<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJMB</journal-id><journal-title-group><journal-title>American Journal of Molecular Biology</journal-title></journal-title-group><issn pub-type="epub">2161-6620</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajmb.2018.83012</article-id><article-id pub-id-type="publisher-id">AJMB-84661</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Molecular Cloning and Expression Analysis of &lt;i&gt;PgLAC&lt;/i&gt; in Pomegranate
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lili</surname><given-names>Dong</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Feng</surname><given-names>Xiong</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Na</surname><given-names>Liu</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Qi</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Shuiming</surname><given-names>Zhang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>College of Horticulture, Anhui Agricultural University, Hefei, China</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>2423690380@qq.com(SZ)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>22</day><month>05</month><year>2018</year></pub-date><volume>08</volume><issue>03</issue><fpage>145</fpage><lpage>155</lpage><history><date date-type="received"><day>29,</day>	<month>January</month>	<year>2018</year></date><date date-type="rev-recd"><day>19,</day>	<month>May</month>	<year>2018</year>	</date><date date-type="accepted"><day>22,</day>	<month>May</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Decreasing the hardness of pomegranate seeds by reducing the content of lignin is an effective way to develop soft-seeded pomegranate. Laccases (LAC) is a key regulatory factor in lignin synthesis. The full-length sequence of 
  PgLAC
   was obtained from “
  Punica granatum
   cv. Hongyushizi”, by using RACE and RT-PCR methods. 
  PgLAC
   had an open reading frame of 1716 bp and encoded a protein of 571 amino acids. Phylogenetic tree analysis showed that 
  PgLAC
   was most closely related to the
   LAC
  5 ortholog identified in 
  Eucalyptus grandis
   (
  EgLAC
  5). Expression analysis showed that expression of 
  PgLAC 
  was higher in “Hongyushizi”, while lower in “Huiliruanzi” and “Tunisiruanzi”; 
  PgLAC
   was predominantly expressed in stems; From 20 to 80 days after full bloom, the expression of 
  PgLAC
   increased and reached a maximum at 80 d, then gradually decreased. These results suggested that 
  PgLAC
   may
   
  be a candidate gene for reducing the hardness of 
  pomegranate seeds.
 
</p></abstract><kwd-group><kwd>Pomegranate</kwd><kwd> &lt;i&gt;LAC&lt;/i&gt;</kwd><kwd> Gene Cloning</kwd><kwd> Expression Analysis</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Pomegranate is popular due to the high nutritional value and health benefits [<xref ref-type="bibr" rid="scirp.84661-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.84661-ref2">2</xref>] . However, most of the cultivars are hard-seeded pomegranate, and the edible parts accounted for only 45% - 52% of the total fruit quality [<xref ref-type="bibr" rid="scirp.84661-ref3">3</xref>] . Therefore, developing new cultivars of soft-seeded is an important direction for pomegranate breeding [<xref ref-type="bibr" rid="scirp.84661-ref4">4</xref>] . Lignin, which can increase cell wall hardness, is considered to be a key factor that determines the hardness of pomegranate seeds [<xref ref-type="bibr" rid="scirp.84661-ref5">5</xref>] . Consequently, reducing the hardness of the pomegranate seeds by decreasing the lignin content is an effective way to increase the edible rate of the pomegranate.