<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AS</journal-id><journal-title-group><journal-title>Agricultural Sciences</journal-title></journal-title-group><issn pub-type="epub">2156-8553</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/as.2018.95037</article-id><article-id pub-id-type="publisher-id">AS-84573</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Earth&amp;Environmental Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Detection and Identification of Potato Soft Rot &lt;i&gt;Pectobacterium carotovorum&lt;/i&gt; Subspecies &lt;i&gt;carotovorum&lt;/i&gt; by PCR Analysis of 16S rDNA in Jordan
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ibtihal</surname><given-names>Abu-Obeid</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hamed</surname><given-names>Khlaif</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Nida</surname><given-names>Salem</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Plant Protection Directorate, National Agricultural Research Center (NARC), Amman, Jordan</addr-line></aff><aff id="aff2"><addr-line>Plant Protection Department, Faculty of Agriculture, Jordan University, Amman, Jordan</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>ibtihal@ncare.gov.jo(IA)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>11</day><month>05</month><year>2018</year></pub-date><volume>09</volume><issue>05</issue><fpage>546</fpage><lpage>556</lpage><history><date date-type="received"><day>25,</day>	<month>March</month>	<year>2018</year></date><date date-type="rev-recd"><day>14,</day>	<month>May</month>	<year>2018</year>	</date><date date-type="accepted"><day>17,</day>	<month>May</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Various bacterial species are known to be agents causing soft rot of potatoes. The results of this study showed that potato soft rot is widely spread in different potato planting areas in Jordan. A survey was conducted through the years 2013-2015 to detect potato soft rot disease in Jordan, two hundred and four rotted potato samples were collected from different potato growing areas through different potato growing seasons. One hundred and thirty one bacterial isolates were isolated, purified on selective media and identified as 
  <em>Pec</em>
  <em>tobacterium carotovorum</em> subspecies 
  <em>carotovorum </em>(
  <em>Pcc</em>) by different biochemical and physiological tests. Furthermore, 131 
  <em>Pcc </em>Jordanian (Jo) isolates were identified by PCR analysis of total DNA extracted from isolates that were biochemically identified as
  <em> Pcc </em>using universal primer Fd1/Rd1. Cloning and sequencing of representative PCR products, amplifying the 16S rDNA region were done. Phylogenetic analysis of the 
  <em>Pcc</em> Jo-isolates revealed other than 90% similarity with different reference
  <em> Pcc</em> strains available at the GenBank. Different rot causal agents also were detected by PCR amplification and further sequences. The sequencing data revealed similarities to 
  <em>Pseudomonas fluorescence</em>, Enterobacteriaceae genera such as 
  <em>Enterobacter</em> spp.,
  <em> Serratia</em> spp. and 
  <em>Klebsiella</em> spp., in addition to 
  <em>Pectobacterium carotovorum </em>subsp. 
  <em>carotovorum</em>. This study indicated that using molecular techniques such as amplification of 16S rDNA region is a sensitive and specific method for detecting 
  <em>Pcc </em>as potato soft rot causal agent. So far this is the first study where 
  <em>Pcc </em>has been identified by using PCR and sequencing approaches in Jordan.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Pectobacterium carotovorum&lt;/i&gt; subsp. &lt;i&gt;carotovorum&lt;/i&gt; (&lt;i&gt;Pcc&lt;/i&gt;)</kwd><kwd> Soft Rot of Potato</kwd><kwd> PCR</kwd><kwd> Sequencing</kwd><kwd> Detection</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Potato (Solanum tuberosum L.) is one of the most common and important vegetables listed among the five principle and popular crops grown in the world as well as in Jordan for both consumption and export. In 2013, the area planted with potato in Jordan was 34,028.5 dunams, with total production of 103,223.4 tons [<xref ref-type="bibr" rid="scirp.84573-ref1">1</xref>] .</p><p>Different bacterial diseases have been reported to attack potatoes leading to a high economic loss in yield and quality under favorable environmental conditions. However, the potato soft rot is one of the most important diseases of potatoes causing great reduction in yield resulting in economic losses in the field, during transit, and reported to be caused by various species: Bacillus spp., fluorescent Pseudomonas spp., Enterobacter cloacae and Erwinia spp. [<xref ref-type="bibr" rid="scirp.84573-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref5">5</xref>] . However, Erwinia carotovora subsp. carotovora is reported as the most common causal agent of bacterial soft rot of potato and other commercially important crops [<xref ref-type="bibr" rid="scirp.84573-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref7">7</xref>] .