<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AS</journal-id><journal-title-group><journal-title>Agricultural Sciences</journal-title></journal-title-group><issn pub-type="epub">2156-8553</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/as.2018.95042</article-id><article-id pub-id-type="publisher-id">AS-85022</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Earth&amp;Environmental Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  MtsR, an Iron-Dependent Regulator in &lt;i&gt;Streptococcus iniae&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jun</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Peng</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yanyan</surname><given-names>Qin</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lili</surname><given-names>Zou</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff3"><addr-line>The Institute of Infection and Inflammation, Medical College, China Three Gorges University, Yichang, China</addr-line></aff><aff id="aff2"><addr-line>Hubei Key Laboratory of Tumor Microenvironment and Immunotherapy, Medical College, China Three Gorges University, Yichang, China</addr-line></aff><aff id="aff1"><addr-line>Translational Neuroscience and Neural Regeneration and Repair Institute, The People’s Hospital of China Three Gorges University, Yichang, China</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>zoulili@mail3.sysu.edu.cn(LZ)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>09</day><month>05</month><year>2018</year></pub-date><volume>09</volume><issue>05</issue><fpage>609</fpage><lpage>618</lpage><history><date date-type="received"><day>12,</day>	<month>April</month>	<year>2018</year></date><date date-type="rev-recd"><day>28,</day>	<month>May</month>	<year>2018</year>	</date><date date-type="accepted"><day>31,</day>	<month>May</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  <em>Streptococcus iniae</em> (
  <em>S. iniae</em>) is a major pathogen that is capable of resulting severe economic loss to cultured fish. Steadily iron availability from micro-environment is an important virulence factor for pathogens, and 
  <em>S. iniae</em> encodes the iron-transporter MtsABC to accomplish heme utilization, but very little was known about the mechanisms involved in regulating and maintaining iron balance in 
  <em>S. iniae</em>. In this study, the role of a putative iron-dependent transcriptional regulator MtsR was investigated, and the results showed that MtsR regulated the expression of iron-transport mtsABC to control iron homeostasis in 
  <em>S. iniae</em>.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Streptococcus iniae&lt;/i&gt;</kwd><kwd> Iron-Dependent Regulator</kwd><kwd> Iron Transporter</kwd><kwd> MtsR</kwd><kwd> MtsABC</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Iron plays a significant role in many biological processes [<xref ref-type="bibr" rid="scirp.85022-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.85022-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.85022-ref3">3</xref>] , and is an essential nutrient that Streptococcus iniae (S. iniae) needs to survive. Despite its abundance in the natural environment, iron has low solubility in physiological condition which made iron capture is an important act in bacteria. Our previous study indicated that the iron-transporter mtsABC of S. iniae HD-1 was involved in hemeutilization [<xref ref-type="bibr" rid="scirp.85022-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.85022-ref5">5</xref>] , but very little was known about the mechanisms involved in regulating and maintaining iron balance in S. iniae. The iron acquisition processes in bacteria are tightly regulated, and the homeostasis of iron was typically controlled by iron-dependent transcription regulators belonging to the DtxR or the Fur family [<xref ref-type="bibr" rid="scirp.85022-ref6">6</xref>] . These two families regulated the production of iron-transport systems, and in pathogens, they often controlled the expression of virulence factors as well.