Oral lichen planus (OLP) is a disease of unknown etiology affecting oral mucosa by mediated chronic inflammation and is classified as a potentially malignant oral disorder.
SOCS1 and
SOCS3 in the
SOCS family have been identified as negative regulators of the cytokine-activated JAK/STAT pathway responsible for inflammatory reaction. The DNA methylation in the promoter regions of
SOCS1 and
SOCS3 have been reported to correlate with carcinogenesis. In this study, we performed methylation-specific PCR (MSP) to investigate the methylation status of the promoter regions in
SOCS1 and
SOCS3 genes using biopsy samples from OLP and oral squamous cell carcinoma (OSCC) patients.
SOCS1 was methylated in 14/29 (48.3%) cases with OLP and 7/15 (46.7%) cases with OSCC. At the same time,
SOCS3 was methylated in 25/29 (86.2%) cases with OLP and 11/15 (73.3%) cases with OSCC. We didn’t recognize any DNA methylation in
SOCS1 or
SOCS3 genes from the exfoliated cytological specimens of normal buccal mucosa. Furthermore, mRNA expression level was analyzed using real-time RT-PCR method to evaluate the correlation with DNA methylation status. DNA methylation status of
SOCS1 seemed not to affect the expression level of
SOCS1 mRNA. At the same time, DNA methylation status of
SOCS3 was negatively correlated
with the expression level of
SOCS3 mRNA (p < 0.05). We posit frequent methylation of the
SOCS3 gene promoter, theoretically resulting in the increase of cytokines expression, might be associated with the etiological mechanism of OLP.
Oral lichen planus (OLP) is a T-cell-mediated chronic inflammatory disease that occurs in 2.2% of the general population of women aged 30 - 80 years [1] [2] . Lesions are most commonly located in the buccal mucosa, tongue, and gingiva. The disease can appear in six different clinical forms: reticular, plaque, popular, erosive, atrophic, and bullous [3] [4] . An OLP of erosive or ulcerative type is accompanied with strong subjective symptoms and requires treatment although some cases of OLP may be asymptomatic [5] . The etiology of OLP remains uncertain. Previous studies have reported its cause to be a delayed type hypersensitivity reaction by external substances, including metal allergy [6] , and the interaction between environmental factors, such as hepatitis C virus (HCV) infection or autoimmune disease [6] [7] . As the same time, OLP was classified by the World Health Organization (WHO) as a precancerous condition in 2005 [8] and as an oral potentially malignant disorder, like leukoplakia in 2017 [9] . The transformation rate into malignancy of OLP has been reported to range from 0.4% - 12.5%. Therefore, it requires continuous follow-up.
On histopathological examination, OLP lesions present as the hydropic degeneration in the basal cell layer of the epithelium, band-like lymphocyte infiltrate in the lamina propria, and Civatte bodies in the epithelium [10] . Previous studies have reported that lymphocytes in OLP are involved in cellular immunity because of CD4 and CD8 positivity. CD4-positive T cells are classified Th1 cell products of IFN-γ and Th2 cell products of IL-4 or IL-5 [7] . It has been deemed that OLP occurs due to the alteration of Th1/Th2 cytokine balance. However, in recent reports, the increased production of Th1 cytokines has been reported to be a key event. IFN-γ released primarily from activated T-lymphocytes plays a central role in local response in OLP [11] .
The suppressors of cytokine signaling (SOCS) are inhibitors of cytokine signaling that function via the Janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway. To date, the cytokine-inducible SH2-domain-containing protein (CIS) and SOCS1-7 have been identified as members of SOCS family [12] [13] . SOCS1 is shown to inhibit signaling through the direct interaction with JAK and the suppression of IFN-γ or IL-17 cytokine signaling by activating STAT1; thus, SOCS1 is associated with inflammation, such as chronic hepatitis B [14] [15] [16] [17] . SOCS1 also regulates the expression of IL-6 and EGFR involved in tumor growth by activating STAT3 [18] . SOCS1 activation is induced by the phosphorylation of p53 and the proteasomal degradation of NF-κB [19] [20] [21] . SOCS3 can bind the cytokine receptor and JAK and is recruited to the tyrosine-phosphorylated receptor, facilitating JAK inhibition [12] . SOCS3 is a key regulator of IL-6 or IL-10 activated by Toll-like cell receptor stimulation, and it also suppresses cell growth and cell survival by controlling the activation of STAT3 [22] [23] [24] . STAT3 is correlated with the activation of NF-κB [23] [24] . The activation of STAT3 by cytokines thorough JAK/STAT signaling pathway has found earlier to induce inflammation and subsequent carcinogenesis [22] [23] [24] [25] [26] .
Epigenetic mechanisms occur independent of changes in the primary DNA sequence. And they are involved in the development of individuals and tumors as well as chronic inflammation. Epigenetic processes have involved DNA methylation, posttranslational histone modifications, and noncoding RNAs, all of which are related to gene expression and chromatin structure [27] [28] .