</p><p>Laccase enzyme, belongs to the family of ceruloplasmin oxidase, which can be combined with a plurality of copper ions [<xref ref-type="bibr" rid="scirp.84661-ref6">6</xref>] . Studies showed that laccase was involved in the synthesis of lignin and enabled lignin monomers to polymerize into lignin [<xref ref-type="bibr" rid="scirp.84661-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.84661-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.84661-ref9">9</xref>] . Members of the laccase family have been identified in Arabidopsis, poplar, tomato, sugar cane, maize etc. [<xref ref-type="bibr" rid="scirp.84661-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.84661-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.84661-ref12">12</xref>] . However, LACs have no orthologs in lower plant species, indicating that the LACs diverged after the evolution of seed plants [<xref ref-type="bibr" rid="scirp.84661-ref13">13</xref>] . Laccase genes usually have multiple members, such as 17 members in Arabidopsis, 49 members in poplar [<xref ref-type="bibr" rid="scirp.84661-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.84661-ref15">15</xref>] . Single mutation of LAC4, LAC11 or LAC17 in Arabidopsis did not cause significant changes in lignin content, suggesting that these members were usually functionally redundant [<xref ref-type="bibr" rid="scirp.84661-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.84661-ref13">13</xref>] . Transformation of SofLAC from sugarcane into Arabidopsis LAC17 mutant restored lignin content [<xref ref-type="bibr" rid="scirp.84661-ref11">11</xref>] . Overexpression of AtmiRNA397b reduced the expression of AtLAC4, which led to the reduction of lignin content [<xref ref-type="bibr" rid="scirp.84661-ref16">16</xref>] . Studies in Populus trichocarpa showed that the 29 members of LACs might be the target genes of Ptr-miR397a. Overexpression of Ptr-miR397a caused a decrease of expression of 17 LAC members, and eventually caused the reduction of lignin content in P. trichocarpa [<xref ref-type="bibr" rid="scirp.84661-ref17">17</xref>] . According to the existing researches on LAC, we found that the functions of the LAC in plants were less studied, and LAC in pomegranate had not been reported.</p><p>In this study, LAC homologous gene PgLAC was cloned from pomegranate, and the expression level in different pomegranate cultivars, tissues and developmental stages was detected by real-time quantitative PCR. This study lays a foundation for further research on the function analysis of PgLAC, and also provides gene resources for breeding new cultivars of soft-seeded pomegranate.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Plant Materials</title><p>Pomegranate cultivars used in this study were all collected from Germplasm Resources Garden of Pomegranate in Anhui Agricultural University. The fruits of “Huiliruanzi”, “Hongyushizi” and “Tunisiruanzi” in similar cultivation environment were collected. The arils and kernels were removed from the seeds, then the seed coats were soaked in liquid nitrogen, and eventually were taken back to the laboratory and store in a −80˚C refrigerator. For the expression analysis experiments, flowers, stems, leaves and the seeds of 20 d, 40 d, 60 d, 80 d, 100 d and 120 d of “Hongyushizi” were collected, respectively. After the same treatments to seeds as mentioned above, the tissues and seed coats were taken back to the laboratory and stored in a −80˚C refrigerator.</p></sec><sec id="s2_2"><title>2.2. Isolation of PgLAC</title><p>The total RNA was extracted from the seed coats of “Hongyushizi” using Trizol reagent (Invitrogen), and digested with DNase I (TaKaRa). Then cDNA was synthesized using reverse transcriptase M-MLV (Promega). According to the LAC sequences of other species that have been published, we designed degenerate primers LAC-PF/LAC-PR to clone the intermediate fragment. Based on the obtained sequence, 5’ end specific primers LAC-5’GSP1, LAC-5’GSP2 and 3’ end specific primers LAC-3’GSP1, LAC-3’GSP2 were designed. LAC-5’GSP1/UPM Long were used for the first round amplification, and the PCR products were used as template, then LAC-5’GSP2/NUP were used for the second round of amplification to obtain the 5’ end sequence of PgLAC. Similarly, 3’ end sequence of PgLAC was obtained. The three parts were spliced, and primers LAC-QC-F/LAC-QC-R were used to amplify the full-length sequence (<xref ref-type="table" rid="table1">Table 1</xref>). Finally, PgLAC was amplified using PrimeSTAR HS DNA polymerase (Takara) to correct the sequence.