</p><p>S. iniae is one of the most important fish pathogens that causes serious infections in kinds of fish [<xref ref-type="bibr" rid="scirp.85022-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.85022-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.85022-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.85022-ref10">10</xref>] , and has been reported to cause opportunistic infection in humans [<xref ref-type="bibr" rid="scirp.85022-ref11">11</xref>] . In present study, BLAST-mediated sequences similarity search of S. iniae genome sequences resulted in the identification of gene mtsR that shared amino acid sequence homologies with iron-dependent transcription regulators of other Streptococcal pathogens. Therefore, the role of iron-dependent transcriptional regulator MtsR in S. iniae has been characterized, and the results demonstrated that MtsR regulated the expression of iron-transporter mtsABC in response to iron availability intracellular. This might provide information about the role of MtsR in iron homeostasis in S. iniae HD-1.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Iron Is Essential for S. iniae</title><p>To detect the iron requirement of S. iniae, HD-1 cells were cultured. HD-1 was isolated from Plectorhynchus cinctus in China, and had been described previously and characterized thoroughly by Zhou et al. [<xref ref-type="bibr" rid="scirp.85022-ref12">12</xref>] . HD-1 cells were grown in complete medium, brain heart infusion (BHI) at 28˚C, iron-restricted medium was prepared by adding 0.1285 g nitrilotriacetic acid trisodium salt (NTA), 3.6 g brain heart infusion in 100 ml dd H<sub>2</sub>O, and supplementing it with 0.0043 g MnCl<sub>2</sub>, 0.0038 g ZnCl<sub>2</sub>, 0.0031 g CaCl<sub>2</sub>, and 0.0033 g MgCl<sub>2</sub> [<xref ref-type="bibr" rid="scirp.85022-ref13">13</xref>] .</p></sec><sec id="s2_2"><title>2.2. Cloning and Sequence Analysis of mtsR</title><p>Genomic DNA was extracted from the S. iniae HD-1 using the Wizard genomic DNA purification kit, and the products were quantified by measuring the absorbance at 260 nm. PCR was carried out with 1 μg of genomic DNA using the primers 5'-TTTTGTGACATATAGTTGGCGGGCA-3' and 5'-ATGACGCCTAACAAAGAAGATT-3' as described by Zou [<xref ref-type="bibr" rid="scirp.85022-ref4">4</xref>] , and the PCR products were sequenced at Invitrogen corporation to confirm their specificity. Briefly, the cycling conditions used for mtsR ORF were as follows: 1 cycle of 94˚C for 2 min, 35 cycles of 94˚C for 45 sec, 35 cycles of 61˚C for 45 sec, 35 cycles of 72˚C for 1 min, 1 cycle of 72˚C for 7 min. Nucleotide and deduced amino acid homology analysis of MtsR were carried out by NCBI BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The Conserved Domains of mtsR were detected by NCBI CD Search (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi).</p></sec><sec id="s2_3"><title>2.3. qPCR Analysis</title><p>Duplicate cultures of S. iniae HD-1 were harvested at early logarithmic phase (OD<sub>600 nm</sub> = 0.35), mid-logarithmic phase (OD<sub>600 nm</sub> = 0.65), and final-logarithmic phase (OD<sub>600 nm</sub> = 0.80) in BHI orin iron-restricted medium. The total RNA was extracted and was reverse transcribed to cDNA. Real-time fluorescence PCR (qPCR) analysis was performed with a LightCycler480 system. The primers of mtsABC, mtsR and gyrA used in qPCRas listed in <xref ref-type="table" rid="table1">Table 1</xref> [<xref ref-type="bibr" rid="scirp.85022-ref4">4</xref>] , and the cycling protocol were an initial denaturation at 94˚C for 2 min followed by 40 cycles of 94˚C for 15 s, 56˚C for 50 s, and 79˚C for 10 s. Finally, a melting curve was performed to ensure that there was no contamination. qPCR of the genes of interest, mtsA, mtsB, mtsC, and mtsR and a normalizer gene, gyrA, were performed in triplicate for each sample, and included a no-template control to rule out contamination and primer-dimer formation. Gene gyrA was chosen as a normalizing gene because its expression in other streptococci is stable under different test conditions [<xref ref-type="bibr" rid="scirp.85022-ref14">14</xref>] . The expression fold change of gene was calculated base on the comparison with the normalized gyrA. All statistical analyses were performed using the SPSS 16.0 software (SPSS Inc., USA).