</p><p>Controlling bacterial diseases are very difficult and efficient control should rely on cultural practices and could benefit from different tools allowing rapid and specific detection of causal agents at low levels of infectivity.</p><p>Efficient and cost-effective detection and identification methods are essential to investigate the ecology and pathogenesis of soft rot Erwinias. Different methods are followed in order to detect, identify and differentiate soft rot causing bacteria to species and subspecies level, of these methods: microscopy, isolation, biochemical characterization, serological techniques, pathogenicity and bioassay tests. All of these methods are time consuming, insensitive, inaccurate and not suitable for routine work to test a large number of samples [<xref ref-type="bibr" rid="scirp.84573-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref9">9</xref>] .</p><p>In the last 30 years, Polymerase Chain Reaction (PCR) has been used for specific, rapid detection and identification of pathogen isolates. PCR techniques greatly enhance detection sensitivity, simplicity and rapidity compared with other methods of identification and are based on specific amplification of a target DNA sequence that is unique to a bacterial genome [<xref ref-type="bibr" rid="scirp.84573-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref11">11</xref>] .</p><p>In Jordan, Erwinia carotovora subsp. carotovora, recently known as Pcc, was identified as the causal agent of soft rot disease of vegetables; its detection and identification was carried out through traditional techniques such as isolation on selective media and biochemical characterization. The pathogen infects and causes disease on a wide variety of hosts belonging to different families of vegetables either in field and storage in different areas including; Jordan Valley and Uplands. Soft rot of potatoes is a tuber borne disease where the contaminated mother tubers were reported to be the main source of inoculum. However, this bacterium was found to survive in the soil with population trends varying with the fluctuation in soil temperature [<xref ref-type="bibr" rid="scirp.84573-ref12">12</xref>] .</p><p>Traditional techniques used for detection and identification of the causal agents are time consuming and relatively insensitive. Therefore, there is an urgent need for a sensitive and highly specific technique for rapid detection and identification of Pcc.</p><p>This research was conducted in order to isolate and identify potato soft rot causal agent by PCR technique.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Sample Collections and Bacterial Isolation</title><p>A minimum of five potato representative samples was collected from each site, including stem and tubers suspected to be infected with soft rot, grown in the fall and spring seasons and storage facilities from different potato growing areas in Jordan.</p><p>The rotted tubers and plant tissues were washed; surface disinfected, rinsed with sterile distilled water (SDW). Approximately 10 g of rotted tubers was cut, placed insterile bottles, placed on a shaker at 200 rpm at room temperature. After the suspension becomes homogenized a series of serial dilutions were prepared up to 10<sup>−</sup><sup>3</sup> dilution, then 0.1 ml of the 10<sup>−3</sup> dilution was spread by a sterile glass rod onto the surface of three Logan’s medium plates [<xref ref-type="bibr" rid="scirp.84573-ref13">13</xref>] . The inoculated plates were incubated at 27˚C &#177; 2˚C checked periodically. Appearance of bacterial colonies with wide, pink centers within the first 24 hours of inoculation was suspected to be Pcc [<xref ref-type="bibr" rid="scirp.84573-ref14">14</xref>] , and then single colonies were restreaked onto new NA plates. The obtained bacterial isolates were kept in refrigerator for further identifications.</p></sec><sec id="s2_2"><title>2.2. Identification of the Causal Agent</title><p>Twenty four hours old cultures of the obtained bacterial isolates were subjected to biochemical and physiological tests for characterization and identification as described by [<xref ref-type="bibr" rid="scirp.84573-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref15">15</xref>] . The same tests were run against a reference culture of Pcc isolate NCPPB312 (National Collection of Plant Pathogenic Bacteria) obtained from Food and Environment Research Agency (fera), United Kingdom and against negative control, these tests were:</p><p>Oxidase Test, Catalase Test, Potato soft rot, Oxidative fermentative Test (OF), Growth at 37˚C, Sodium chloride tolerance test, Reducing substances from sucrose, Urease Production Test, Acid Production from Carbohydrates Test.