Due to DNA promoter methylation and the decreased protein expression of SOCS1 and SOCS3, cytokines are continuously released. Released cytokines are involved in the occurrence of chronic hepatitis B and allergic asthma [17] [29] . Regarding the relationship between carcinogenesis and the methylation of promoter region, SOCS1 methylation has been found to be frequent in hepatocellular and pancreatic carcinomas, whereas SOCS3 methylation has been shown to be frequent in lung cancer, hepatocellular carcinoma, and others [17] - [32] .
There are only two reports of an aberrant methylation of the promoter region in OLP. One has demonstrated the hypermethylation of miR-137 and p16 associated with cell cycles, while the other has demonstrated the hypermethylation of the ELANE gene associated with immune response [33] [34] .
We hypothesized that the methylation of SOCS1 and SOCS3 correlates with chronic inflammation and malignant transformation in OLP. In this study, we investigated the mRNA expression of SOCS1 and SOCS3 as well as their methylation status in OLP, SCC and normal oral mucosa.
2. Material and Method
This research has been approved by the Kyushu Dental University Ethics Committee (15-4-Nomal).
2.1. Patients Characteristics
Surgical specimens were collected from patients at the Department of Oral Surgery of the Kyushu Dental University, Fukuoka, Japan between 2011 and 2017. The study population consisted of 40 patients (15 males, 25 females; mean age 64.86 ± 13.490; range 41 - 83 years; 13 patients <60 years old; 27 patients ≥60 years) undergoing biopsies which were diagnosed with oral lichen planus (OLP). The OLP was located in the buccal mucosa in 24 patients, tongue in eight, gingiva in five, and palate in three. A total of 20 patients (13 males, 7 females; mean age 69.1 ± 13.80 years; range 40 - 82 years; five <60 years old; 15 ≥60 years old) had oral squamous cell carcinoma (OSCC). The OSCC was located in the buccal mucosa in three patients, tongue in 10, gingiva in five, and floor of mouth in two. After tissue collection, the biopsy specimens were fixed in 10% formalin and paraffin-embedded blocks were prepared. For control, 10 patients (five males, five females; mean age 36.4 ± 8.87 years; range, 27 - 55 years) underwent collection of normal oral mucosal exfoliated cells by scratching unilateral buccal mucosa 10 times each using an interdental brush.
OLP and OSCC were diagnosed by two oral pathologists (N.Y. and K.M.).
2.2. DNA Extraction, Bisulfate Treatment, and Methylation-Specific PCR (MSP)
Genome DNA of OLP and OSCC was extracted from tissue sections (4-µm-thick × 8 sheets) from paraffin blocks of those samples by a QIAampDNA FFPE Tissue Kit (Qiagen GmbH, Hilden, Germany). On the other hand, the Cica geneusR total DNA prep kit (for tissue; Kanto Chemical, Tokyo, Japan) was used to extract cytological samples of normal buccal mucosa.
Bisulfite modification of DNA was done with the extraEZ DNA Methylation Kit (Zymo Research, Orange, CA, USA). The bisulfate-modified DNA samples were amplified by the Epitect MSP kit (Qiagen) and primers specific for methylated and unmethylated sequences. The primer sequences for detecting methylated and unmethylated SOCS1 and SOCS3 are summarized in Table 1. PCR amplification conditions were followed by 40 cycles of 95˚C for 30 sec, 55˚C for 30 min and 72˚C for 30 sec. PCR products were analyzed in 2% agarose gel stained with ethidium bromide and visualized under UV illumination.
2.3. RNA Extraction and RT-PCR
Total RNA from paraffin blocks was isolated using the RNeasy® FFPE Kit (Qiagen). TotalRNA was reverse transcribed by the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster, CA, USA). mRNA levels of SOCS1 and SOCS3 were assessed by real-time RT-PCR using SYBR green chemistry.
SOCS1 and SOCS3 primers of MSP and real-time RT-PCR
Primer
Sequences
PCR products (bp)
Ref.
MSP
SOCS1
Unmethylated
F; TGAAGATGGTTTTGGGATTTATGA
184
[35]
R; CACAACTCCTACAACAACCACACAC
Methylated
F; TGAAGATGGTTTCGGGATTTACGA
183
R; ACAACTCCTACAACGACCGCACG
SOCS3
Unmethylated
F; TAGTGTGTAAGTTGTAGGAGAGTGG
134
[35]
R; CTAAACATAAAAAAATAACACTAATCCAAA
Methylated
F; GTAGTGCGTAAGTTGTAGGAGAG
139
R; GTAAAAAAATAACGCTAATCCGAA
Real-time RT-PCR
SOCS1
F; TGGTAGCACACAACCAGGTG
92
[36]
R; GAGGAGGAAGAGGAGGAAGG
SOCS3
F; CAAGGACGGAGACTTCGATT
110
[36]
R; GGAGCCAGCGTGGATCTG
GAPDH
F; TGCACCACCAACTGCTTAGC
87
R; GGCATGGACTGTGGTCATGAG
F; forward, R; reverse.
