1. Introduction

AiM

Advances in Microbiology

2165-3402

Scientific Research Publishing

10.4236/aim.2018.84017

AiM-84071

Articles

Biomedical&Life Sciences

Insertion Sequence-Dependent OmpK36 Mutation Associated Ertapenem Resistance in Clinical Klebsiella pneumoniae

Jen-Jain

Lee

¹^*Yi-Ching

Huang

²Yuting

Hsiao

³Chi-Han

Lee

⁴Chuan-Shee

Liu

¹Chishih

Chu

⁴

Department of Microbiology, Immunology, and Biopharmaceutics, National Chiayi University, Taiwan

Yuan’s General Hospital, Taiwan

Medical Laboratory Division, Chiayi Branch, Taichung Veterans General Hospital, Taiwan

Division of Infectious Diseases, Chiayi Branch, Taichung Veterans General Hospital, Taiwan

* E-mail:cschu@mail.ncyu.edu.tw(JL);

27042018

080425326920, February 201823, April 2018 27, April 2018

2014

This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/

Extended-spectrum β-lactamases (ESBLs) and/or AmpC enzymes combined with deficiency of porins OmpK35 and OmpK36 are important for the development of carbapenem-resistant Klebsiella pneumoniae. We characterized the clinical K. pneumoniae human isolates and investigated the effect of meropenem induction on the ompK35 and ompK36 mutation to develop carbapenem resistance from six carbapenem-susceptible ESBL-producing K. pneumoniae strains. 163 clinical K. pneumoniae isolates were grouped mostly into the ESBL + AmpC (44.2%) and ESBL (42.9%) phenotypes. The resistance rate differed between cephalosporins (52.1% for cefepime - 97.5% for cefotaxime) and carbapenems (16% for meropenem - 28.2% for imipenem) (P < 0.001). The ESBL group showed the lowest resistance to cefoxitin and cefepime and all carbapenems, whereas the AmpC group exhibited the lowest resistance to cefepime and the highest resistance to all carbapenems. PCR amplification identified bla _TEM, bla _SHV, bla _CTX-M-3-like, and bla _{CTX-M-14-like} of AmpA β-lactamase genes and bla _DHA and bla _CMY of AmpC β-lactamase genes. Compared to all 163 clinical isolates, the 56 carbapenem-resistant isolates carried less frequently of bla _TEM, bla _CTXM-14-like, and bla _CTXM-3-like and more frequently of bla _DHA-1 and bla _CMY-2. The carbapenem-resistant isolates differed in prevalence against imipenem, ertapenem, and meropenem and lacked OmpK35 more frequently than OmpK36, but abnormal PCR amplicons were detected fewer in the Omp K35-deficient group than in the OmpK36-deficient group (32.5% vs. 68.4%, respectively). The carbapenem-resistant isolate mostly carried bla _DHA (91.1%) and three isolates carried bla _KPC-2. Following induction with meropenem insertion sequences in ompK36, not ompK36, were identified as IS5 for KP08, IS1 for KP15, and IS903 for KP16 isolates. OmpK36 deficiency increased resistance to ertapenem, but not imipenem and meropenem. Clinical isolates belonged mainly to ESBL + AmpC group and ESBL group with difference in resistance to cephalosporins and carbapenems, the bla genes. Carbapenem resistant isolates lacked OmpK35 expression, than the OmpK36 expression, Meropenem induction developed the carbapenem resistant isolates with insertion of different insertion sequences in ompK36, not ompK35.

Klebsiella Pneumoniae Carbapenem ESBL AmpC Outer-Membrane Protein Insertion Sequences

1. Introduction

The community-associated Klebsiella pneumoniae has gradually increased [1] and caused liver abscesses in diabetic patients [2] . The use of cephalosporin to treat K. pneumoniae infections stimulates mutations in cephalosprinase genes to become extended spectrum-lactamase (ESBL)-producing bacteria [3] . Therefore, carbapenems: Imipenem, meropenem, ertapenem, and doripenem are alternative drugs to treat ESBL-producing bacterial infections [4] . Emerging cabapenem resistant K. pneumoniae (KPC) increases mortality and is difficult to treat [5] [6] [7] .

The mechanism of carbapenem resistance involves mutations in penicillin-binding proteins (PBPs) to prevent carbapenem binding [8] . The incorporation of carbapenases as NDM-1 carbapenemase can be through plasmid transfer. [9] [10] [11] [12] . The insertion or point mutations of outer membrane genes in ESBL- and/or AmpC-producing isolates to halt the entrance of carbapenem. The insertion sequences IS1 or IS10 in ompK35 [13] [14] and IS1, IS4, IS5, IS10, and IS903 in ompK36 are often acquired to develop carbapenem resistance [10] [15] [13] [14] [16] [17] . We previously reported that carbapenem usage is strongly associated with the development of carbapenem resistance in K. pneumoniae [18] .

The aim of this study was to investigate the effect of low-dosage meropenem treatment on the induction of carbapenem resistance in five carbapenem-susceptible K. pneumoniae strains with ESBL production with expression of OmpK35 and OmpK36 and one isolate without Ompk35 expression.

2. Materials and Methods2.1. Bacterial Collection and Identification

163 K. pneumoniae isolates were collected from the Chiayi Branch of Taichung Veterinary Hospital and identified by biochemical methods using the GDN ID-8 Kit (Bio Star, Taiwan) and PCR identification of 16S rDNA sequences [19] . This research was approved by the IRB of Taichung Veterans General Hospital (CE12034 and SE13132).

2.2. Antimicrobial Susceptibility Testing

Resistance to β-lactam antimicrobials, including ampicillin, cefoxitin (FOX), ceftriaxone (CRO), ceftazidime (CAZ), cefotaxime (CTX), and cefepime (FEP) of cephalosporins, as well as ertapenem (ETP), meropenem (MEM), and imipenem (IMP) of carbapenems, were tested using the disc diffusion method (Becton, Dickinson and Company, USA) and the guidelines of the Clinical and Laboratory Standard Institute [20] . Escherichia coli ATCC 25922 was used as a control. The minimal inhibitory concentration (MIC) was determined by the Etest and the broth microdilution method.

2.3. Determination of ESBL, AmpC Enzyme and Carbapenase

ESBL isolates were identified by the differences in diameter of the inhibition zones between cefotaxime and cefotaxime/clavulanic acid or between ceftazidime and ceftazidime/clavulanic acid. Active AmpC enzyme was identified using disks with 300 µg of 3-aminophenylboronic acid and carbapenemase production was detected by the Modified Hodge Test (MHT) based on the Centers for Disease Control and Prevention guidelines [21] .