</p></sec><sec id="s2_3"><title>2.3. Isolation and PCR Amplification of Genomic</title><p>Bacterial DNA was extracted from 24 hours old pure bacterial cultures of one hundred and thirty one bacterial isolates grown on NA media at 37˚C, obtained and identified by biochemical and physiological tests as Pcc isolates. Pure bacterial colonies were picked with a sterile loop and mixed in 4 ml of nutrient broth media in a sterile and labeled culture tubes (Greiner, Bio-One, GmbH, Germany) incubated over night at 37˚C, with shaking at 150 rpm.</p><p>Genomic DNA extraction was done using DN easy Blood and Tissue Kit (Qiagen, Valancia, CA); the protocol was performed according to the manufacturer’s instructions. The quantity and quality of the extracted genomic DNA were measured using the spectrophotometer (BioPhotometer plus, Eppendorf, Hamburg, Germany) and DNA was visualized by electrophoresis (BIORAD power PAC300) in 1.0% agarose gel in Tris-Acetate-EDTA (TAE 1X) (Promega, Madison, Wisconsin) buffer stained with ethidium bromide (0.5 &#181;g/ml) (Sambrook and Russell, 2001). The extracted DNA was stored at −20˚C for further PCR work.</p></sec><sec id="s2_4"><title>2.4. Polymerase Chain Reaction (PCR) Amplification</title><p>In order to detect the presence of the desired DNA fragments that confirm the presence of Pcc, the 16S rDNA sets of primers (Fd1: CAGAGTTTGATCCTGGCTCAG, Rd1AAGGAGGTGATCCAGCC), were used (Lane, 1991). The concentration of each primer was adjusted to 10 pmol/&#181;l by Nuclease Free Water (NFW) and stored at −20˚C.</p><p>DNA amplification was done according to the conventional method and the PCR reaction mix was in the final reaction volume of 25 &#181;l contained; 5.0 &#181;l 5X Crimson Taq buffer, 1.1 &#181;l 25 mM MgCl<sub>2</sub>, 0.5 &#181;l 10 mM dNTPs, 0.13 &#181;l 5 U/&#181;l Taq polymerase, 1.25 &#181;l 10 &#181;M of each primer and 2.0 &#181;l DNA template finalized to 25 &#181;l by adding 13.77 NFW.</p><p>PCR was performed in a thermal cycler BIORAD T100™ (Biorad, Hercules, CA) using the following protocol and adjusted as needed. The reaction involved Initial denaturation (94˚C, 5 min) followed by 35 cycles of denaturation (94˚C, 1 min), annealing (55˚C, 1 min), extension (72˚C, 1 min) with a final extension (72˚C, 7 min).</p></sec><sec id="s2_5"><title>2.5. DNA Sequencing and Phylogenetic Analysis</title><p>Clones containing inserts and PCR products were identified and nucleotide sequencing was performed in both directions by Macrogen Korea (Seoul, Rep. OF Korea) or Quintara Biosciencs (South San Francisco, CA). The homology search of the cloned sequences or PCR products was performed using Basic local alignment searching tool (BLAST) at the NCBI server (http://blast.ncbi.nlm.nih.gov/Blast.cgi). A Blast search was performed for nucleotide using BLASTn. Evolutionary trees for the data were reconstructed using MEGA [<xref ref-type="bibr" rid="scirp.84573-ref16">16</xref>] and they were inferred by using the Neighbor-Joining (NJ) program of MEGA.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Sample Collection, Identification and Characterization of the Causal Agent</title><p>Approximately, two hundreds and four rotted potato samples suspected to be infected with soft rot disease were collected from fields and storage throughout potato growing areas in Jordan during summer, autumn and winter seasons, during the period extended from November/2013 until July/2015 from 20 locations.</p><p>After inoculation tests, observation of different characteristics, biochemical, physiological and nutritional tests; one hundred and thirty one bacterial isolates could be identified as strains of Pcc. The reactions of the tested bacterial isolates to the different biochemical, physiological and nutritional tests were identical to the results of the same tests ran against the reference bacterial culture of Pcc isolate NCPPB312.</p></sec><sec id="s3_2"><title>3.2. Detection of Pcc Using Polymerase Chain Reaction (PCR)</title><p>One hundred and thirty one bacterial isolates yielded a 1530 bp DNA fragments with the universal primers set (Fd1/Rd1) which are commonly used for the detection of bacteria (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p></sec><sec id="s3_3"><title>3.3. Sequencing Analysis</title><p>Searching nucleotide data base using a nucleotide query (BLASTn) of all isolates sequences obtained showed high range of similarity to different plant rotting causal agents such as Pseudomonas fluorescens, Enterobacteriaceae genera such as Enterobacter spp., Serratia spp. and Klebsiella spp. Some sequences showed high similarity to Pectobacterium spp., in addition to the similarity to Pcc isolates (<xref ref-type="table" rid="table1">Table 1</xref>).