Diluted cDNA was added to Ultra-Fast SYGR Green (Agilent Technologies, Santa Clara, California, USA) and each of forward and reverse primers, and performed using the Roche Applied Science 96cycler (Roche Diagnostics GmbH, Hilden, Germany). In each case, triplicate threshold cyclevalues were obtained and averaged, and expression levels were then evaluated by the ΔΔCT method. Expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the endogenous control to normalize expression data, which were analyzed using then: 2−ΔΔCT where, Δ Δ C T = ( C t-target − C t-reference ) treated-sample − ( C t-target − C t-reference ) calibrator-sample . Primers of SOCS1, SOCS3, and GAPDH are shown in Table 1.
2.4. Statistical Analysis
Data were given as mean ± SD. The Mann-Whitney U test was performed and P values less than 0.05 were considered statistically significant.
3. Results3.1. Methylation Status of SOCS1 and SOCS3 Genes by Methylation-Specific PCR (MSP)
The results of MSP are summarized in Table 2. Association between clinicopathological findings and MSP results in OLP are summarized in Table 3, and typical gel pictures of MSP are shown in Figure 1.
SOCS1 and SOCS3 gene methylation could be detected in 29/40 (72.5%) cases of OLP, 15/20 (75.0%) of OSCC, and 10/10 (100%) of normal oral exfoliated mucosa by the MSP method. SOCS1 methylation in 14/29 cases (48.3%) of OLP and 7/15 (46.7%) of OSCC was observed. However, all normal mucosa cases showed SOCS1 unmethylation. In contrast, SOCS3 methylation was found in 25/29 (86.2%) of OLP and 11/15 (73.3%) of OSCC cases. All normal mucosa cases showed SOCS3 unmethylation. Among the OLP cases, SOCS1 gene methylation was detected in 4/10 (40.0%) smoking and 9/17 (52.9%) nonsmoking patients. On the other hand, SOCS3 gene methylation was detected in 8/10 (80.0%) and 15/17 (88.2%) patients, respectively. When the frequency of methylation was compared according to clinical pictures, SOCS1 gene methylation was
Results of MSP
Gene
Disorders
Detected cases of MSP
Methylated cases
Unmethylated cases
Rate of methylation (%)
SOCS1
OLP (N = 40)
29
14
15
48.3
OSCC (N = 20)
15
7
8
46.7
Normal mucosa (N = 10)
10
0
10
0
SOCS3
OLP (N = 40)
29
25
4
86.2
OSCC (N = 15)
15
11
4
73.3
Normal mucosa (N = 10)
10
0
10
0
Association between clinicopathological findings and methylated cases of SOCS1 and SOCS3 in OLP
Clinicopathological findings
N = 29
SOCS1 methylated cases (%) N = 14
SOCS3 methylated cases (%) N = 25
Sex
Male
10
5 (50.0)
10 (100.0)
Female
19
9 (47.4)
15 (78.9)
Age
≤60 years
9
6 (66.7)
8 (88.9)
>60 years
20
8 (40.0)
17 (85.0)
Location
Buccal mucosa
22
9 (40.9)
19 (86.4)
Tongue
3
2 (66.7)
2 (66.7)
Gingiva
2
2 (100.0)
2 (100.0)
Palate
2
1 (50.0)
2 (100.0)
Smoking history
Smoking
10
4 (40.0)
8 (80.0)
Non-smoking
17
9 (52.9)
15 (88.2)
Unknown
2
1 (50.0)
2 (100.0)
Clinical feature of
Reticular type
16
8 (50.0)
14 (87.5)
OLP
Erosive type
13
6 (46.2)
11 (84.6)
A: SOCS1 methylation status in OLP. Cases 9, 20, and 29 were found unmethylated; cases 11 and 23 showed partial methylation; case 26 was not detectable by MSP. B: SOCS3 methylation status in OLP. Cases 14, 16, and 31 showed partial methylation. Cases 2, 15, and 27 showed complete methylation. C: SOCS1 methylation status in OSCC. Case 2 showed unmethylation and case 8 showed partial methylation. D: SOCS3 methylation status in OSCC. Case 4 showed partial methylation. Case 8 showed complete methylation. E: SOCS1 methylation status in normal mucosa. Case 1 showed unmethylation. F: SOCS3 methylation status in normal mucosa. Case 2 showed unmethylation.
found 8/16 (50.0%) reticular and 6/13 (46.2%) erosive types, whereas SOCS3 gene methylation was found in 14/16 (87.5%) and 11/13 (84.6%), respectively. Of three patients with HCV, two had SOCS1 and one had SOCS3 methylation. Similarly, there was no significant difference in methylation status between SOCS1 and SOCS3 in sex, age, location and clinical features (Table 3).