2.4. PCR Detection of bla Genes, omp35 and omp36, and Insertion Sequences

PCR amplification of AmpA bla_TEM, bla_SHV, bla_CTX-M-3, bla_CTX-M-14 and bla_KPC-1 [22] [23] [24] , AmpC bla_CMY-2 and bla_DHA [25] , carbapenem resistance genes, MBLs bla_VIM, bla_IMP, bla_SPM, bla_SIM, bla_GIM, bla_KHM, and bla_NDM, as well as outer membrane genes omp35 and omp36, and insertion sequences IS1, IS5, and IS903 were performed using the primers listed in Table 1.

2.5. Sequence Analysis

PCR products were purified using a DNA purification kit (ProTECH, Taiwan) and sequenced. DNA sequences were aligned and compared using Lasergene v7.1 software (DNASTAR Inc, USA) and the BLAST program of the National Center for Biotechnology Information.

2.6. Outer Membrane Protein Analysis of Carbapenem-Resistant Isolates Induced by Meropenem

ESBL-producing isolates KP07, KP08, KP10, KP13, KP15 and KP16 were used. Except that isolate KP15 lacked OMPK15 due to a deletion in the promoter region of ompK35, all isolates carried normal PCR size and protein expression of ompK35 and ompK36. These bacteria were cultured firstly in Muller-Hinton

Table 1 Primer sequences and PCR conditions

Target	Primer sequence (5’ to 3’)		TA^a (˚C)	Size (bp)
Multiplex PCR
bla_TEM	F	GAAGATCAGTTGGGTGCACGAGT	59	520
bla_TEM	R	CAACTTTATCCGCCTCCATCCAGT	59	520
bla_SHV	F	AACGGAACTGAATGAGGCGCT	59	141
bla_SHV	R	TCCACCATCCACTGCAGCAGCT	59	141
bla_CTX-M-3	F	AATCACTGCGCCAGTTCACGCT	59	479
bla_CTX-M-3	R	GAACGTTTCGTCTCCCAGCTGT	59	479
bla_CTX-M-14	F	TACCGCAGATAATACGCAGGTG	59	355
bla_CTX-M-14	R	CAGCGTAGGTTCAGTGCGATCC	59	355
bla_DHA	F	AACTTTCACAGGTGTGCTGGGT	59	405
bla_DHA	R	CCGTACGCATACTGGCTTTGC	59	405
bla_VIM	F	GTTTGGTCGCATATCGCAAC	57	147
bla_VIM	R	CTTYTCAATCTCCGCGAGAAG	57	147
bla_IPM-1	F	GGAATAGAGTGGCTTAATTCTCAATC	57	272
bla_IPM-1	R	GCTTCTAAATTTGCGTCACCC	57	272
bla_IPM-2	R	GYAACCAAACCACTACGTTATCT	57	193
bla_SPM	F	ATGAACTCACCTAAATCGAGAGC	57	340
bla_SPM	R	GTGCCGTCCAAATGAAAGTG	57	340
bla_SIM	F	GGCTTAGTAGTTCTTGACAATCAC	57	516
bla_SIM	R	CAATAGTGATGCGTCTCCGA	57	516
bla_GIM	F	TGTAGCGTTGCCAGCTTTAG	57	431
bla_GIM	R	CAGCACCTGGATAGTAGAGC	57	431
bla_KHM	F	CGTTTGGTCTGCTGTTGTTTAC	57	322
bla_KHM	R	GGAATGGACTTGGAGTTGAGAA	57	322
bla_NDM	F	ACTTATGCCAATGCGTTGTC	57	225
bla_NDM	R	TCTGTCCTTGATCAGGCAG	57	225
Single PCR
KP16S	F	AGCACAGAGAGCTTG	50	126
KP16S	R	ACTTTGGTCTTGCGAC	50	126
bla_CMY-2	F	CTGACAGCCTCTTTCTCCACA	56	1005
	R	CTACGTAGCTGCCAAATCCAC
bla_KPC	F	TGTCACTGTATCGCCGTC	54	1000
bla_KPC	R	CTCAGTGCTCTACAGAAAACC	54	1000
OmpK35	F	TGATCCCTGCCCTGCTGGT	56	717
OmpK35	R	CCGGAGTCATGTTGTAAGTCT	56	717

OmpK36	F	ACAGAGGGTTAATAACATGAA	51	1112
OmpK36	R	TAGAACTGGTAAACCAGGC	51	1112
OmpK35-FL1	F	GTTACGCACTGTTTCGG	52	1572
OmpK35-FL1	R	GGTGTACTGCAGATTAGAAC	52	1572
OmpK36-FL	F	GCAGCACAATGAAATAGCC	53	1265
OmpK36-FL	R	GACAAGAGTATACCAGCGAG	53	1265
OmpK35-Pro	F	GTTACGCACTGTTTCGG	52	502
OmpK35-Pro	R	CCAGAATATTGCGCTTCATC	52	502
OmpK35-Ter	F	CCAGACTTACAACATGACTC	51	349
OmpK35-Ter	R	GGTGTACTGCAGATTAGAAC	51	349
IS1	F	TGACTCCAACTTATTGATAGTGT	46	997
IS1	R	CATGAATGGCGTTGGATG	46	997
IS5	F	TATTTCCGGTTTTTACTGAGA	51	529
IS5	R	CATCATGAGCCATCAACTC	51	529
IS903	F	CTTTTGCTGAGTTGAAGGA	51	987
IS903	R	TGTGTTTTCAGGCAATACG	51	987

^aTA: annealing temperature.

Broth (MHB) containing 0.1 μg/ml meropenem for 16 hours at 100 rpm, followed by subculture in MHB supplemented with 0.5 μg/ml, 1 μg/ml, and 2 μg/ml meropenem, subsequently. The bacterial solution was plated onto Muller-Hinton Agar (MHA), and meropenem discs were plated thereafter. Colonies in the inhibition zone were selected, and outer membrane proteins were analyzed using a previously described method [26] . Proteins were separated by 12% SDS-PAGE at 100 V, 100 mA, and 400 W. Protein profiles were recorded and analyzed using ImageJ software (National Institutes of Health, USA).

2.7. Statistical Analysis

Duncan’s multiple range test and SPSS software (version 18, Chicago, IL, USA) were used to analyze differences among groups.

