /&gt;https://doi.org/10.1155/2009/614371</mixed-citation></ref><ref id="scirp.86325-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Boswihi, S.S., Udo, E.E. and Al-Sweih, N. (2016) Shifts in the Clonal Distribution of Methicillin-Resistant Staphylococcus aureus in Kuwait Hospitals: 1992-2010. PLoS ONE, 11, e0162744.</mixed-citation></ref><ref id="scirp.86325-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Khaledi, A., Schniederjans, M., Pohl, S., Rainer, R., Bodenhofer, U., Xia, B., Klawonn, F., Bruchmann, S., Preusse, M., Eckweiler, D., Dotsch, A. and Haussler, S. (2016) Transcriptome Profiling of Antimicrobial Resistance in Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy, 60, 4722-4733.  
&lt;br /&gt;https://doi.org/10.1128/AAC.00075-16</mixed-citation></ref><ref id="scirp.86325-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Janjua, H.A., Segata, N., Bernabo, P., Tamburini, S., Ellen, A. and Jousson, O. (2012) Clinical Populations of Pseudomonas aeruginosa Isolated from Acute Infections Show a Wide Virulence Range Partially Correlated with Population Structure and Virulence Gene Expression. Microbiology, 158, 2089-2098.  
&lt;br /&gt;https://doi.org/10.1099/mic.0.056689-0</mixed-citation></ref><ref id="scirp.86325-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Zelezniak, A., Sheridan, S. and Patil, K.R. (2014) Contribution of Network Connectivity in Determining the Relationship between Gene Expression and Metabolite Concentration Changes. PLOS Computational Biology, 10, e1003572.  
&lt;br /&gt;https://doi.org/10.1371/journal.pcbi.1003572</mixed-citation></ref><ref id="scirp.86325-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Caldwell, R., Sapolsky, R., Weyler, W., Maile, R.R., Causey, S.C. and Ferrari, E. (2001) Correlation between Bacillus subtilis scoC Phenotype and Gene Expression Determined Using Microarrays for Transcriptome Analysis. Journal of Bacteriology, 183, 7329-7340. &lt;br /&gt;https://doi.org/10.1128/JB.183.24.7329-7340.2001</mixed-citation></ref></ref-list></back></article>