3.2. SOCS1 and SOCS3 mRNA Expression by Real-Time RT-PCR
We detected mRNA expression levels of SOCS1 and SOCS3 genes in cases that were detectable by MSP. SOCS1 mRNA expression level in OLP was significantly higher than that in SCC and normal mucosa (p < 0.05, Figure 2). There were no significant differences in SOCS3 among the three groups, although OSCC showed a tendency for higher mRNA expression level than OLP and normal mucosa (Figure 3). In OLP, there were no significant differences between mRNA expression levels of SOCS1 and SOCS3 and clinicopathological findings (sex, age, location, smoking history, and clinical types; data not shown).
3.3. Correlation of SOCS1 and SOCS3 Methylation with mRNA Expression
There were no differences in SOCS1 mRNA expression level between DNA methylation and mRNA expression (Figure 4). SOCS3 mRNA expression level in OLP and OSCC methylated groups was significantly lower than that in normal mucosa. Moreover, it was significantly higher than that in unmethylated groups (Figure 5).
4. Discussion
The etiology and pathogenesis of OLP is not completely understood. Many studies have focused on the association with environmental factors, like metal allergy, HCV, autoimmune disease and others [6] [7] . Epigenetics contribute to chronic inflammation and the development of individuals and tumors by regulating gene
expression by acquired qualification by environment without dependency on nucleotide sequence. Epigenetics contribute to chronic inflammation and the development of individuals and tumors by regulating gene expression by acquired qualification by environment without dependency on nucleotide sequence. One of the epigenetic mechanisms is the DNA methylation of the promoter region [27] [28] .
SOCS3 is involved in the negative regulation of inflammatory cytokines, such as IL-6 or IL-10, by interacting with the JAK/STAT pathway [22] [23] [24] [25] [26] . Furthermore, recent studies have shown that suppression of protein expression by aberrant methylation in the promoter region of the SOCS3 gene is associated with several types of malignancy, such as hepatocellular carcinoma, multiple myeloma, malignant melanoma, and colorectal carcinoma [32] [33] [34] [37] [38] [39] . In this study, SOCS3 methylation was found in 25/29 OLP (86.2%) and in 11/15 SCC (73.3%) cases. Moreover, it was found that the levels of mRNA for the SOCS3 genes were reduced in the methylated group compared to the unmethylated group in OLP and SCC. In addition, the level of mRNA expression in OLP was lower than that in SCC. In our study, we used the same primers as did Weber et al. [35] , who designed primers of the promoter region of SOCS1 and SOCS3. They have reported that the inactivation of SOCS3 has observed frequently in head and neck SCCs is due mainly to 90% methylation, and SOCS3 is detected with lower staining in the methylated than unmethylated groups on the protein level. In the cell lines of the SCCs, SOCS3 transcripts have increased on treatment with demethylation [35] .
SOCS3 is induced by tyrosine-phosphorylated STAT3 and terminates STAT3 phosphor ylation after initial exposure of cells to members of the IL-6 family of cytokines by binding cooperatively to the common receptor subunits gp130 and JAK1 and 2 [40] . Du et al. [41] have examined the immunoexpression and phosphorylation status of STAT3 of OLP using PathScan analysis and have found that pSTAT3 expression increased gradually in the normal mucosa, reticular OLP, and erosive OLP groups. They suggested that pSTAT3 might be involved in OLP development and progression [41] . On the other hand, a relationship has been reported between activation of STAT3 and Th17-induced cytokine, including IL-6 in malignant tumor, inflammatory bowel disease, and psoriasis [42] [43] . Th17-induced cytokines have activated STAT3 [42] . A previous study has shown that a new set, called Th17 cells, has been identified recently beyond the traditional Th1 and Th2 cells. Th17 cells produce IL-17A, IL-17F, IL-6, tumor necrosis factor (TNF)-α, granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-21, IL-26, and IL-22. Th17 cells have an important role in the protection against extracellular bacteria and fungi, in inflammation, and in the development of autoimmune diseases [44] . Th17-type molecules are increased in erosive OLP, whereas Th2-type molecules predominate in reticular OLP [44] . Activated STAT3 is interconnected with epidermal growth factor receptor (EGFR) and NF-κB, so that is related to tumor expression [18] [23] [24] . Therefore, our research suggested cases of methylated status and low mRNA expression level of SOCS3 in OLP and SCC might be activated STAT3 and correlate with chronic inflammation and tumorigenesis. In addition, the occurrence of OLP and SCC might be controlled by the demethylation of SOCS3.