</p></sec><sec id="s2_3"><title>2.3. Sequence Analysis and Phylogenetic Tree Construction</title><p>PgLAC was compared with the homologous sequences of other species in the NCBI database using DNAMAN 5.0 software; the phylogenetic tree was constructed using MEGA 5.05 and maximum likelihood method with 1000 bootstrap replications [<xref ref-type="bibr" rid="scirp.84661-ref18">18</xref>] .</p></sec><sec id="s2_4"><title>2.4. Quantitative Real-Time PCR</title><p>Two grams of RNA from different samples digested by DNase I (TaKaRa) was reverse transcribed into cDNA. Quantitative real-time PCR (qRT-PCR) was performed using an ABI 7500 Fast Real-time PCR system and SYBR<sup>&#174;</sup>Premix Ex Taq™ II (TaKaRa). Amplification was carried out by an initial denaturation at 95˚C for 30 s, followed by 40 cycles of amplification (denaturation at 95˚C for 15 s, annealing at 60˚C for 30 s and extension at 72˚C for 1 min). PgACTIN was used as the reference gene. The results were analyzed using ABI 7500 software, and relative expression was calculated using the 2<sup>−ΔΔCT</sup> method [<xref ref-type="bibr" rid="scirp.84661-ref19">19</xref>] .</p></sec></sec><sec id="s3"><title>3. Results and Analysis</title><sec id="s3_1"><title>3.1. Cloning and Sequence Analysis of PgLAC</title><p>Based on the conserved regions of LAC in Arabidopsis, grape, tobacco, apple,</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> The primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primers</th><th align="center" valign="middle" >Sequence 5’-3’</th><th align="center" valign="middle" >Usage</th></tr></thead><tr><td align="center" valign="middle" >LAC-PF</td><td align="center" valign="middle" >GAAGGHACACTTTGGTGGCA</td><td align="center" valign="middle"  rowspan="2"  >Amplification formiddle fragments of PgLAC</td></tr><tr><td align="center" valign="middle" >LAC-PR</td><td align="center" valign="middle" >ACATCBGTGGTTTGTCCTGG</td></tr><tr><td align="center" valign="middle" >LAC-5’GSP1</td><td align="center" valign="middle" >TCGTCTCACCAGAATCAATCGG</td><td align="center" valign="middle"  rowspan="2"  >Amplification for5’ race of PgLAC</td></tr><tr><td align="center" valign="middle" >LAC -5’GSP2</td><td align="center" valign="middle" >CGGTGTCTTGCTTGGTCTCCAT</td></tr><tr><td align="center" valign="middle" >LAC-3’GSP1 LAC-3’GSP2</td><td align="center" valign="middle" >CTAAGCCAAAGCGTGAAACTCC GTGCTCCCAATGTCTCCGATGC</td><td align="center" valign="middle" >Amplification for3’ race of PgLAC</td></tr><tr><td align="center" valign="middle" >LAC-QC-F</td><td align="center" valign="middle" >CACTCTCTGCCACCTTTTGATCAG</td><td align="center" valign="middle"  rowspan="2"  >Amplification for full-length of PgLAC</td></tr><tr><td align="center" valign="middle" >LAC-QC-R</td><td align="center" valign="middle" >CTACTTTATCTTATAGAATCAAAT</td></tr><tr><td align="center" valign="middle" >LAC-RTPF</td><td align="center" valign="middle" >CCTGGTAGAAGACGGAGTCGGGGAG</td><td align="center" valign="middle"  rowspan="2"  >qRT-PCR primers</td></tr><tr><td align="center" valign="middle" >LAC-RTPR</td><td align="center" valign="middle" >GGGCGGTGTGACGGTGCTATTATT</td></tr><tr><td align="center" valign="middle" >PgACT-PF</td><td align="center" valign="middle" >AGTCCTCTTCCAGCCATCTC</td><td align="center" valign="middle"  rowspan="2"  >Amplification for PgACTIN</td></tr><tr><td align="center" valign="middle" >PgACT-PR</td><td align="center" valign="middle" >CACTGAGCACAATGTTTCCA</td></tr></tbody></table></table-wrap><p>plum