3. Results3.1. Antimicrobial Resistance and Prevalence of AmpA and AmpC Genes in ESBL and AmpC Phenotypes

The 163 isolates were separated into four phenotypic groups: the ESBL + AmpC group (44.2%), the ESBL group (42.9%), the AmpC group (7.4%), and neither group (5.5%). The prevalence was 87.1% (142 isolates) for ESBL-producing isolates, and 50.3% (82 isolates) for AmpC isolates, with the different resistance patterns among the ESBL and AmpC phenotypes (Table 2). The resistance rate differed between cephalosporins (52.1% for cefepime - 97.5% for cefotaxime)

Table 2 Resistance to cephalosporins and carbapenems and AmpA and AmpC genes in different ESBL and AmpC pnenotypes of clinical K. pneumonia

Characters	ESBL and AmpC phenotypes
Characters	ESBLs + AmpC	ESBLs	AmpC	Neither	Total
Number	72	70	12	9	163
Resistance to cephalosporins
cefoxitin	68 (94.4)^a,x	18 (25.7)^c,z	11 (91.7)^a,x	6 (66.7)^b,x	103 (63.2)
ceftriaxone	71 (98.6)^a,x	69 (98.6)^a,x	7 (58.3)^b,y	1 (11.1)^c,y	148 (90.8)
ceftazidime	71 (98.6)^a,x	63 (90.0)^a,x	11 (91.7)^a,x	5 (55.6)^b,x	150 (92.0)
cefotaxime	71 (98.6)^a,x	69 (98.6)^a,x	12 (100.0)^a,x	7 (77.8)^b,x	159 (97.5)
cefepime	41 (56.9)^a,y	41 (58.6)^a,y	2 (16.7)^b,z	1 (11.1)^b,y	85 (52.1)
Resistance to carbapenem
Imipenem	33 (45.8)^a,x	3 (4.3)^b	7 (58.3)^a	3 (33.3)^a	46 (28.2)
Meropenem	16 (22.2)^b,y	3 (4.3)^b	6 (50.0)^a	1 (11.1)^b	26 (16.0)
Ertapenem	26 (36.1)^b,xy	4 (5.7)^c	8 (66.7)^a	2 (22.2)	40 (24.5)
AmpA genes
bla_SHV	72 (100.0)	70 (100.0)	12 (100.0)	9 (100.0)	163 (100)
bla_TEM	60 (83.3)	53 (75.7)	9 (75.0)	1 (11.1)	123 (75.5)
bla_CTX-M3	6 (8.3)	13 (18.6)	0 (0.0)	0 (0.0)	19 (11.7)
bla_CTX-M14	31 (43.1)	25 (35.7)	0 (0.0)	0 (0.0)	56 (34.4)
AmpC genes
bla_DHA	67 (93.1)	13 (18.6)	9 (75.0)	4 (44.4)	93 (57.1)
bla_CMY2	7 (9.7)	3 (4.3)	3 (25.0)	0 (0.0)	13 (8.0)

^a-dDifferent letters indicate significant difference between different ESBL and AmpC types, and ^x-zDifferent letters indicate significant difference between antibiotics in each ESBL and AmpC phenotypes, P < 0.05.

and carbapenems (16% for meropenem - 28.2% for imipenem) (P < 0.001). The ESBL + AmpC group with respect to resistance revealed no differences among ceftriaxone, cefotaxime, and cefoxitin as well as lower resistance to cefepime in cephalosporins and the highest resistance for imipenem, followed by ertapenem and r meropenem in carbapenem. The ESBL group showed the lowest resistance to cefoxitin and cefepime and all carbapenems, whereas the AmpC group exhibited the lowest resistance to cefepime and the highest resistance to all carbapenems. Nine isolates of the none group differed in resistance to cephalosporin, but some were resistant to carbapenems.

PCR amplification identified bla_TEM, bla_SHV, bla_CTX-M-3-like, and bla_{CTX-M-14-like} of AmpA β-lactamase genes and bla_DHA and bla_CMY of AmpC β-lactamase genes (Table 2). The prevalent AmpA genes were bla_SHV (100%), bla_TEM (75.5%), bla_CTXM-14-like (34.4%), and bla_CTXM3-like (11.7%), and were mostly detected in ESBL-producing isolates. While bla_CMY-2 (8.0%) was lower in the AmpC gene, bla_DHA-1 (57.1%) was the more prevalent with the highest prevalence in the ESBLs + AmpC group (93.1%), followed by the AmpC group (75%), none group (44.4%) and ESBL group (18.6%).

3.2. Characterization of the 56 Carbapenem Resistant Isolates

Of the 56 carbapenem-resistant isolates, 42.9% of the isolates were resistance to all three carbapenems and one carbapenem, respectively, while 14.3% isolates were resistant to two carbapenems (Table 3). The highest carbapenem resistance was observed in the ESBL + AmpC group (71.4%), which exhibited the highest prevalence in the isolates with single resistance to imipenem (87.5%, ertapenem (75.0%), and the AmpC group (14.3%), which showed the highest rate of resistance to all three carbapenems (25%). Although no PCR products were detected

Table 3 Characterization of 56 clinical carbapenem resistant K. pneumoniae

Characters	Carbapenem resistant patterns								Total [No, (%)]
Imipenem	R	R	I	R	R	R	I	I	46 (82.1)
Meropenem	R	I	R	I	I	S	I	S	26 (46.4)
Ertapenem	R	R	R	I	S	S	R	R	40 (71.4)
No.	24	6	2	16			8		56
ESBL and AmpC phenotypes [No, (%)]
ESBL + AmpC	15 (62.5)	4 (66.7)	1 (50.0)	14 (87.5)			6 (75.0)		40 (71.4)
ESBLs	2 (8.3)	0 (0.0)	1 (50.0)	1 (6.3)			1 (12.5)		5 (8.9)
AmpC	6 (25.0)	1 (16.6)	0 (0.0)	0 (0.0)			1 (12.5)		8 (14.3)
Neither	1 (4.2)	1 (16.6)	0 (0.0)	1 (6.3)			0 (0.0)		3 (5.4)
AmpA gnes [No, (%)]
bla^TEM	14 (58.3)	5 (83.3)	1 (50.0)	8 (72.7)	3 (100.0)	2 (100.0)	5 (71.4)	1 (100.0)	39 (69.6)
bla^CTX-M3	0 (0.0)	1 (16.7)	1 (50.0)	1 (9.1)	0 (0.0)	0 (0.0)	1 (14.3)	0 (0.0)	4 (7.1)
bla^CTX-M14	6 (25.0)	2 (33.3)	0 (0.0)	4 (36.4)	0 (0.0)	0 (0.0)	3 (42.9)	1 (100.0)	16 (28.6)
AmpC genes [No, (%)]
bla^DHA	20 (83.3)	6 (100.0)	1 (50.0)	11 (100.0)	3 (100.0)	2 (100.0)	7 (100.0)	1 (100.0)	51 (91.1)
bla^CMY2	5 (20.8)	1 (16.7)	0 (0.0)	0 (0.0)	0 (0.0)	0 (0.0)	4 (57.1)	0 (0.0)	10 (17.9)
ESBL and AmpC phenotype	Outmembrane protein deficiency
ESBL and AmpC phenotype	OmpK35		OmpK36		OmpK35 + OmpK36			Normal	Total
ESBL + AmpC	27 (67.5)		0 (0.0)		6 (15.0)			7 (17.5)	40 (55.6)
ESBLs	3 (60.0)		0 (0.0)		2 (40.0)			0 (0.0)	5 (7.1)
AmpC	4 (50.0)		0 (0.0)		4 (50.0)			0 (0.0)	8 (66.7)
No	2 (66.7)		0 (0.0)		0 (0.0)			1 (33.3)	3 (33.3)
Total	36 (64.3)		0 (0.0)		12 (21.4)			8 (14.3)	56 (34.4)

for bla_VIM, bla_IPM-1-like, bla_IPM-2-like, bla_SPM, bla_SIM, bla_GIM, and bla_KHM, of the AmpB β-lactamase genes bla_KPC were identified in three isolates (Supplementary Figure 1).