In this study, there is no statistical difference between methylation status and mRNA expression levels of SOCS1 gene in OLP and SCC. Previous studies of malignant tumors, such as hepatocellular carcinoma, and pancreatic carcinoma, have shown methylated SOCS1 and a decrease in mRNA levels and protein [14] [17] [30] . Our study used the SOCS1 primer similarly to those devised by Weber et al. Although they have reported that the methylation status of SOCS1 was detected in 10/94 head and neck OSCC samples (11%) [38] , our study showed a high rate of the methylation status of SOCS1 in 7/15 OSCC (46.7%) and 14/29 OLP (48.3%) samples. The MSP method has detected a low concentration of methylated templates in an excess of unmethylated DNA. Consequently, the MSP method has a high analytical sensitivity [45] . This specificity is achieved by including many CpG in the primer sequences, preferably at or close to the 3’ end, but it also facilitates amplification of incompletely converted sequences in the bisulfite-treated DNA and can be false positives [46] [47] . The possibility that SOCS1 methylation occurs at a high rate in this study because of incompletely converted molecules may mimic methylated sequences, although that confirms that it does not nonspecifically amplify with negative control. In our research, the reason for choosing the MSP method is highly sensitive method. Because OLP specimen is small size and DNA amount extracted formalin-fixed paraffin embedded tissue with bisulfate treatment is low concentration. Practically, DNA methylation of SOCS1 and SOCS3 were detected by the methylation-specific PCR (MSP) method in 29/40 (72.5%) cases with OLP in this study.
The mRNA expression level of SOCS1 is higher in OLP than in SCC in this study. Increased SOCS1 mRNA levels correlated with increased IL-10 expression levels in periapical granuloma [48] , and with phosphorylated STAT1 expression levels in ligature-induced periodontitis in rats [49] . Furthermore, the expression of phosphorylated STAT1 is allowed in immunostaining of OLP [50] . In this study, increase of SOCS1 mRNA expression levels in OLP may be related closely to the activation of STAT1
5. Conclusion
Methylation of the SOCS3 promoter region resulted in the decreased expression levels of SOCS3 mRNA in OLP. Our data suggested that frequent methylation of the SOCS3 gene promoter, theoretically resulting in the increase of cytokines expression, might be associated with the etiological mechanism of OLP.
Acknowledgements
This study was supported in part by a research program of JSPS KAKENHI, Grant-in-Aid for Scientific Research (C) Grant Number 15K11319.
Cite this paper
Yoshimura, K., Yada, N., Matsuo, K., Hikiji, H., Yoshiga, D., Habu, M., Sasaguri, M. and Tominaga, K. (2018) Methylation and Expression Status of SOCS1 and SOCS3 in Oral Lichen Planus. Open Journal of Stomatology, 8, 168-181. https://doi.org/10.4236/ojst.2018.85016
ReferencesDe Rossi, S.S. and Ciarroca, K. (2014) Oral Lichen Planus and Lichenoid Mucositis. Dental Clinics of North America, 58, 299-313. https://doi.org/10.1016/j.cden.2014.01.001Parashar, P. (2011) Oral Lichen Planus. Otolaryngologic Clinics of North America, 44, 89-107. https://doi.org/10.1016/j.otc.2010.09.004Gorouhi, F., Davari, P. and Fazel, N. (2014) Cutaneous and Mucosal Lichen Planus: A Comprehensive Review of Clinical Subtype, Risk Factors, Diagnosis, and Prognosis. Scientific World Journal, 2014, 742-826. https://doi.org/10.1155/2014/74826Andresen, J.O. (1968) Oral Lichen Planus. 