and other species, degenerate primers were designed to amplify the intermediate fragment with a length of 449 bp (<xref ref-type="fig" rid="fig1">Figure 1</xref>). The 5’ end sequence (670 bp) and 3’ end sequence (1417 bp) were obtained by nested PCR (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b), <xref ref-type="fig" rid="fig1">Figure 1</xref>(c)). Three parts were spliced to obtain the full-length of PgLAC (2128 bp), which contained 5’-noncoding sequence of 64 bp, 3’-noncoding sequence of 351 bp and an open reading frame of 1716 bp. The gene encoded a protein containing 571 amino acids. The molecular weight was predicted to be 62.8 kD and theoretical isoelectric point was 8.59. The more amino acids in the protein were alanine Ala (8.1%, 46), Thr (8.1%, 46) and Pro (7.7%, 44). Subcellular location prediction showed that the possibility of PgLAC localization in the endoplasmic reticulum was 82%, and the possibility of localization in the cell membrane was 18%.</p></sec><sec id="s3_2"><title>3.2. Homology Analysis of PgLAC</title><p>PgLAC displayed high similarities with other LAC protein sequences. For example, the similarity between PgLAC and EgLAC5, VvLAC12, RcLAC12 reached to 86.51%, 83.54% and 81.11%, respectively. Sequence analysis indicated that the conserved PgLAC binding domains contained three copper ions of laccase gene family: T1 (84 - 131) with four H (histidine) residues, T2 (232 - 270) containing N (aspartic acid), L (leucine), V (valine), K (Lai Ansuan), P (proline), Q (glutamine) and T (threonine) residues, T3 (472 - 545) with two H (histidine) residues, C (cysteine), and L (leucine) residues (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p></sec><sec id="s3_3"><title>3.3. Phylogenetic Analysis of PgLAC Homeodomain Proteins</title><p>In order to determine the phylogenetic relationship between PgLAC and other LACs, MEGA 5.05 software was used for multiple sequence alignments and phylogenetic analysis. The results showed that PgLAC was identical with the origin of LACs in other species, and was indeed a homologue of the LAC family. The phyologenetic tree revealed that PgLAC was placed in one clade with EgLAC5,</p><p>whlie it had a distant relationship with VaLAC5 (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p></sec><sec id="s3_4"><title>3.4. Expression Analysis of PgLAC in Different Pomegranate Cultivars</title><p>In order to investigate the expression level of PgLAC in different cultivars of pomegranate, qRT-PCR was used to detect the relative expression of PgLAC in</p><p>The phylogenetic tree was constructed using the maximum likelihood method. The scale bar indicated 0.05 substitutions per site. The accession numbers of selected LACs were listed as follows: Vigna angularis VaLAC5 (XP_017429457.1); Glycine max GmLAC5 (XP_003519418.1); Cajanus cajan CcLAC5 (XP_020208524.1); Gossypium arboreum GaLAC5 (XP_017645108.1); Theobroma cacao TcLAC12 (XP_007008849.2); Ricinus communis RcLAC12 (XP_002520796.1); Jatropha curcas JcLAC12 (XP_012086668.1); Populus euphratica PeLAC12 (XP_011004316.1); Juglans regia JrLAC12 (XP_018838961.1); Ziziphus jujuba ZjLAC12 (XP_015877482.1); Malus domestica MdLAC12 (XP_008343632.1); Prunus persica PpLAC12 (XP_007218932.1); Nelumbo nucifera NnLAC12 (XP_010264533.1); Punica granatum PgLAC (AJD79906.1); Eucalyptus grandis EgLAC5 (XP_010067566.1); EgLAC12 (XP_010031156.1); Vitis vinifera VvLAC12 (XP_002273875.2); Daucus carota subsp. Sativus DcLAC12 (XP_017238938.1); Nicotiana tabacum NtLAC12 (XP_016460452.1); Capsicum annuum CaLAC12 (XP_016575563.1); Solanum tuberosum StLAC12 (XP_006355637.1); Solanum lycopersicum SlLAC5 (XP_004240885.1).</p><p>“Hongyushizi”, “Huiliruanzi” and “Tunisiruanzi”. The results showed that the expression of PgLAC in “Hongyushizi” was 3.5 times higher than that of “Tunisiruanzi”. The expression of PgLAC in “Huiliruanzi” and “Tunisiruanzi” was lower, and there was no significant difference between the two cultivars (<xref ref-type="fig" rid="fig4">Figure 4</xref>).