</p><p>Maximum nucleotide similarity (BLASTn) results obtained from Jo-isolates that amplified with Fd1 and Rd1 set of primers showed high similarity with different strains of Pcc deposited in the GenBank (<xref ref-type="table" rid="table2">Table 2</xref>), and the nucleotide sequence similarity percentage ranged from 96% up to 100%. In addition to similarity with different strains of Pcc, some isolates showed similarity with other rotting causal agents such as Pseudomonas spp., Serratia spp. and Enterobacter spp., where the similarity ranged between 94% and 98% (<xref ref-type="table" rid="table1">Table 1</xref>).</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Homology search (BLAST) results of all sequenced samples</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >No.</th><th align="center" valign="middle" >Primer Set</th><th align="center" valign="middle" >Isolate</th><th align="center" valign="middle" >Type of Sequenced sample (Clones/PCR product)*</th><th align="center" valign="middle" >Maximum similarity hit</th></tr></thead><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Fd1 Rd1</td><td align="center" valign="middle" >M86\1</td><td align="center" valign="middle" >clones</td><td align="center" valign="middle" >98% Pseudomonas sp</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G20\2</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >98% Serratia sp</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G18\2</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >98% Enterobacter sp.</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G29\1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >96% Pseudomonas sp.</td></tr><tr><td align="center" valign="middle" >5</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G34\2</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >99% Pseudomonas sp.</td></tr><tr><td align="center" valign="middle" >6</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G37\4</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >99% Enterobacter sp.</td></tr><tr><td align="center" valign="middle" >7</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G49\1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >97% Pseudomonas sp.</td></tr><tr><td align="center" valign="middle" >8</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G55\1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >97% Pseudomonas sp.</td></tr><tr><td align="center" valign="middle" >9</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G60\3</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >94% Pseudomonas sp.</td></tr><tr><td align="center" valign="middle" >10</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G62\1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >97% Pseudomonas sp.</td></tr><tr><td align="center" valign="middle" >11</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G65\3</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >96% Pseudomonas sp.</td></tr><tr><td align="center" valign="middle" >12</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G70\1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >98% Pseudomonas sp.</td></tr><tr><td align="center" valign="middle" >13</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >S102\1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >96% Pseudomonas sp.</td></tr><tr><td align="center" valign="middle" >14</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >R16\3</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >96% Agrobacterium sp.</td></tr><tr><td align="center" valign="middle" >15</td><td align="center" valign="middle" >Fd1 Rd1</td><td align="center" valign="middle" >G27\4</td><td align="center" valign="middle" >PCR products</td><td align="center" valign="middle" >94% P. carotovorum</td></tr><tr><td align="center" valign="middle" >16</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >Q111\4</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >99% Enterobacter sp.</td></tr><tr><td align="center" valign="middle" >17</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >R105\4</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >95% Pcc</td></tr><tr><td align="center" valign="middle" >18</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G18\3</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >96% P. carotovorum</td></tr><tr><td align="center" valign="middle" >19</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G43\1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >97% Enterobacter sp.