Compared to all clinical isolates, the carbapenem-resistant isolates carried less frequently of bla_TEM (69.6% vs. 75.5%), bla_CTXM-14-like (28.6% vs. 34.4%), and bla_CTXM-3-like (7.1% vs. 11.7%) of AmpA genes and more frequently of bla_DHA-1 (91.1% vs. 57.1%) and bla_CMY-2 (17.9% vs. 8%) of AmpC genes_, Eight isolates expressed both OmpK35 and OmpK36, 36 isolates lacked OmpK35 individually and 12 isolates lacked both OmpK35 and OmpK36; however, no isolate with single deficiency in OmpK36 was observed. These results may imply that deficiency in OmpK35 and OmpK36 may partly contribute to carbapenem resistance. PCR detected the abnormal ompK35 and ompK36 that differed among ESBL and/or AmpC phenotypes. Among 56 carbapenem-resistant isolates, abnormal PCR products were found in 29.3% (14/48) and 75.0% (9/12) of isolates with no OmpK35 and OmpK36 expression, respectively (Table 3). Sequence analysis of 14 abnormal PCR products of ompK35 revealed that one isolate contained the IS903 insertion at + 4 bp, while eight isolates contained the IS10 insertion from + 744 bp to + 1093 bp. PCR products were not detected in five isolates.

3.3. Analysis of Outer Membrane Protein Expression

K. pneumoniae ATCC 13883 was used as a control in NB broth with or without 20% sorbitol to evaluate the expression of OmpA, OmpK35 and OmpK36. Deficiency in OmpK35, OmpK36 and OmpK35/OmpK36 was observed separately in 69.4%, 1.4% and 8.3% of isolates in the ESBL + AmpC group, 60.0%, 5.7% and 2.9% of isolates in the ESBL group, 50.0%, 8.3% and 33.3% of isolates in the AmpC group, and 33.3%, 0% and 11.1% of isolates in the neither group. The analysis of 15 ESBL- and non-ESBL-producing isolates revealed that ESBL-producing I solate 92 with the AmpC phenotype and bla_DHA-1 and deficiency in OmpK35 and OmpK36 i exhibited the highest MIC against ertapenem and imipenem, whereas non-ESBL producing isolates 110 and 114 with the AmpC

phenotype and both bla_DHA-1 and bla_CMY-2 and deficiency in OmpK35 and OmpK36 exhibited the highest MIC against all three carbapenems (Table 4).

3.4. Meropenem-Induced Carbapenem Resistance Is Associated with the Insertion Sequence and Antimicrobial Variations

ESBL-producing isolates KP07, KP08, KP10, KP13, KP15 and KP16 exhibited intermediate susceptibility to carbapenem (isolates KP07, KP08, KP10 and KP16 contain bla_TEM, and isolates KP10 and KP16 contain bla_CTX-M-14 and bla_CMY). With the exception of isolate KP15 with a deletion in the promoter region of ompK35 and no OmpK35 expression normal PCR products and expression of ompK35 and ompK36 and were generated from other isolates. In total, 119 isolates were collected from KP07 (9), KP08 (17), KP10 (3), KP13 (36), KP15 (9) and KP16 (45). Only six isolates generated abnormal PCR products: KP08-1, KP08-2, KP08-12 and KP08-15 from KP08; KP15-4 from KP15; and KP16-22 from KP16. Although PCR analysis revealed three insertion sequences IS1, IS5, and IS903 present in all six isolates, only one insertion sequence was found in the ompK36 gene at different locations for each mutant isolate. Sequence analysis of ompK36 PCR products revealed an IS5 insertion at −48 bp in KP08-1 and KP08-12, at

Table 4 Characteristic of ESBL- and non-ESBL-producing clinical isolates with insertion in ompK35 and ompK36

	ESBL		Strain	β-lactamase			Carbapenem									Outer membrane
	ESBL		Strain	AmpA	AmpC		ETP		MIC		MEM		MIC	IMP	MIC	ompK35	ompK36
+		2		TEM, SHV	DHA	S		0.19		S		0.047		S	0.38	Inserted
		13		SHV	-	S		0.094		S		0.064		S	0.19		Inserted
		55		TEM, SHV, CTXM14	-	S		0.094		S		0.016		S	0.19	Inserted
		58		SHV	-	S		0.006		S		0.032		S	0.25		Inserted
		67		TEM, SHV	-	S		0.064		S		0.016		S	0.094	Inserted
		87		SHV	-	S		0.023		S		0.032		S	0.25	Inserted
		92		SHV	DHA	R		16		I		2		R	6	Inserted	Inserted
		96		TEM, SHV, CTXM14	DHA	R		16		I		2		R	4		Inserted
		98		SHV	-	S		0.064		S		0.023		S	0.19	Inserted
−		60		SHV	DHA	S		0.25		S		0.032		S	0.75	Inserted
		79		SHV	-	S		0.012		S		0.023		S	0.125		Inserted
		100		TEM, SHV	DHA	S		0.19		S		0.023		S	0.25	Inserted
		110		SHV	CMY-2, DHA	R		>32		R		12		R	>32	Inserted	Inserted
		114		TEM, SHV	CMY-2, DHA	R		>32		R		4		R	12	Inserted	Inserted
		119		TEM, SHV	CMY-2, DHA	R		4		S		0.5		I	2		Inserted

+433 bp in KP08-2, and at 78 bp in KP08-15. Additionally, an IS1 insertion at −74 bp was discovered in KP15-4, as was an IS903 insertion at +910 bp (Table 5).

Although no isolates altered antimicrobial resistance genes, the MIC value increased the highest against ertapenem, followed by meropenem and imipenem. Exception of KP08-15 with IS5 insertion in 5’-end ompK36, all KP08 derivatives were resistant to ertapenem and exhibited reduced susceptibility to meropenem and imipenem (Table 5). Such antimicrobial susceptibility was also confirmed by the disc diffusion method. For the ompK36 mutation-associated change in susceptibility to cephalosporins, all mutant isolates exhibited a reduced inhibition zone compared to the parental isolates. Importantly, isolates KP08-2 and KP15-4 developed resistance to cefepime, Instead, KP08-1, KP08-12, KP08-15 and KP16-22 developed an intermediate phenotype.