</p></sec><sec id="s3_5"><title>3.5. Expression Analysis of PgLAC in Different Tissues</title><p>The expression level of PgLAC in different tissues of pomegranate was detected, with “Hongyushizi” as the material. The results showed that PgLAC was all detected in leaves, petals and stems. The expression in stems and petals was 19.59 times and 3.74 times higher than that in leaves，respectively (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p></sec><sec id="s3_6"><title>3.6. Expression Analysis of PgLAC in Different Developmental Stages</title><p>In order to reveal the expression characteristics of PgLAC in different developmental stages of seeds, the pomegranate seeds were collected from 20<sup>th</sup> day to</p><p>120<sup>th</sup> day, with the time interval of 20 days. The results showed that PgLAC was expressed in all stages of seeds, showing the overall downward trend after rising first. The relative expression remained a low level from 20 d to 60 d, and reached a maximum value at 80 d, then decreased gradually (<xref ref-type="fig" rid="fig6">Figure 6</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Pomegranate is widely cultivated all over the world, and seed hardness is one of the most important economic traits. Compared to hard-seeded pomegranate, soft-seeded pomegranate has a broader market prospect. Lignin content is an important factor in determining the hardness of pomegranate seeds.</p><p>More and more studies showed that LACs were involved in lignin synthesis. In this study, the homologous gene of LAC was cloned from pomegranate. The putative amino acid sequence of this gene contained the conserved binding domains of three copper ions, hence it was named PgLAC. Phylogenetic tree analysis suggested that all the LACs originated from the same ancestral origin, which subsequently diverged at different phases of evolution. PgLAC were most closely related to EgLAC5.</p><p>The relative expression of PgLAC varied among different cultivars. PgLAC expression was higher in the seeds of “Hongyushizi” with high lignin content, while lower in “Huiliruanzi” and “Tunisiruanzi” with lower lignin content, which indicated that PgLAC expression was correlated with lignin content, and PgLAC may be an important factor affecting seed hardness in different cultivars. The roles of LAC members in plant growth and development varied, and therefore tissue-specific expression were different. For example, studies in Arabidopsis showed that LAC17 was mainly expressed in the interfascicular fibers, whereas LAC4 was expressed in vascular bundles and interfascicular fibers [<xref ref-type="bibr" rid="scirp.84661-ref10">10</xref>] . To analyze the expression characteristics of PgLAC in different tissues of pomegranate, the expression levels of PgLAC in leaves, petals and stems were detected. PgLAC was expressed in all three tissues, with the highest expression in</p><p>stems and lowest expression in leaves. The result indicated that LAC was highly expressed in tissues with high lignin content, which further supported the involvement of PgLAC in the synthesis of lignin in Pomegranate. PgLAC expression in seeds at different stages was also detected. The expression of PgLAC increased rapidly from 20 d to 80 d, suggesting that lignin was rapidly synthesized and accumulated during this period. When the content of lignin reached a certain range, the expression of PgLAC decreased, also the synthesis of lignin reduced. These results implied that PgLAC might play an important role in the synthesis of pomegranate lignin.