</td></tr><tr><td align="center" valign="middle" >20</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >G70\2</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >99% Pcc</td></tr><tr><td align="center" valign="middle" >21</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >M113\2\4</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >95% Klebsilla sp.</td></tr><tr><td align="center" valign="middle" >22</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >M113\4</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >95% Pcc</td></tr><tr><td align="center" valign="middle" >23</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >R105\4</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >99% Pseudomonas sp.</td></tr><tr><td align="center" valign="middle" >24</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >NCPPB312</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >99% Pcc</td></tr></tbody></table></table-wrap><p>*The type of product that have been sequenced.</p></sec><sec id="s3_4"><title>3.4. Phylogenetic Analysis</title><p>The preliminary analysis for the partial DNA sequences obtained compared with different Pcc strains deposited in the GenBank revealed that different isolates from different regions clustered closely to the reference strains used for comparison (<xref ref-type="fig" rid="fig2">Figure 2</xref>). Isolates Jo-M2, 113, 86 and Jo-G 70, 18, 43 clustered closely to reference strains; Pcc C150 from Germany (Acc. no. J243601.1), strain Pcc ECC301901 from Korea (Acc. No. FJ595867.1) and Pcc strain NBRC 3830 from Japan (Acc. No. AB680143.1) in addition to the reference strain Pcc NCPPB312 (Acc. No. NZ_JQHJ01000042.1) from UK with 100% bootstrap value. Whereas isolates Jo-G37 and Jo-Q111 clustered individually and were closer to the Pcc strain Y46 (Acc. No. KP187511.1) from China with bootstrap value of 98%.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Maximum nucleotide similarity (BLASTn) between Pectobacterium carotovorum subsp. carotovorum Jo-isolates amplified with Fd1 and Rd1 set of primers and most closely species/subspecies [<xref ref-type="bibr" rid="scirp.84573-ref17">17</xref>] </title></caption><table><tbody><thead><tr><th align="center" valign="middle" >No.</th><th align="center" valign="middle" >Isolate and Accession no. in GenBank</th><th align="center" valign="middle" >Closely related species/subspecies</th><th align="center" valign="middle" >E-value</th><th align="center" valign="middle" >Maximum % similarity</th><th align="center" valign="middle" >Accession no.</th></tr></thead><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Jo-G18 (MF375782)</td><td align="center" valign="middle" >Pcc strain C142</td><td align="center" valign="middle" >5e<sup>−175</sup></td><td align="center" valign="middle" >100%</td><td align="center" valign="middle" >JF926752.1</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >Jo-G43 (MF375783)</td><td align="center" valign="middle" >Pcc strain Y46</td><td align="center" valign="middle" >9e<sup>−169</sup></td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >KP187511.1</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >Jo-G70 (MF375784)</td><td align="center" valign="middle" >Pcc strain Y46</td><td align="center" valign="middle" >4e<sup>−172</sup></td><td align="center" valign="middle" >100%</td><td align="center" valign="middle" >KP187511.1</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >Jo-M113 (MF375785)</td><td align="center" valign="middle" >Pcc strain Y46</td><td align="center" valign="middle" >4e<sup>−172</sup></td><td align="center" valign="middle" >100%</td><td align="center" valign="middle" >KP187511.1</td></tr><tr><td align="center" valign="middle" >5</td><td align="center" valign="middle" >Jo-M86 (MF375786)</td><td align="center" valign="middle" >Pcc strain Y46</td><td align="center" valign="middle" >4e<sup>−172</sup></td><td align="center" valign="middle" >98%</td><td align="center" valign="middle" >KP187511.1</td></tr><tr><td align="center" valign="middle" >6</td><td align="center" valign="middle" >Jo-G37 (MF375787)</td><td align="center" valign="middle" >Erwinia spp.ST12</td><td align="center" valign="middle" >4e<sup>−158</sup></td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >KP405846.1</td></tr><tr><td align="center" valign="middle" >7</td><td align="center" valign="middle" >Jo-M2 (MF375788)</td><td align="center" valign="middle" >Pcc strain Y46</td><td align="center" valign="middle" >4e<sup>−172</sup></td><td align="center" valign="middle" >98%</td><td align="center" valign="middle" >KP187511.1</td></tr><tr><td