</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Iron Supports S. iniae HD-1 Growth</title><p>To detect the importance of iron for S. iniae, the growth curves of HD-1 in BHI and iron-restricted medium were characterized. The results showed that the growth of S. iniae HD-1 was inhibited by adding NTA to BHI medium supplemented with additional cations, and this inhibition was the result of iron limitation. In iron-restricted medium, the HD-1 cells needed 9.5 h to reach the stationary phase, which was 3 h more than that of in BHI medium, and the growth level was dropped 10% (<xref ref-type="fig" rid="fig1">Figure 1</xref>). The gram stain was used to observe the morphological features of S. iniae HD-1 cells at the logarithmic phase, and the results showed that the cells in iron-restricted medium had long chain length (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)) than that of in BHI medium (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)), which indicated that</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primer pairs used in qPCR analysis of mtsABC and mtsR</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene*</th><th align="center" valign="middle" >Sequence (5'-3')</th><th align="center" valign="middle" >Amplicon size (bp)</th><th align="center" valign="middle" >Annealing temperature (˚C)</th></tr></thead><tr><td align="center" valign="middle" >mtsA F mtsA R mtsB F mtsB R mtsC F mtsC R mtsR F mtsR R gyrA F gyrA R</td><td align="center" valign="middle" >AGCCGTTGCCAGAAGATGTTG<sup> </sup> AGTTTCGTAAACCAGGCTTGCC<sup> </sup> GTGGTACGGTAACTATTGGTGAAC<sup> </sup> CATACTTCGTTGCTCCACATAGG<sup> </sup> ATATTCTGGCGGTTCAAGATAGTG<sup> </sup> TTAGCAAGCACTGGGTCAAATG<sup> </sup> TTGGTCTTTTCTTGGAATGCTAC AACACCGCTTGATTGAACTCTTT AGTTCACCGTCGTATTCTTTATGGTATGA CCATACGAACCATGGCTTCATAAATA</td><td align="center" valign="middle" >99 bp 99 bp 76 bp 76 bp 123 bp 123 bp 179 bp 179 bp 150 bp 150 bp</td><td align="center" valign="middle" >56˚C 56˚C 56˚C 56˚C 56˚C 56˚C 56˚C 56˚C 56˚C 56˚C</td></tr></tbody></table></table-wrap><p>*Gene correspond to mtsABC gene designations in S. iniae HD-1. F, forward, R, reverse.</p><p>the reproduction of S. iniae HD-1 cells had been affected without the support of iron. These results indicated that iron was the essential nutrient that S. iniae needed to survive.</p></sec><sec id="s3_2"><title>3.2. Cloning and Sequence Analysis of mtsR</title><p>Iron acted as a regulatory factor having influence on proteins production, but the mechanisms processes in S. iniae for iron homeostasis have not been characterized. Screening of S. iniae genome sequences resulted in the identification of gene mtsR (GeneBank No: JN177478) that shared amino acid sequence homologies with DtxR family which were the metal-dependent transcription regulators. The closest homologs for MtsR are the iron-dependent repressors from Streptococcus pyogenes MGAS9429 (<xref ref-type="table" rid="table2">Table 2</xref>, http://blast.ncbi.nlm.nih.gov/Blast.cgi). mtsR has 624 bp which located at 5' proximal of the iron-transporter mtsABC, and was transcribed in the opposite direction (<xref ref-type="fig" rid="fig3">Figure 3</xref>(a)). The localization of mtsR, and its similarity to other iron-dependent transcriptional regulators suggested that MtsR may function as the mtsABC repressor, which can regulate</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> The proteins to which MtsR have close identity and similarity</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Function</th><th align="center" valign="middle" >Organism</th><th align="center" valign="middle" >% Identity/ similarity</th><th align="center" valign="middle" >Length of aa compared</th></tr></thead><tr><td align="center" valign="middle" >copyIron-dependent repressor Putative metal-dependent transcriptional regulator Putative metal-dependent transcriptional regulator Iron-dependent repressor Iron-dependent repressor Iron-dependent repressor Putative