</p><p>Since PgLAC was expressed in several tissues of pomegranate, reducing the total expression level of PgLAC will affect multiple developmental processes. Our study found that PgLAC expression gradually increased in the early stages of seed development, and eventually resulted in lignin accumulation. Therefore, reducing lignin content by regulating the expression level of PgLAC during seed development, may be an effective way to reduce the hardness of the pomegranate seeds. This study lays a theoretical foundation for developing new cultivars of soft-seeded pomegranate by using genetic engineering methods.</p></sec><sec id="s5"><title>Acknowledgements</title><p>This work was supported by the Natural Science Research Project of Anhui colleges and Universities (Grant number KJ2017A154).</p></sec><sec id="s6"><title>Cite this paper</title><p>Dong, L.L., Xiong, F., Liu, N., Wang, Q. and Zhang, S.M. (2018) Molecular Cloning and Expression Analysis of PgLAC in Pomegranate. American Journal of Molecular Biology, 8, 145-155. https://doi.org/10.4236/ajmb.2018.83012</p></sec><sec id="s7"><title>Abbreviations</title><p>C, cysteine;</p><p>H, histidine;</p><p>K, Lai Ansuan;</p><p>LAC, Laccases;</p><p>L, leucine;</p><p>N, aspartic acid;</p><p>P, proline;</p><p>Q, glutamine;</p><p>qRT-PCR, Quantitative real-time PCR;</p><p>T, threonine;</p><p>V, valine.</p></sec></body><back><ref-list><title>References</title><ref id="scirp.84661-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Chidambara Murthy, K.N., Jayaprakasha, G.K. and Singh, R.P. (2002) Studies on Antioxidant Activity of Pomegranate (Punica granatum) Peel Extract Using in Vivo Models. Journal of Agricultural and Food Chemistry, 50, 4791-4795. https://doi.org/10.1021/jf0255735</mixed-citation></ref><ref id="scirp.84661-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Lansky, E.P. and Newman, R.A. (2007) Punica granatum (Pomegranate) and Its Potential for Prevention and Treatment of Inflammation and Cancer. Journal of Ethnopharmacology, 109, 177-206.  https://doi.org/10.1016/j.jep.2006.09.006</mixed-citation></ref><ref id="scirp.84661-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Sarkhosh, A., Zamani, Z., Fatahi, R. and Ranjbar, H. (2009) Evaluation of Genetic Diversity among Iranian Soft-Seed Pomegranate Accessions by Fruit Characteristics and RAPD Markers. Scientia Horticulturae, 121, 313-319. https://doi.org/10.1016/j.scienta.2009.02.024</mixed-citation></ref><ref id="scirp.84661-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, S., Chen, L., Huang, R., Isha, A. and Dong, L. (2017). Generation and Analysis of Expressed Sequence Tag Sequences from a Soft-Seeded Pomegranate cDNA Library. Plant Breeding, 136, 994-999. https://doi.org/10.1111/pbr.12525</mixed-citation></ref><ref id="scirp.84661-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Zarei, A., Zamani, Z., Fatahi, R., Mousavi, A., Salami, S.A., Avila, C. and Cánovas, F.M. (2016) Differential Expression of Cell Wall Related Genes in the Seeds of Soft- and Hard-Seeded Pomegranate Genotypes. Scientia Horticulturae, 205, 7-16. https://doi.org/10.1016/j.scienta.2016.03.043</mixed-citation></ref><ref id="scirp.84661-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Benfield, G., Bocks, S.M., Bromley, K. and Brown B.R. (1964) Studies of Fungal and Plant Laccases. Phytochemistry, 3, 79-88. https://doi.org/10.1016/S0031-9422(00)83998-9</mixed-citation></ref><ref id="scirp.84661-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Dean, J.F.D., LaFayette, P.R., Rugh, C., Tristram, A.M., Hoopes, J.T., Eriksson, K.E.L. and Markle, S.A. (1998) Laccase Associated with Lignifying Vascular Tissues. ACS Symposium Series, 697, 96-108. https://doi.org/10.1021/bk-1998-0697.ch008</mixed-citation></ref><ref id="scirp.84661-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Gavnholt, B. and Larsen, K. (2002) Molecular Biology of Plant Laccases in Relation to Lignin Formation. Physiologia Plantarum, 116, 273-280. [https://doi.org/10.1034/j.1399-3054.2002.1160301.x</mixed-citation></ref><ref id="scirp.84661-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Mayer, A.M. and