4. Discussion

The prevalence of ESBL-producing K. pneumoniae differs among regions and sources in Taiwan: increasing from 3.4% - 10.3% in 1995 to 11.3% in 2000 [27] [28] , 20.9% in 2007 [29] , 40.5% in 2010-2012 [30] , 69.7% in 2006-2007 [31] and

Table 5 Insertion in OmpK36MIC and diameter of inhibition zone of carbapenem in clinical and carbapenem-induced resistance isolates

Characters	Item	Strain
Characters	Item	KP08	KP08-1	KP08-2	KP08-12	KP08-15	KP15	KP15-4	KP16	KP16-22
ompK36	IS family	−	IS5	IS5	IS5	IS5	−	IS1	−	IS903
	Location	−	−48 bp	433 bp	−48 bp	78 bp	−	−74 bp	−	910 bp
	Target sequence		TAAG	CTAA	AAAG	ATAA		GCCGACTG		GTAAGGATC
MIC (μg/ml)	Ertapenem	0.023	2 (R)	4 (R)	2 (R)	1.5 (R)	0.047	2 (R)	0.094	6 (R)
	ratio	1	87.0	173.9	87.0	65.2	1	42.6	1	63.8
	Meropenem	0.023	0.38 (S)	1 (S)	0.5 (S)	0.38 (S)	0.023	0.5 (S)	0.047	0.75(S)
	ratio	1	16.5	43.5	21.7	16.5	1	21.7	1	16.0
	Imipenem	0.19	0.38 (S)	0.75(S)	0.38(S)	0.38 (S)	0.125	0.25 (S)	0.38	2 or 3(I)
	ratio	1	2	3.9	2	2	1	2	1	7.9
Zome (mm)	Ertapenem	28	17	13	18	18	26	14	26	14
	Meropenem	28	22	19	22	21	25	18	25	19
	Imipenem	28	26	25	25	27	26	23	24	20
	Cefepime	25	15	13	16	17	15	9	20	15
	Ceftriazone	15	10	9	11	12	10	6	12	10
	Ceftazidime	11	8	6	9	9	6	6	8	6
	Cefotaxime	18	11	10	12	14	11	6	14	11
	Cefoxitin	23	13	12	13	12	14	6	9	6

87.1% in the current study (Table 2). The addition of 3-aminophenylboronic acid can enhance the accuracy to determine the ESBL-producing and the AmpC phenotypes [32] [33] . In our study, 50.7% of ESBL-producing isolates carried AmpC enzymes, which is higher than that reported previously (35.3%) (Table 2) [30] Furthermore, the prevalence differed between the carbapenem-resistant isolates and the total clinical isolates, with a low prevalence of AmpA genes and a high prevalence of AmpC genes (especially bla_DHA-1, 91.1%) in the carbapenem-resistant isolates (Table 2 and Table 3). For the bla_DHA and bla_CMY genes of the AmpC enzyme, bla_CMY can be located on a chromosome with a nonsense mutation or in a plasmid to reduce the susceptibility to third-generation cephalosporins [34] , while bla_DHA can increase resistance to cefoxitin (Table 4) [35] [36] . In our study, ESBL-producing isolates and AmpC enzyme-producing isolates exhibited different resistance patterns with higher resistance rate to ceftriaxone and cefepime vs. higher resistance rates to ceftazidime and cefoxitin, respectively (Table 2). Regardless of whether the isolate was ESBL- or non-ESBL-producing, the carbapenem-resistant isolates carried bla_DHA-1 and an insertion in both ompK35 and ompK36 genes, exhibiting the highest MIC to carbapenems (Table 4). These results indicate that porin loss and the presence of bla_DHA-1 are important for carbapenem resistance. However, we also observed carbapenem-resistant isolates without the ESBL and AmpC phenotypes, indicating the involvement of other mechanisms for carbapenem resistance.

Carbapenem-resistant ESBL-producing isolates are gradually increasing annually due to the use of meropenem and ertapenem for the treatment of ESBL-producing bacterial infections [29] . In recent years, carbapenem-resistant isolates have increased from 1.2% in 2003 to 11.9% in 2011³⁷ and have reached 13.5% against ertapenem.¹⁵ The bla_KPC-carrying K. pneumoniae belonged to ST11 being the major clone in Taiwan [37] [38] . and worldwide [39] [40] [41] . In the present study, only three isolates carried bla_KPC. Furthermore, carbapenem resistance can be developed by isolates with the ESBL-type bla_SHV or bla_CTX-M and/or AmpC enzymes in combination with deficiency of outer membrane proteins OmpK35 and OmpK36 [42] [43] . Here, we observed one isolate with bla_SHV and bla_CTX-M14-like with no OmpK35 and OmpK36 expression, 13 isolates with bla_SHV and bla_CTX-M14-like with OmpK35 loss, and two isolates with bla_SHV and bla_CTX-M3-like with OmpK35 loss.

In K. pneumoniae, porins OmpK35 and OmpK36 play multiple roles in the development of antibiotic resistance and virulence. Isolates with deficiency in both OmpK35 and OmpK36 showed a significant decrease in virulence (i.e., a slower growth rate), an increase of susceptibility to neutrophil phagocytosis [44] and a significant decrease in proinflammatory cytokine levels [45] . Further, the loss of OmpK35 is associated with resistance to lipophilic (benzylpenicillin) and large (cefepime) compounds [46] . In contrast to ompK35 deletion, ompK36 deletion caused an increased resistance to cefoxitin and cefepine associated with bla gene [47] . Additionally, the deletion of both ompK35 and ompK36 led to 8- and 16-fold increases in the MICs of meropenem and cefepime, respectively. Although imipenem resistance is not directly associated with porin OmpK35/36 loss combined with ESBL production [48] . ertapenem resistance can be acquired by the loss of OmpK35/36 alone or the loss of a single porin combined with bla_CTX-M-15 or bla_DHA-1 expression [47] .

Altered susceptibility to carbapenem is associated with carbapenem type, insertion sequence type, insertion location, and the MIC of the parental strain (Table 5). A previous study reported that the insertion sequences IS1, IS5, IS10, and IS903 insert into the promoter and coding regions of ompK35 and ompK36 (Supplementary Table 1). Imipenem-resistant isolates containing bla_SHV-12 and bla_DHA-1 are obtained from IS5 insertion in ompK36 from Korea and Taiwan [15] [49] . IS26, IS5, IS903, and IS1 insertion in ompK36 increases resistance to cefoxitin [50] . Following meropenem induction, all isolates with an insertion sequence in ompK36 exhibited reduced susceptibility to imipenem (2- to 7.9-fold increase) and meropenem (16- to 43.5-fold increase) and increased resistance to ertapenem (42.6- to 173.9-fold increase) (Table 5), suggesting that only OmpK36 is responsible for ertapenem resistance due to its small molecular weight. Despite the presence of IS1, IS5, and IS903 in all isolates, only KP08, KP15, and KP16 developed ertapenem resistance from a single insertion sequence in each ertapenem-resistant strain. These results imply a strain-dependent activation of the insertion sequence. Furthermore, the MIC levels of ertapenem and the inhibition zone of cephalosporins are associated with the insertion type and site.