1. A Clinical Evaluation of 115 Cases. Oral Surgery, Oral Medicine, Oral Pathology, 25, 31-42. https://doi.org/10.1016/0030-4220(68)90194-1Ismail, S.B., Kumar, S.K. and Zain, R.B. (2007) Oral Lichen Planus and Lichenoid Reactions: Etiopathogenesis, Diagnosis, Management and Malignant Transformation. Journal of Oral Science, 49, 89-106.Kurago, Z.B. (2016) Etiology and Pathogenesis of Oral Lichen Planus: An Overview. Oral Surgery Oral Medicine Oral Pathology Oral Radiology, 122, 72-80. https://doi.org/10.1016/j.oooo.2016.03.011Payeras, M.R., Cherubini, K., Figueiredo, M.A. and Salum, F.G. (2013) Oral Lichen Planus; Focus on Etiopahogenesis. Archives of Oral Biology, 58, 1057-1069. http://linkinghub.elsevier.com/retrieve/pii/S0003996913001362 https://doi.org/10.1016/j.archoralbio.2013.04.004El-Naggar, A.K. and Reichart, P.A. (2005) Proliferative Verrucous Leukoplakia and Precancerous Condition. In: Barnes, L., Eveson, J.W., Reichart, P. and Sidranskiy, D., Eds., WHO Classification of Tumours. Pathology and Henetics Head Neck Tumours, IARC, Lyon, 180-181.Reibel, J. (2017) Oral Potentially Malignant Disoders and Oral Epithelial Dysplasia. In: El-Naggar, A.K., Chan, J.K.C., Grandis, J.R., Takata, T. and Slootweg, P.J., Eds., WHO Classification of Head and Neck Tumours, IARC, Lyon, 112.Cheng, Y.S., Gould, A., Kyrago, Z., Fantasia, J. and Muller, S. (2016) Diagnosis of Oral Lichen Planus: A Position Paper of the American Academy of Oral Maxillofacial Pathology. Oral Surgery Oral Medicine Oral Pathology Oral Radiology, 122, 332-354. https://doi.org/10.1016/j.oooo.2016.05.004Carrozzo, M., Uboldi de Capei, M., Dametto, E., Fasano, M.E., Arduino, P., Broccoletti, R., Vezza, D., Rendine, S., Courtoni, E.S. and Gandolfo, S. (2004) Tumor Necrosis Factor-Alpha and Interferon-Gamma Polymorphisms Contribute to Susceptibility to Oral Lichen Planus. Journal of Investigative Dermatology, 122, 87-94.http://linkinghub.elsevier.com/retrieve/pii/S0022202X15305923 https://doi.org/10.1046/j.0022-202X.2003.22108.xCacalano, N.A., Sanden, D. and Johnston, J.A. (2001) Thyrosine-Phospholated SOCS-3 Inhibits STAT Activation But Binds to p120 RasGAP and Activates Ras. Nature Cell Biology, 3, 460-465. https://doi.org/10.1038/35074525Larsen, L. and Ropke, C. (2002) Suppressors of Cytokine Signaling: SOCS. APMIS, 110, 833-844. https://doi.org/10.1034/j.1600-0463.2002.1101201.xYoshikawa, H., Matsubara, K., Qian, G.S., Jackson, P., Groopman, J.D., Manning, J.E., Harris, C.C. and Herman, J.G. (2001) SOCS-1, A Negative Regulator of the JAK/STAT Pathway, Is Silenced by Methylation in Human Hepatocellular Carcinoma and Shows Growth-Suppression Activity. Nature Genetics, 28, 29-35. https://doi.org/10.1038/88225Hanada, T., Kobayashi, T., Chinen, T., Saeki, K., Takaki, H., Koga, K., Minoda, Y., Sanada, T., Yoshioka, T., Mimata, H., Kato, S. and Yoshimura, A. (2006) IFNγ-Dependent, Spontaneous Development of Colorectal Carcinomas in SOCS1-Deficient Mice. JEM, 203, 1391-1397. https://doi.org/10.1084/jem.20060436Tanaka, K., Ichiyama, K., Hashimoto, M., Yoshida, H., Takimoto, T., Takasue, G., Torisu, T., Hanada, T., Yasukawa, H., Fukuyma, S., Inoue, H., Nakanishi, Y., Kobayashi, T. and Yosimura, A. (2008) Loss of Suppressor of Cytokine Signaling 1 in Helper T Cells Leads to Defective Th17 Differentiation by Enhancing Antagonistic Effects of IFN-γ on STAT3 and Smads. The Journal of Immunology, 180, 3746-3756. https://doi.org/10.4049/jimmunol.180.6.3746Zhang, X., Wang, J., Ding, S., Li, M., Sun, S., Zhang, L., Liu, S., Chen, X., Zhuang, H. and Lu, F. (2014) An Intergraded Analysis of SOCS1 Down-Regulation in HBV Infection-Related Hepatocellular Carcinoma. Journal of Viral Hepatitis, 21, 264-271.https://doi.org/10.1111/jvh.12137Lee, T.L., Yeh, J., Waes, C.V. and Chen, Z. (2006) Epigenetic Modification of SOCS-1 Differentially Regulates STAT3 Activation in Response to Interleukin-6 Receptor and Epidermal Growth Factor Receptor Signaling through JAK and/or MEK in Head and Neck Squamous Cell Carcinoma. Molecular Cancer Therapeutics, 5, 8-19. https://doi.org/10.1158/1535-7163.MCT-05-0069Mallette, F.A., Calabrese, V., Ilangumaran, S. and Ferbeyre, G. (2010) SOCS1, A Novel Interaction Partner of p53 Controlling Oncogene-Induced Senescence. Aging, 2, 445-452. https://doi.org/10.18632/aging.100163Maine, G.N., Mao, X., Komarck, C.M. and Burstein, E. (2007) COMMD1 Promotes the Ubiquitination of NF-kB Subunits through