align="center" valign="middle" >8</td><td align="center" valign="middle" >Jo-G20 (MF375789)</td><td align="center" valign="middle" >Pcc C1 strain</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >96%</td><td align="center" valign="middle" >CP001657.1</td></tr><tr><td align="center" valign="middle" >9</td><td align="center" valign="middle" >Jo-Q111 (MF375790)</td><td align="center" valign="middle" >Pcc strain KN28216</td><td align="center" valign="middle" >0.0</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >GU936999.1</td></tr><tr><td align="center" valign="middle" >10</td><td align="center" valign="middle" >Reference strain NCPPB312</td><td align="center" valign="middle" >Pcc strain Y46</td><td align="center" valign="middle" >6e<sup>−156</sup></td><td align="center" valign="middle" >98%</td><td align="center" valign="middle" >KP187511.1</td></tr></tbody></table></table-wrap><p>Moreover, the individual isolate Jo-G20 clustered with the reference strain Pcc C1 (Acc. No. CP001657.1) from USA with 100% bootstrap value. Phytophthora infestance (Acc. No. ES466728.1) from USA was used as out group because the 16S rDNA primers set can detect all bacterial strains.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Seed potatoes have been imported into Jordan with reports of increasing incidence and dispersal of important bacterial potato diseases in different potato growing regions. Field trips to all potato growing areas during all seasons of the study at different plant growing stages revealed that potato soft rot disease occurred in all surveyed areas.</p><p>The number of species and subspecies of Pectobacterium has been increased over recent years and, as a result, their identification and differentiation by classical microbiological tests have become challenging. It has been become more difficult to make accurate identification based on biochemical tests alone because phenotypic characteristics vary among strains of same species and subspecies [<xref ref-type="bibr" rid="scirp.84573-ref18">18</xref>] . However, identification of Jordanian potato soft rot isolates using traditional methods; biochemical tests which are usually used for identification of Pcc at species level, results indicated that Pcc was the causal agent of the disease, but our findings later on, indicated that these tests were not highly accurate when compared to molecular methods. Compared with different DNA sequence analysis used in this study, biochemical tests were able to identify most isolates but misidentified others.</p><p>Sequence analysis identified in addition to Pcc other bacterial genera that could be associated with potato soft rot. Our findings indicated different bacterial causal agents that would be associated with Pcc and causing rot diseases such as Pseudomonas fluorescens, different Enterobacteriaceae genera such as Enterobacter spp., Serratia spp., and Klebsiella spp., whereas these species belonging to these genera cause rots and were reported by different studies [<xref ref-type="bibr" rid="scirp.84573-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref19">19</xref>] . Therefore, utilization of molecular data will be required since morphological or biochemical characters may be less robust.</p><p>In this study, PCR was carried out for all DNA extracts of bacterial soft rot isolates that were confirmed by biochemical tests as Pcc, the result of PCR for 131 isolates tested detected the presence of the desired DNA fragments of 1530 bp using the 16S rDNA set of primers, (Fd1and Rd1) compared with the positive DNA extract of the reference strain of Pcc NCPPB312 which gave a product size of 1530 bp, The 16S rDNA sequences are conserved with stable copies and its analysis is discriminative than other ribosomal regions, and in general 16S rDNA is amplified and sequenced with universal primers to identify species and subspecies [<xref ref-type="bibr" rid="scirp.84573-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.84573-ref21">21</xref>] .</p><p>Consequently, the identity of Pcc causing soft rot of potato in Jordan was confirmed by phylogenetic analysis of 16S rDNA from variety of phytopathogenic bacteria. Jo-isolates tested from different regions of Jordan clustered together with Pcc 16S rDNA sequences presented in the GenBank. Results support the classification of Pcc as a species or subspecies distinct from Phytophthora infestance strain which was used as out group.