5. Conclusion

In clinical isolates, ESBL or AmpC-producing isolates associated with carbapenem resistance were more common with deficiency in OmpK35, not OmpK36. The isolate dependent IS1, IS5, and IS903 were able to insert into ompK36 to cause resistance to ertapenem and reduced susceptibility to imipenem and carbapenem.

Acknowledgements

The authors would like to acknowledge funding of the Chiayi Branch, Taichung Veterans General Hospital (RVHCY101013 and RVHCY102003), Taiwan.

Cite this paper

Lee, J.-J., Huang, Y.-C., Hsiao, Y., Lee, C.-H., Liu, C.-S. and Chu, C. (2018) Insertion Sequence-Dependent OmpK36 Mutation Associated Ertapenem Resistance in Clinical Klebsiella pneumoniae. Advances in Microbiology, 8, 253-269. https://doi.org/10.4236/aim.2018.84017

References1

Fang, C.T., Lai, S.Y., Yi, W.C., Hsueh, P.R., Liu, K.L. and Chang, S.C. (2007) Klebsiella pneumoniae Genotype K1: An Emerging Pathogen That Causes Septic Ocular or Central Nervous System Complications from Pyogenic Liver Abscess. Clinical Infectious Diseases, 45, 284-293. https://doi.org/10.1086/519262

Chang, S.C., Fang, C.T., Hsueh, P.R., Chen, Y.C. and Luh, K.T. (2000) Klebsiella pneumoniae Isolates Causing Liver Abscess in Taiwan. Diagnostic Microbiology and Infectious Disease, 37, 279-284. https://doi.org/10.1016/S0732-8893(00)00157-7

Paterson, D.L., Ko, W.C., Von Gottberg, A., Mohapatra, S., Casellas, J.M., Goossens, H., Trenholme, G., Klugman, K.P., Bonomo, R.A., Rice, L.B., Wagener, M.M., McCormack, J.G. and Yu, V.L. (2004) Antibiotic Therapy for Klebsiella pneumoniae Bacteremia: Implications of Production of Extended-Spectrum Beta-Lactamases. Clinical Infectious Disease, 39, 31-37. https://doi.org/10.1086/420816

Perrott, J., Mabasa, V.H. and Ensom, M.H. (2010) Comparing Outcomes of Meropenem Administration Strategies Based on Pharmacokinetic and Pharmacodynamic Principles: A Qualitative Systematic Review. The Annals of Pharmacotherapy, 44, 557-564. https://doi.org/10.1345/aph.1M339

Patel, G., Huprikar, S., Factor, S.H., Jenkins, S.G. and Calfee, D.P. (2008) Outcomes of Carbapenem-Resistant Klebsiella pneumoniae Infection and the Impact of Antimicrobial and Adjunctive Therapies. Infection Control and Hospital Epidemiology, 29, 1099-1106. https://doi.org/10.1086/592412

Hirsch, E.B. and Tam, V.H. (2010) Detection and Treatment Options for Klebsiella pneumoniae carbapenemases (KPCs): An Emerging Cause of Multidrug-Resistant Infection. The Journal of Antimicrobial Chemotherapy, 65, 1119-1125. https://doi.org/10.1093/jac/dkq108

Ben-David, D., Kordevani, R., Keller, N., Tal, I., Marzel, A., Gal-Mor, O., Maor, Y. and Rahav, G. (2012) Outcome of Carbapenem Resistant Klebsiella pneumoniae Bloodstream Infections. Clinical Microbiology and Infection, 18, 54-60. https://doi.org/10.1111/j.1469-0691.2011.03478.x

Papp-Wallace, K.M., Endimiani, A., Taracila, M.A. and Bonomo, R.A. (2011) Carbapenems: Past, Present, and Future. Antimicrobial Agents and Chemotherapy, 55, 4943-4960. https://doi.org/10.1128/AAC.00296-11

Gupta, V., Bansal, N., Singla, N. and Chander, J. (2013) Occurrence and Phenotypic Detection of Class A Carbapenemases among Escherichia coli and Klebsiella pneumoniae Blood Isolates at a Tertiary Care Center. Journal of Microbiology, Immunology, and Infection, 46, 104-108. https://doi.org/10.1016/j.jmii.2012.01.004

Shoma, S., Kamruzzaman, M., Ginn, A.N., Iredell, J.R. and Partridge, S.R. (2014) Characterization of Multidrug-Resistant Klebsiella pneumoniae from Australia Carrying blaNDM-1. Diagnostic Microbiology and Infectious Disease, 78, 93-97. https://doi.org/10.1016/j.diagmicrobio.2013.08.001

Karampatakis, T., Antachopoulos, C., Iosifidis, E., Tsakris, A. and Roilides, E. (2016) Molecular Epidemiology of Carbapenem-Resistant Klebsiella pneumoniae in Greece. Future Microbiology, 11, 809-823. https://doi.org/10.2217/fmb-2016-0042

Vubil, D., Figueiredo, R., Reis, T., Canha, C., Boaventura, L. and Silva, D.A. (2017) Outbreak of KPC-3-Producing ST15 and ST348 Klebsiella pneumoniae in a Portuguese Hospital. Epidemiology and Infection, 145, 595-599. https://doi.org/10.1017/S0950268816002442

Park, Y.J., Yu, J.K., Park, K.G., Park, Y.G., Lee, S., Kim, S.Y. and Jeong, S.H. (2011) Prevalence and Contributing Factors of Nonsusceptibility to Imipenem or Meropenem in Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae and Escherichia coli. Diagnostic Microbiology and Infectious Disease, 71, 87-89. https://doi.org/10.1016/j.diagmicrobio.2010.12.012

Wu, J.J., Wang, L.R., Liu, Y.F., Chen, H.M. and Yan, J.J. (2011) Prevalence and Characteristics of Ertapenem-Resistant Klebsiella pneumoniae Isolates in a Taiwanese University Hospital. Microbial Drug Resistance, 17, 259-266. https://doi.org/10.1089/mdr.2010.0115

Song, W., Suh, B., Choi, J.Y., Jeong, S.H., Jeon, E.H., Lee, Y.K., Hong, S.G. and Lee, K. (2009) In Vivo Selection of Carbapenem-Resistant Klebsiella pneumoniae by OmpK36 Loss during Meropenem Treatment. Diagnostic Microbiology and Infectious Disease, 65, 447-449. https://doi.org/10.1016/j.diagmicrobio.2009.08.010

Shin, S.Y., Bae, I.K., Kim, J., Jeong, S.H., Yong, D., Kim, J.M. and Lee, K. (2012) Resistance to Carbapenems in Sequence Type 11 Klebsiella pneumoniae Is Related to DHA-1 and Loss of OmpK35 and/or OmpK36. Journal of Medical Microbiology, 61, 239-245. https://doi.org/10.1099/jmm.0.037036-0