a Cullin-Containing Ubiquitin Ligase. The EMBO Journal, 26, 436-447. https://doi.org/10.1038/sj.emboj.7601489Ryo, A., Suizu, F., Yoshida, Y., Perrem, K., Liou, Y.C., Wulf, G., Rottapel, R., Yamaoka, S. and Lu, K.P. (2003) Regulation of NF-kappaB Signaling by Pin1-Dependent Prolyl Isomerization and Ubiquitin-Mediated Proteolysis of p65/RelA. Molecular Cell, 12, 1413-1426. https://doi.org/10.1016/S1097-2765(03)00490-8Yu, H., Kortylewski, M. and Pardoll, D. (2007) Crosstalk between Cancer and Immune Cells: Role of STAT3 in the Tumour Microenviroment. Nature Reviews Immunology, 7, 41-51. https://doi.org/10.1038/nri1995Jiang, R., Tan, Z., Deng, L., Chen, Y., Xia, Y., Gao, Y., Wang, X. and Sun, B. (2001) Interleukin-22 Promotes Human Hepatocellular Carcinoma by Activation of STAT3. Hepatology, 54, 900-909. https://doi.org/10.1002/hep.24486Yu, H., Pardoll, D. and Jove, R. (2009) STATs in Cancer Inflammation and Immunity: A Leading Role for STAT3. Nature Reviews Cancer, 9, 798-809. https://doi.org/10.1038/nrc2734Yoshimura, A., Suzuki, M., Sakaguchi, R., Hanada, T. and Yasukawa, H. (2012) SOCS, Inflammation, and, Autoimmunity. Frontiers in Immunology, 3, 20. https://doi.org/10.3389/fimmu.2012.00020Persico, Y., Capasso, M., Russo, R., Persico, E., Croce, L., Tiribelli, C. and Iolascon, A. (2008) Elevated Expression and Polymorphisms of SOCS3 Influence Patient Response to Antiviral Therapy in Chronic Hepatitis C. Gut, 57, 507-515. https://doi.org/10.1136/gut.2007.129478Baylin, S.B. (2005) DNA Methylation and Gene Silencing in Cancer. Nature Clinical Practice. Oncology, 1, 4-11. https://doi.org/10.1038/ncponc0354Bayarsaihan, D. (2011) Epigenetic Mechanisms in Inflammation. Journal of Dental Research, 90, 9-17. https://doi.org/10.1177/0022034510378683Gras, D. and Chanez, P. (2016) New Sociology for Better Understanding Severe Eosinophilic Asthma: Introducing the SOCS Family. The European Respiratory Journal, 48, 608-610. https://doi.org/10.1183/13993003.01240-2016Komazaki, T., Nagai, H., Emi, M., Terada, Y., Yabe, A., Jin, E., Kawanami, O., onishi, N., Moriyama, Y., Naka, T. and Kishimoto, T. (2004) Hypermethylation-Associated Inactivation of the SOCS-1 Gene, A JAK/STAT Inhibitor, in Human Pancreatic Cancers. Japanese Journal of Clinical Oncology, 34, 191-194. https://doi.org/10.1093/jjco/hyh035He, B., You, L., Uematsu, K., Zang, K., Xu, Z., Lee, A.Y., Costello, J.F., McCormick, F. and Jablons, D.M. (2003) SOCS-3 Is Frequently Silenced by Hypermethylation and Suppresses Cell Growth in Human Lung Cancer. Proceedings of the National Academy of Sciences, 100, 14133-14138. https://doi.org/10.1073/pnas.2232790100Jiang, B.G., Wang, N., Haung, J., Yang, Y., Sun, L., Pan, Z.Y. and Zhou, W.P. (2017) Tumor SOCS3 Methylation Status Predicts the Treatment Response to TACE and Prognosis in HCC Patients. Oncotarget, 8, 28621-28627. https://doi.org/10.18632/oncotarget.16157Dang, J., Bian, Y.Q., Sun, J.Y., Chen, F., Dong, G.Y., Liu, Q., Wang, X.W., Kjems, J., Gao, S. and Wang, Q.T. (2013) MicroRNA-137 Promoter Methylation in Oral Lichen Planus and Oral Squamous Cell Carcinoma. Journal of Oral Pathology & Medicine, 42, 315-321. https://doi.org/10.1111/jop.12012Cruz, A.F., De Resende, R.G., De Lascerda, J.C.T., Pereira, N.B., Melo, L.A., Diniz, M.G., Gomes, C.C. and Gomez, R.S. (2018) DNA Ethylation Patterns of Genes Related to Immune Response in the Different Clinical Forms of Oral Lichen Planus. Journal of Oral Pathology & Medicine, 47, 91-95. https://doi.org/10.1111/jop.12645Weber, A., Hengge, U.R., Bardenheuer, W., Tischoff, I., Sommerer, F., Markwarth, A., Dietz, A., Wittekind, C. and Tannapfel, A. (2005) SOCS-3 Is Frequently Methylated in Head and Neck Squamous Cell Carcinoma and Its Precursor Lesions and Causes Growth Inhibition. Oncogene, 24, 6699-6708. https://doi.org/10.1038/sj.onc.1208818Zhou, H., Miki, R., Eeva, M., Fike, F.M., Seligson, D., Yang, L., Yoshimura, A., Teitell, M.A., Jamieson, C.A. and Cacalano, N.A. (2007) Reciprocal