metal-dependent transcriptional regulator Putative metal-dependent transcriptional regulator Putative metal-dependent transcriptional regulator Iron-dependent repressor Iron-dependent repressor Putative metal-dependent transcriptional regulator Putative metal-dependent transcriptional regulator Transcriptional regulator of metal ABC transporter Putative metal-dependent transcriptional regulator Putative metal-dependent transcriptional regulator Iron-dependent repressor Iron-dependent repressor Hypothetical protein Iron-dependent transcriptional repressor Putative iron-dependent transcriptional regulator Putative metal-dependent transcriptional regulator</td><td align="center" valign="middle" >Streptococcus pyogenes MGAS9429 Streptococcus pyogenes SSI-1 Streptococcus pyogenes MGAS315 Streptococcus pyogenes MGAS6180 Streptococcus dysgalactiae subsp. equisimilis GGS_124 Streptococcus pyogenes MGAS5005 Streptococcus pyogenes NZ131 Streptococcus pyogenes MGAS8232 Streptococcus pyogenes str. Manfredo Streptococcus pyogenes MGAS10394 Streptococcus pyogenes MGAS10270 Streptococcus pyogenes M1 Streptococcus equi subsp. Zooepidemicus Streptococcus equi subsp. zooepidemicus MGCS10565 Streptococcus equi subsp. equi 4047 Streptococcus uberis 0140J Streptococcus pyogenes MGAS2096 Streptococcus agalactiae A909 Streptococcus agalactiae NEM316 Streptococcus agalactiae 2603V/R Streptococcus gallolyticus UCN34 Streptococcus suis P1/7</td><td align="center" valign="middle" >155/181 155/181 155/181 155/181 155/180 155/181 155/180 154/180 154/180 154/180 154/180 154/180 151/180 151/180 150/180 144/180 87/105 129/169 129/169 129/169 129/164 123/164</td><td align="center" valign="middle" >213 213 213 213 213 213 213 213 213 213 213 213 213 213 213 213 131 213 213 213 214 214</td></tr></tbody></table></table-wrap><p>the transcription of mtsABC in response to iron availability intracellular.</p><p>The TBLASTN analysis showed that the predicted amino acid sequence of MtsR was highly conserved (<xref ref-type="table" rid="table2">Table 2</xref>), and the NCBI CD Search predicted that MtsR has three conserved domains: WHTH_GntR, Fe_dep_repr_C, and FeoA (<xref ref-type="fig" rid="fig3">Figure 3</xref>(c)). WHTH_GntR, and Fe_dep_repr_Cdomains are highly conserved in MtsR, which found in other DtxR homologues thatare responsive to iron, manganese, or both (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). FeoA domain was found at the C-terminus of a variety of metal-dependent transcriptional regulators, which in most cases likely to be either iron or manganese [<xref ref-type="bibr" rid="scirp.85022-ref15">15</xref>] . Based on these observations, we concluded that mtsR is a member of the metal-dependent transcriptional regulators.</p></sec><sec id="s3_3"><title>3.3. Determination of MtsR as the Iron-Dependent Transcriptional Regulator</title><p>Total RNA was isolated from HD-1 cells in BHI and in iron-restricted medium, and qPCR analysis was performed to determine whether MtsR regulated the expression of iron-transporter mtsABC at the transcriptional level. The housekeeping gene gyrA was used as an internal control in qPCR, and similar levels of</p><p>amplification confirmed that the RNA quantities used as the templates in all qPCR reactions were equal. When use the RNA isolated from the HD-1 grown in BHI medium as templates, the expression of mtsA, mtsB, and mtsC were significantly up-regulated and reached the peak at the early logarithmic, de-regulated at the mid-logarithmic, and back to housekeeping gene level at the final-logarithmic phase (p &lt; 0.05, <xref ref-type="fig" rid="fig4">Figure 4</xref>). This representation owed to the high-efficiency of procaryotic cells. The cells needed iron for growth, they stored iron through up-regulate iron-transporter, and once they captured enough iron, the expression of iron-transporter was up-regulated [<xref ref-type="bibr" rid="scirp.85022-ref16">16</xref>] . The expression tendency of the mtsABC in iron-restricted medium was consistent with that of in BHI medium, but the expression levels of mtsA, mtsB, and mtsC were showed 