Staples, R.C. (2002) Laccase: New Functions for an Old Enzyme. Phytochemistry, 60, 551-565. https://doi.org/10.1016/S0031-9422(02)00171-1</mixed-citation></ref><ref id="scirp.84661-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Berthet, S., Demont-Caulet, N., Pollet, B., Bidzinski, P., Cézard, L., Le Bris, P., Borrega, N., Hervé, J., Blondet, E., Balzergue, S., Lapierre, C. and Jouanin, L. (2011) Disruption of LACCASE4 and 17 Results in Tissue-Specific Alterations to Lignification of Arabidopsis thaliana Stems. The Plant Cell, 23, 1124-1137. https://doi.org/10.1105/tpc.110.082792</mixed-citation></ref><ref id="scirp.84661-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Cesarino, I., Araújo, P., Sampaio Mayer, J.L., Vicentini, R., Berthet, S., Demedts, B., Vanholme, B., Boerjan, W. and Mazzafera, P. (2013) Expression of SofLAC, a New Laccase in Sugarcane, Restores Lignin Content but not S:G Ratio of Arabidopsis LAC17 Mutant. Journal of Experimental Botany, 64, 1769-1781.https://doi.org/10.1093/jxb/ert045</mixed-citation></ref><ref id="scirp.84661-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Liang, M., Haroldsen, V., Cai, X. and Wu, Y. (2006) Expression of a Putative Laccase Gene, ZmLAC1, in Maize Primary Roots under Stress. Plant, Cell &amp; Environment, 29, 746-753. https://doi.org/10.1111/j.1365-3040.2005.01435.x</mixed-citation></ref><ref id="scirp.84661-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Zhao, Q., Nakashima, J., Chen, F., Yin, Y., Fu, C., Yun, J., Shao, H., Wang, X., Wang, Z.Y. and Dixon, R.A. (2013) LACCASE Is Necessary and Nonredundant with PEROXIDASE for Lignin Polymerization during Vascular Development in Arabidopsis. The Plant Cell, 25, 3976-3987. https://doi.org/10.1105/tpc.113.117770</mixed-citation></ref><ref id="scirp.84661-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">McCaig, B.C., Meagher, R.B. and Dean, J.F. (2005) Gene Structure and Molecular Analysis of the Laccase-Like Multicopper Oxidase (LMCO) Gene Family in Arabidopsis thaliana. Planta, 221, 619-636. https://doi.org/10.1007/s00425-004-1472-6</mixed-citation></ref><ref id="scirp.84661-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Hoegger, P.J., Kilaru, S., James, T.Y., Thacker, J.R. and Kües, U. (2006) Phylogenetic Comparison and Classification of Laccase and Related Multicopper Oxidase Protein Sequences. The FEBS Journal, 273, 2308-2326. https://doi.org/10.1111/j.1742-4658.2006.05247.x</mixed-citation></ref><ref id="scirp.84661-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Wang, C.Y., Zhang, S., Yu, Y., Luo, Y.C., Liu, Q., Ju, C., Zhang, Y.C., Qu, L.H., Lucas, W.J., Wang, X. and Chen, Y.Q. (2014) MiR397b Regulates Both Lignin Content and Seed Number in Arabidopsis via Modulating a Laccase Involved in Lignin Biosynthesis. Plant Biotechnology Journal, 12, 1132-1142. https://doi.org/10.1111/pbi.12222</mixed-citation></ref><ref id="scirp.84661-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Lu, S., Li, Q., Wei, H., Chang, M.J., Tunlaya-Anukit, S., Kim, H., Liu, J., Song, J., Sun, Y.H., Yuan, L., Yeh, T.F., Peszlen, I., Ralph, J., Sederoff, R.R. and Chiang, V.L. (2013) Ptr-miR397a Is a Negative Regulator of Laccase Genes Affecting Lignin Content in Populus trichocarpa. Proceedings of the National Academy of Sciences of the United States of America, 110, 10848-10853. https://doi.org/10.1073/pnas.1308936110</mixed-citation></ref><ref id="scirp.84661-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Saitou, N. and Nei, M. (1987) The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Molecular Biology and Evolution, 4, 406-425.</mixed-citation></ref><ref id="scirp.84661-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Livak, K.J. and Schmittgen, T.D. (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2&lt;sup&gt;-ΔΔCT&lt;/sup&gt; Method. Methods, 25, 402-408.</mixed-citation></ref></ref-list></back></article>