</p><p>In our homology search; BLASTn of Jo-isolates sequenced on the bases of the 16S rDNA, detected high similarity with different reference strains at the GenBank and was closely related to the sequences of different bacterial rotting causal agents such as; Pseudomonas spp., Bacillus spp., Serratia spp. and Enterobacter spp.. In fact the Fd1and Rd1 primers that were used in this study are general primers which can detect different bacterial causal agents [<xref ref-type="bibr" rid="scirp.84573-ref22">22</xref>] , but could be used as a preliminary step in bacterial identification.</p><p>Interestingly, the Pcc Jo-isolates from different regions didn't cluster distinctively according to their locations and this would be attributed to the fact that the source or origin of potato seeds in Jordan is mainly from one source and the importing companies are few, which distribute seeds to all agricultural regions (personal communication with MOA). On the other hand, a study done by [<xref ref-type="bibr" rid="scirp.84573-ref23">23</xref>] and confirmed by [<xref ref-type="bibr" rid="scirp.84573-ref20">20</xref>] indicated that Pectobacterium can easily spread by different agents such as air currents and may travel long distance in the atmosphere and surface water in addition to contaminated stored seeds [<xref ref-type="bibr" rid="scirp.84573-ref24">24</xref>] .</p><p>In majority of cases, genotypically isolates were more closely related to one another than those isolated from different geographical regions. However, the similarity between groups of isolates isolated from different regions suggested the same genetic origin of these isolates.</p></sec><sec id="s5"><title>5. Conclusions and Recommendations</title><p>Soft rot disease is widely common in different potato growing areas in Jordan and the results of biochemical and physiological tests confirmed that the main causal agent of soft rot in Jordan is P. carotovorum subsp. carotovorum. While using the PCR primer pair Fd1/Rd1 was found to be reliable in detection and identification of all soft rot Jordanian isolates of Pcc, DNA sequencing was found to be the most reliable way in specific detection and confirmation of the causal agent of soft rot.</p><p>On the other hand, more studies need to be implemented in order to study soft rot disease etiology and epidemiology.</p></sec><sec id="s6"><title>Cite this paper</title><p>Abu-Obeid, I., Khlaif, H. and Salem, N. (2018) Detection and Identification of Potato Soft Rot Pectobacterium carotovorum Subspecies carotovorum by PCR Analysis of 16S rDNA in Jordan. Agricultural Sciences, 9, 546-556. https://doi.org/10.4236/as.2018.95037</p></sec></body><back><ref-list><title>References</title><ref id="scirp.84573-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Anonymous (2013) The Hashemite Kingdom of Jordan. Jordan Statistical Year Book.</mixed-citation></ref><ref id="scirp.84573-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Liao, C.H. and Wells, J.M. (1987) Diversity of Pectolytic Fluorescent Pseudomonades Causing Soft Rots of Fresh Vegetables at Produce Markets. Phytopathology, 77, 673-677. https://doi.org/10.1094/Phyto-77-673</mixed-citation></ref><ref id="scirp.84573-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Bishop, A.L and Davis, R.M. (1990) Internal Decay of Onion Caused by Enterobacter cloacae. Plant Disease, 74, 692-694. https://doi.org/10.1094/PD-74-0692</mixed-citation></ref><ref id="scirp.84573-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Agrios, G. (2005) Plant Pathology. 5th Edition, Elsevier Academic Press, London.</mixed-citation></ref><ref id="scirp.84573-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Schroeder, B.K., duToit, L.J. and Schwartz, H.F. (2009) First Report of Enterobacter colace Causing Onion Bulb Rot in the Colombia Basin Washington State. Plant Disease, 93, 223-228. https://doi.org/10.1094/PDIS-93-3-0323A</mixed-citation></ref><ref id="scirp.84573-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Perombelon, M. (2002) Potato Diseases Caused by Soft Rot Erwinias: An Overview of Pathogenesis. Plant Pathology, 51, 1-12. https://doi.org/10.1046/j.0032-0862.2001.Short title.doc.x</mixed-citation></ref><ref id="scirp.84573-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Monilola, W. and Abiola, O. (2011) Diversity of Pectinolytic Bacteria Causing Soft Rot Disease of Vegetables in Ibadan, Nigeria. Journal of Applied Bio Sciences, 38, 2540-2550.