1.83, 13.3, and 2.11 times higher than that of in BHI medium, respectively (<xref ref-type="fig" rid="fig5">Figure 5</xref>). In contrast, both in <xref ref-type="fig" rid="fig4">Figure 4</xref> and <xref ref-type="fig" rid="fig5">Figure 5</xref> the results showed that the high transcription of the mtsABC is observed when the mtsR remain inactivate, suggesting that MtsR up-regulate mtsABC expression was very likely to lead to an increase in iron uptake by S. iniae. Meanwhile, activation of MtsR resulted in de-regulation of the mtsABC transcription, which demonstrated that mtsR</p><p>up-regulated the expression of mtsABC in response to iron availability intracellular to control the iron homeostasis in S. iniae HD-1.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Iron is an important nutrient for various pathogens, which can often use low environmental iron levels as a signal for the induction of virulence genes [<xref ref-type="bibr" rid="scirp.85022-ref2">2</xref>] . Bacteria face the problem that in acquiring sufficient iron from their surroundings is particularly acute for pathogens. For bacterial pathogen, scavenging iron from the environment is less effortless than synthesizing it de novo. Our study showed that S. iniae HD-1 in the iron-restricted medium caused by addition of NTA in the final concentration 5 mM postpones the log phase of bacterial growth 3 h. When the morphological features were examined by the Gram stain, HD-1 cells showed a long chain appearance in iron-restricted medium than that of in BHI medium. These results indicated that iron was required for the growth of S. iniae HD-1.</p><p>Iron withholding by the human host is a challenge for pathogen, as the bacterium requires iron for optimal growth. At the same time, maintaining iron homeostasis is important for the bacterial physiology as well. Therefore, like other bacterial pathogens, S. iniae needs to modify iron uptake in response to changes of iron availability in the environment. To address the conundrum of iron homeostasis in S. iniae, the gene of putative iron-dependent transcriptional regulators, mtsR, was cloned fromHD-1. MtsR may have both negative and positive roles in mtsABC expression, depending on the iron availability in the cells. Using qPCR analysis, we have demonstrated that high transcription of the mtsABC genes is observed when the mtsR maintained inactivate, suggesting that MtsR repressed mtsABC expression in cells growing in BHI medium. MtsR de-regulated the expression of mtsABC in cells grown in restricted-medium, and this de-regulation as a result of MtsR activation is very likely to lead to an increase in iron uptake by S. iniae. This has demonstrated that MtsR is a DtxR homologue with an important role in iron homeostasis.</p></sec><sec id="s5"><title>Acknowledgements</title><p>Project support was provided by grants from The Hubei Office of Education Foundation (grant nos.B2016022 to J.W.).</p></sec><sec id="s6"><title>Cite this paper</title><p>Wang, J., Wang, P., Qin, Y.Y. and Zou, L.L. (2018) MtsR, an Iron-Dependent Regulator in Streptococcus iniae. Agricultural Sciences, 9, 609-618. https://doi.org/10.4236/as.2018.95042</p></sec></body><back><ref-list><title>References</title><ref id="scirp.85022-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Wooldridge, K.G. and Williams, P.H. (1993) Iron Uptake Mechanisms of Pathogenic Bacteria. FEMS Microbiology Reviews, 12, 325-348. https://doi.org/10.1111/j.1574-6976.1993.tb00026.x</mixed-citation></ref><ref id="scirp.85022-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Christine, M.L. and Stephen, B.C. (1993) Role of Iron in Regulation of Virulence Genes. Clinical Microbiology Reviews, 6, 137-149. https://doi.org/10.1128/CMR.6.2.137</mixed-citation></ref><ref id="scirp.85022-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Cyril, A., Tjepkema, J.D. and Trinick, M.J. (1997) Heme Compounds as Iron Sources for Nonpathogenic Rhizobium bacteria. Journal of Bacteriology, 179, 3076-3078. https://doi.org/10.1128/jb.179.9.3076-3078.1997</mixed-citation></ref><ref