Clancy, C.J., Chen, L., Hong, J.H., Cheng, S., Hao, B., Shields, R.K., Farrell, A.N., Doi, Y., Zhao, Y., Perlin, D.S., Kreiswirth, B.N. and Nguyen, M.H. (2013) Mutations of the ompK36 Porin Gene and Promoter Impact Responses of Sequence Type 258, KPC-2-Producing Klebsiella pneumoniae Strains to Doripenem and Doripenem-Colistin. Antimicrobial Agents and Chemotherapy, 57, 5258-5265. https://doi.org/10.1128/AAC.01069-13

Lee, H.S., Loh, Y.X., Lee, J.J., Liu, C.S. and Chu, C. (2015) Antimicrobial Consumption and Resistance in Five Gram-Negative Bacterial Species in a Hospital from 2003 to 2011. Journal of Microbiology, Immunology, and Infection, 48, 647-654. https://doi.org/10.1016/j.jmii.2014.04.009

Kurupati, P., Chow, C., Kumarasinghe, G. and Poh, C.L. (2004) Rapid Detection of Klebsiella pneumoniae from Blood Culture Bottles by Real-Time PCR. Journal of Clinical Microbiology, 42, 1337-1340. https://doi.org/10.1128/JCM.42.3.1337-1340.2004

CLSI (2012) Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Second Informational Supplement. CLSI Document M100-S22, Clinical and Laboratory Standards Institute, Wayne.

CDC (2009) Modified Hodge Test for Carbapenemase Detection in Enterobacteriaceae. CDC Protocol.

Chia, J.H., Chu, C., Su, L.H., Chiu, C.H., Kuo, A.J., Sun, C.F. and Wu, T.L. (2005) Development of a Multiplex PCR and SHV Melting-Curve Mutation Detection System for Detection of Some SHV and CTX-M Beta-Lactamases of Escherichia coli, Klebsiella pneumoniae, and Enterobacter cloacae in Taiwan. Journal of Clinical Microbiology, 43, 4486-4491. https://doi.org/10.1128/JCM.43.9.4486-4491.2005

Chiou, C.S., Lin, J.M., Chiu, C.H., Chu, C.H., Chen, S.W., Chang, Y.F., Weng, B.C., Tsay, J.G., Chen, C.L., Liu, C.H. and Chu, C. (2009) Clonal Dissemination of the Multi-Drug Resistant Salmonella enterica Serovar Braenderup, But Not the Serovar Bareilly, of Prevalent Serogroup C1 Salmonella from Taiwan. BMC Microbiology, 9, 264. https://doi.org/10.1186/1471-2180-9-264

Yigit, H., Queenan, A.M., Anderson, G.J., Domenech-Sanchez, A., Biddle, J.W., Steward, C.D., Alberti, S., Bush, K. and Tenover, F.C. (2001) Novel Carbapenem-Hydrolyzing β-Lactamase, KPC-1, from a Carbapenem-Resistant Strain of Klebsiella pneumoniae. Antimicrobial Agents and Chemotherapy, 45, 1151-1161. https://doi.org/10.1128/AAC.45.4.1151-1161.2001

Perez-Perez, F.J. and Hanson, N.D. (2002) Detection of Plasmid-Mediated AmpC Beta-Lactamase Genes in Clinical Isolates by Using Multiplex PCR. Journal of Clinical Microbiology, 2153-2162. https://doi.org/10.1128/JCM.40.6.2153-2162.2002

Wu, T.L., Siu, L.K., Su, L.H., Lauderdale, T.L., Lin, F.M., Leu, H.S., Lin, T.Y. and Ho, M. (2001) Outer Membrane Protein Change Combined with Co-Existing TEM-1 and SHV-1 Beta-Lactamases Lead to False Identification of ESBL-Producing Klebsiella pneumoniae. Journal of Antimicrobial Chemotherapy, 47, 755-761. https://doi.org/10.1093/jac/47.6.755

Yan, I.S., Hsueh, P.R., Teng, L.J., Ho, S.W. and Luh, K.T. (1998) Antimicrobial Susceptibility Testing for Klebsiella pneumoniae Isolates Resistant to Extended- Spectrum Beta-Lactam Antibiotics. Journal of the Formosan Medical Association, 97, 661-666.

Hsueh, P.R., Liu, Y.C., Yang, D., Yan, J.J., Wu, T.L., Huang, W.K., Wu, J.J., Ko, W.C., Leu, H.S., Yu, C.R. and Luh, K.T. (2001) Multicenter Surveillance of Antimicrobial Resistance of Major Bacterial Pathogens in Intensive Care Units in 2000 in Taiwan. Microbial Drug Resistance, 7, 3733-3782.

Jean, S.S., Hsueh, P.R., Lee, W.S., Chang, H.T., Chou, M.Y., Chen, I.S., Wang, J.H., Lin, C.F., Shyr, J.M., Ko, W.C., Wu, J.J., Liu, Y.C., Huang, W.K., Teng, L.J. and Liu, C.Y. (2009) Nationwide Surveillance of Antimicrobial Resistance among Enterobacteriaceae in Intensive Care Units in Taiwan. European Journal of Clinical Microbiology and Infectious Disease, 28, 215-220. https://doi.org/10.1007/s10096-008-0610-7

Kung, C.H., Ku, W.W., Lee, C.H., Fung, C.P., Kuo, S.C., Chen, T.L. and Lee, Y.T. (2013) Epidemiology and Risk Factors of Community-Onset Urinary Tract Infection Caused by Extended-Spectrum Beta-Lactamase-Producing Enterobacteriaceae in a Medical Center in Taiwan: A Prospective Cohort Study. Journal of Microbiology, Immunology, and Infection, 48, 168-174. https://doi.org/10.1016/j.jmii.2013.08.006

Lin, H.C., Lai, L.A., Wu, J.Y., Su, Y.M., Chang, S.P. and Hsueh, Y.M. (2013) Risk Factors for Acquiring Extended-Spectrum Beta-Lactamase-Producing Enterobacteriaceae in Geriatric Patients with Multiple Comorbidities in Respiratory Care Wards. Geriatrics and Gerontology International, 13, 663-671. https://doi.org/10.1111/j.1447-0594.2012.00961.x

Jeong, S.H., Song, W., Park, M.J., Kim, J.S., Kim, H.S., Bae, I.K. and Lee, K. (2008) M. Boronic Acid Disk Tests for Identification of Extended-Spectrum Beta-Lactamase Production in Clinical Isolates of Enterobacteriaceae Producing Chromosomal AmpC Beta-Lactamases. International Journal of Antimicrobial Agents, 31, 467-471. https://doi.org/10.1016/j.ijantimicag.2007.12.014