Regulation of SOCS 1 and SOCS3 Enhances Resistance to Ionizing Radiation in Glioblastoma. Clinical Cancer Research, 13, 2344-2253. https://doi.org/10.1158/1078-0432.CCR-06-2303Wilop, S., van Gemmeren, T.B., Lentjes, M.H., van Engeland, M., Herman, J.G., Brümmendorf, T.H., Jost, E. and Galm, O. (2011) Methylation-Associated Dysregulation of the Suppressor of Cytokine Signaling-3 Gene in Multiple Myeloma. Epigenetics, 6, 1047-1052. https://doi.org/10.4161/epi.6.8.16167Tokita, T., Maesawa, C., Kimura, T., Kotani, K., Takahashi, K., Akasaka, T. and Masuda, T. (2007) Methylation Status of the SOCS3 Gene in Human Malignant Melanomas. International Journal of Oncology, 30, 689-694.Li, Y., de Haar, C., Chen, M., Deuring, J., Gerrits, M.M., Smits, R., Xia, B., Kuipers, E.J. and van der Woude, C.J. (2010) Disease-Related Expression of the IL6/STAT3/SOCS3 Signalling Pathway in Ulcerative Colitis and Ulcerative Colitis-Related Carcinogenesis. Gut, 59, 227-235. https://doi.org/10.1136/gut.2009.184176Wang, Y., van Boxel-Dezaire, A.H., Cheon, H., Yang, J. and Stark, G.R. (2013) STAT3 Activation in Response to IL-6 Is Prolonged by the Binding of IL-6 Receptor to EGF Receptor. Proceedings of the National Academy of Sciences, 110, 16975-16980. https://doi.org/10.1073/pnas.1315862110Du, G., Chen, J., Wang, Y., Cao, T., Zhou, L., Wang, Y., Han, X. and Tang, G. (2018) Differential Expression of STAT-3 in Subtypes of Oral Lichen Planus: A Preliminary Study. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, 125, 236-243.e1. https://doi.org/10.1016/j.oooo.2017.10.016Waldner, M.J. and Neurath, M.F. (2014) Master Regulator of Intestinal Disease: IL-6 in Chronic Inflammation and Cancer Development. Seminars in Immunology, 26, 75-79. https://doi.org/10.1016/j.smim.2013.12.003Calautti, E., Avalle, L. and Poli, V. (2018) Psoriasis: A STAT3-Centric View. International Journal of Molecular Sciences, 19, pii: E171. https://doi.org/10.3390/ijms19010171Piccinni, M.P., Lombardelli, L., Logiodice, F., Tesi, D., Kullolli, O., Biagiotti, R., Giudizi, M., Romagnani, S., Maggi, E. and Ficarra, G. (2014) Potential Pathogenetic Role of Th17, Th0, and Th2 Cells in Erosive and Reticular Oral Lichen Planus. Oral Diseases, 20, 212-218. https://doi.org/10.1111/odi.12094Kristensen, L.S. and Hancen, L.L. (2009) PCR-Based Methods for Detecting Single-locus DNA Methylation Biomarkers in Cancer Diangostics, Prognostics, and Response to Treatment. Clinical Chemistry, 55, 1471-1483. https://doi.org/10.1373/clinchem.2008.121962Shaw, R.J., Akufo-Tetteh, E.K., Risk, J.M., Field, J.K. and Liloglou, T. (2006) Methylation Enrichment Pyrosequencing: Combining the Specificity of MSP with Validation by Pyrosequencing. Nucleic Acids Research, 34, e78.Rand, K., Qu, W., Ho, T., Clark, S.J. and Molloy, P. (2002) Conversion-Specific Detection of DNA Methylation using Real-Time Polymerase Chain Reaction (ConLight-MSP) to Avoid False Positives. Methods, 27, 114-120. https://doi.org/10.1016/S1046-2023(02)00062-2Menezes, R., Garlet, T.P., Trombone, A.P., Repeke, C.E., Letra, A., Granjeiro, J.M., Campanelli, A.P. and Garlet, G.P. (2008) The Potential Role of Suppressors of Cytokine Signaling in the Attenuation of Inflammatory Reaction and Alveolar Bone Loss Associated with Apical Periodontitis. Journal of Endodontics, 34, 1480-1484. https://doi.org/10.1016/j.joen.2008.09.003de Souza, J.A, Nogueira, A.V., de Souza, P.P., Cirelli, J.A., Garlet, G.P. and Rossa, C. (2011) Expression of Suppressor of Cytokine Signaling 1 and 3 in Ligature-Induced Periodontitis in Rats. Archives of Oral Biology, 56, 1120-1128.http://linkinghub.elsevier.com/retrieve/pii/S0003996911001026 https://doi.org/10.1016/j.archoralbio.2011.03.022Liu, Y., Liu, G., Liu, Q., Tan, J., Hu, X., Wang, J., Wang, Q. and Wang, X. (2017) The Cellular Character of Liquefaction Degeneration in Oral Lichen Planus and the Role of Interferon Gamma. Journal of Oral Pathology & Medicine, 46, 1015-1022. https://doi.org/10.1111/jop.12595