id="scirp.85022-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Zou, L.L., Wang, J., Huang, B.F., Xie, M.Q. and Li, A.X. (2010) A Solute-Binding Protein for Iron Transport in Streptococcus iniae. BMC Microbiology, 10, 1-10. https://doi.org/10.1186/1471-2180-10-309</mixed-citation></ref><ref id="scirp.85022-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Zou, L.L., Wang, J., Huang, B.F., Xie, M.Q. and Li, A.X. (2011) MtsB, A Hydrophobic Membrane Protein of Streptococcus iniae, Is an Effective Subunit Vaccine Candidate. Vaccine, 29, 391-394. https://doi.org/10.1016/j.vaccine.2010.10.062</mixed-citation></ref><ref id="scirp.85022-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Andrews, S.C., Robinson, A.K. and Rodriguez-Quinones, F. (2003) Bacterial Iron Homeostasis. FEMS Microbiology Reviews, 27, 215-237. https://doi.org/10.1016/S0168-6445(03)00055-X</mixed-citation></ref><ref id="scirp.85022-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Kitao, T., Aoki, T. and Sakoh, R. (1981) Epizootic Caused by Beta-Haemolytic Streptococcus Species in Cultured Freshwater Fish. Fish Pathology, 15, 301-307. https://doi.org/10.3147/jsfp.15.301</mixed-citation></ref><ref id="scirp.85022-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Kusuda, R. (1992) Bacterial Fish Diseases in Marineculture in Japan with Special Emphasis on Streptococcosis. The Israeli Journal of Aquaculture, 44, 140.</mixed-citation></ref><ref id="scirp.85022-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Eldar, A., Bejerano, Y. and Bercovier, H. (1994) Streptococcus shiloi and Streptococcus Difficile: Two New Streptococcal Species Causing a Meningoencephalitis in Fish. Current Microbiology, 28, 193-143. https://doi.org/10.1007/BF01571054</mixed-citation></ref><ref id="scirp.85022-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Eldar, A., Bejerano, Y. and Bercovier, H. (1994) Streptococcus shiloi and Streptococcus Difficile: Two New Streptococcal Species Causing a Meningoencephalitis in Fish. Current Microbiology, 28, 193-143. https://doi.org/10.1007/BF01571054</mixed-citation></ref><ref id="scirp.85022-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Weinstein, M.R., Litt, M., Kertesz, D.A., Wyper, P., Rose, D., Coulter, M., McGeer, A., Facklam, R., Ostach, C., Willey, B.M., Borczyk, A. and Low, D.E. (1997) Invasive Infections Due to a Fish Pathogen, Streptococcus iniae. S. iniae Study Group. New England Journal of Medicine, 337, 589-594. https://doi.org/10.1056/NEJM199708283370902</mixed-citation></ref><ref id="scirp.85022-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Zhou, S.M., Xie, M.Q., Zhu, X.Q., Ma, Y., Tan, Z.L. and Li, A.X. (2008) Identification and Genetic Characterization of Streptococcus iniae Strains Isolated from Diseased Fish in China. Journal of Fish Diseases, 31, 869-875. https://doi.org/10.1111/j.1365-2761.2008.00954.x</mixed-citation></ref><ref id="scirp.85022-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Zehava, E., Eric, M., Stephen, A.M. and June, R.S. (1996) Acquisition of Iron Host Protein Proteins by Group A Streptococcus. Infection and Immunity, 64, 5428-5429.</mixed-citation></ref><ref id="scirp.85022-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Shelly, B., Jeffrey, D.F., Darrin, J.B. and Joyce, C.S.A. (2007). The Two-Component System sivS/R Regulates Virulence in Streptococcus iniae. FEMS Immunology &amp; Medical Microbiology, 51, 547-554. https://doi.org/10.1111/j.1574-695X.2007.00334.x</mixed-citation></ref><ref id="scirp.85022-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Kammler, M., Schon, C. and Hantke, K. (1993) Characterization of the Ferrous Iron Uptake System of Escherichia coli. Journal of Bacteriology, 175, 6212-6219. https://doi.org/10.1128/jb.175.19.6212-6219.1993</mixed-citation></ref><ref id="scirp.85022-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Laurent, M., Lzabela, S., Nicole, M.G. and James, M.M. (2008) Remodeling of the Streptococcus agalactiae Transcription in Response to Growth Temperature. PLoS ONE, 3, 2785-2796. https://doi.org/10.1371/journal.pone.0002785</mixed-citation></ref></ref-list></back></article>