</mixed-citation></ref><ref id="scirp.84573-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Narayanasamy, P. (2011) Detection of Bacterial and Phytoplasmal Pathogens. Microbial Plant Pathogens-Detection and Disease Diagnosis. Springer Science, New York. https://doi.org/10.1007/978-90-481-9769-9_2</mixed-citation></ref><ref id="scirp.84573-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Czajkowski, R., Grzegorz, G. and van der Wolf, J. (2009) Distribution of Dickeya spp. and Pectobacterium carotovorum ssp. Carotovorum in Naturally Infected Seed Potatoes. European Journal of Plant Pathology, 125, 263-275. https://doi.org/10.1007/s10658-009-9480-9</mixed-citation></ref><ref id="scirp.84573-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Toth, I., Hyman, L. and Wood, J. (1999) A One Step PCR-Based Method for Detection of Economically Important Soft Rot Erwinia Species on Micropropagated Potato Plants. Journal of Applied Microbiology, 87, 158-166. https://doi.org/10.1046/j.1365-2672.1999.00808.x</mixed-citation></ref><ref id="scirp.84573-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Kang, H., Knwon, S. and Go, S. (2003) PCR-Based Specific and Sensitive Detection of Pectobacterium carotovorum ssp. Carotovorum by Primers Generated from URP-PCR Finger Printing-Derived Polymorphic Band. Plant Pathology, 52, 127-133. https://doi.org/10.1046/j.1365-3059.2003.00822.x</mixed-citation></ref><ref id="scirp.84573-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Rajeh, O. and Khlaif, H. (2000) Soft Rot Disease of Vegetables in Jordan: Host Range, Reaction of Some Potato Cultivars to the Identification and Effect of Planting Date. Dirasat, Agricultural Sciences, 27, 149-157.</mixed-citation></ref><ref id="scirp.84573-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Schaad, N., Jones, J. and Chun, W. (2001) Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd Edition, APS, St. Paul, Minnesota.</mixed-citation></ref><ref id="scirp.84573-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Fahy, P. and Parsley, G. (1983) Plant Bacterial Diseases. Academic Press, Sydney.</mixed-citation></ref><ref id="scirp.84573-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Perombelon, M. and Kelman, A. (1980) Ecology of the Soft Rot Erwinia. Annual Review of Phytopathology, 18, 361-387. https://doi.org/10.1146/annurev.py.18.090180.002045</mixed-citation></ref><ref id="scirp.84573-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Kumar, S., Tamura, K., Jakobsen, I.B. and Nei, M. (2001) MEGA2: Molecular Evolutionary Genetics Analysis Software. Bioinformatics, 17, 1244-1245.https://doi.org/10.1093/bioinformatics/17.12.1244</mixed-citation></ref><ref id="scirp.84573-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Abu-Obeid, I., Khlaif, H. and Salem, N. (2018) Comparison of Different Sets of Primers Used in Detection and Identification of Potato Soft Rot Pectobacterium carotovorum subsp. carotovorum (DYE1969). Asian Journal of Research in Crop Science, 1, 1-12.</mixed-citation></ref><ref id="scirp.84573-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">De Boer, S., Li, X. and Ward, L. (2012) Pectobacterium spp. Associated with Bacterial Stem Rot Syndrome of Potato in Canada. Phytopathology, 102, 937-947.https://doi.org/10.1094/PHYTO-04-12-0083-R</mixed-citation></ref><ref id="scirp.84573-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Rodrigues Neto, J., Yano, T., Beriam, L.O., Destefano, S.A., Oliveira, V.M. and Rosato, Y.B. (2003) Comparative RFLP-ITS Analysis between Enterobacter cloacae Strains Isolated from Plants and Clinical Origin. Arquivos Do Instituto Biologico (Sao Paulo), 70, 367-372.</mixed-citation></ref><ref id="scirp.84573-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Zhu, I., Xie, H., Chen, S. and Ma, R. (2010) Rapid Isolation, Identification and Phylogenetic Analysis of Pectobacterium carotovorum ssp. Journal of Plant Pathology, 92, 479-483.</mixed-citation></ref><ref id="scirp.84573-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Rohinishree, Y. and Negi, P. (2011) Detection, Identification and Characterization of Staphylococci in Street Vend Foods. Food and Nutrition Sciences, 2, 304-313.https://doi.org/10.4236/fns.2011.24044</mixed-citation></ref><ref id="scirp.84573-ref22"><label>22</label><mixed-citation publication-type="book" xlink:type="simple">Lane, D.J. (1991) 16S/23S rRNA Sequencing. In: Stackebrandt, E. and Goodfellow, M., Eds., Nucleic Acid Techniques in Bacterial Systematics, John Wiley and Sons, Chichester, 115-175.</mixed-citation></ref><ref id="scirp.84573-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Quinn, C.E., Sells, I.A. and Graham, D.C. (1980) Soft Rot Erwinia Bacteria in the Atmospheric Bacterial Aerosol. The Journal of Applied Bacteriology, 49, 175-181.https://doi.org/10.1111/j.1365-2672.1980.tb01055.x</mixed-citation></ref><ref id="scirp.84573-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Krid, S., Rhouma, A., Quesada, J., Penylaver, R. and Gargouri, A. (2009) Delineation of Pseudomonas savastanoi pv savastanoi Strains Isolated in Tunisia by Random-Amplified Polymorphic DNA Analysis. Journal of Applied Microbiology, 106, 886-894. https://doi.org/10.1111/j.1365-2672.2008.04058.x</mixed-citation></ref></ref-list></back></article>