Song, W., Jeong, S.H., Kim, J.S., Kim, H.S., Shin, D.H., Roh, K.H. and Lee, K.M. (2007) Use of Boronic Acid Disk Methods to Detect the Combined Expression of Plasmid-Mediated AmpC Beta-Lactamases and Extended-Spectrum Beta-Lactamases in Clinical Isolates of Klebsiella spp., Salmonella spp., and Proteus mirabilis. Diagnostic Microbiology and Infectious Disease, 57, 315-318. https://doi.org/10.1016/j.diagmicrobio.2006.08.023

Jacoby, G.A. (2009) AmpC β-Lactamases. Clinical Microbioloy Review, 22, 161-182. https://doi.org/10.1128/CMR.00036-08

Hsueh, P.R., Liu, C.Y. and Luh, K.T. (2002) Current Status of Antimicrobial Resistance in Taiwan. Emerging Infectious Disease, 8, 132-137. https://doi.org/10.3201/eid0802.010244

Yan, J.J., Wu, S.M., Tsai, S.H., Wu, J.J. and Su, I.J. (2000) Prevalence of SHV-12 among Clinical Isolates of Klebsiella pneumoniae Producing Extended-Spectrum Beta-Lactamases and Identification of a Novel AmpC Enzyme (CMY-8) in Southern Taiwan. Antimicrobial Agents and Chemotherapy, 44, 1438-1442. https://doi.org/10.1128/AAC.44.6.1438-1442.2000

Chiu, S.K., Wu, T.L., Chuang, Y.C., Lin, J.C., Fung, C.P., Lu, P.L., Wang, J.T., Wang, L.S., Siu, L.K. and Yeh, K.M. (2013) National Surveillance Study on Carbapenem Non-Susceptible Klebsiella pneumoniae in Taiwan: The Emergence and Rapid Dissemination of KPC-2 Carbapenemase. PLoS ONE, 8, e69428. https://doi.org/10.1371/journal.pone.0069428

Lee, C.M., Liao, C.H., Lee, W.S., Liu, Y.C., Mu, J.J. and Lee, M.C. (2012) Outbreak of Klebsiella pneumoniae Carbapenemase-2-Producing K. pneumoniae Sequence Type 11 in Taiwan in 2011. Antimicrobial Agents and Chemotherapy, 56, 5016-5022. https://doi.org/10.1128/AAC.00878-12

Andrade, L.N., Curiao, T., Ferreira, J.C., Longo, J.M., Climaco, E.C., Martinez, R., Bellissimo-Rodrigues, F., Basile-Filho, A., Evaristo, M.A., Del Peloso, P.F., Ribeiro, V.B., Barth, A.L., Paula, M.C., Baquero, F., Cantón, R., Darini, A.L. and Coque, T.M. (2011) Dissemination of blaKPC-2 by the Spread of Klebsiella pneumoniae Clonal Complex 258 Clones (ST258, ST11, ST437) and Plasmids (IncFII, IncN, IncL/M) among Enterobacteriaceae Species in Brazil. Antimicrobial Agents and Chemotherapy, 55, 3579-3583. https://doi.org/10.1128/AAC.01783-10

Damjanova, I., Toth, A., Pászti, J., Hajbel-Vékony, G., Jakab, M., Berta, J., Milch, H. and Füzi, M. (2008) Expansion and Countrywide Dissemination of ST11, ST15 and ST147 Ciprofloxacin-Resistant CTX-M-15-Type Beta-Lactamase-Producing Klebsiella pneumoniae Epidemic Clones in Hungary in 2005—The New “MRSAs”? Journal of Antimicrobial Chemotherapy, 62, 978-985. https://doi.org/10.1093/jac/dkn287

Ko, K.S., Lee, J.Y., Baek, J.Y., Suh, J.Y., Lee, M.Y., Choi, J.Y., Yeom, J.S., Kim, Y.S., Jung, S.I., Shin, S.Y., Heo, S.T., Kwon, K.T., Son, J.S., Kim, S.W., Chang, H.H., Ki, H.K., Chung, D.R., Peck, K.R. and Song, J.H. (2010) Predominance of an ST11 Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Clone Causing Bacteraemia and Urinary Tract Infections in Korea. Journal of Medical Microbiology, 59, 822-828. https://doi.org/10.1099/jmm.0.018119-0

Crowley, B., Benedi, V.J. and Domenech-Sanchez, A. (2002) Expression of SHV-2 Beta-Lactamase and of Reduced Amounts of OmpK36 Porin in Klebsiella pneumoniae Results in Increased Resistance to Cephalosporins and Carbapenems. Antimicrobial Agents and Chemotherapy, 46, 3679-3682. https://doi.org/10.1128/AAC.46.11.3679-3682.2002

Doumith, M., Ellington, M.J., Livermore, D.M. and Woodford, N. (2009) Molecular Mechanisms Disrupting Porin Expression in Ertapenem-Resistant Klebsiella and Enterobacter spp. Clinical Isolates from the UK. Journal of Antimicrobial Chemotherapy, 63, 659-667. https://doi.org/10.1093/jac/dkp029

Tsai, Y.K., Fung, C.P., Lin, J.C., Chen, J.H., Chang, F.Y., Chen, T.L. and Siu, L.K. (2011) Klebsiella pneumoniae Outer Membrane Porins OmpK35 and OmpK36 Play Roles in Both Antimicrobial Resistance and Virulence. Antimicrobial Agents and Chemotherapy, 55, 1485-1493. https://doi.org/10.1128/AAC.01275-10

Turner, K.L., Cahill, B.K., Dilello, S.K., Gutel, D., Brunson, D.N., Albertí, S. and Ellis, T.N. (2016) Porin Loss Impacts the Host Inflammatory Response to Outer Membrane Vesicles of Klebsiella pneumoniae. Antimicrobial Agents and Chemotherapy, 60, 1360-1369. https://doi.org/10.1128/AAC.01627-15

Sugawara, E., Kojima, S. and Nikaido, H. (2016) Klebsiella pneumoniae Major Porins OmpK35 and OmpK36 Allow More Efficient Diffusion of β-Lactams than Their Escherichia coli Homologs OmpF and OmpC. Journal of Bacteriology, 198, 3200-3208. https://doi.org/10.1128/JB.00590-16

Tsai, Y.K., Liou, C.H., Fung, C.P., Lin, J.C. and Siu, L.K. (2013) Single or in Combination Antimicrobial Resistance Mechanisms of Klebsiella pneumoniae Contribute to Varied Susceptibility to Different Carbapenems. PLoS ONE, 8, e79640. https://doi.org/10.1371/journal.pone.0079640

Wassef, M., Abdelhaleim, M., AbdulRahman, E. and Ghaith, D. (2015) The Role of OmpK35, OmpK36 Porins, and Production of β-Lactamases on Imipenem Susceptibility in Klebsiella pneumoniae Clinical Isolates, Cairo, Egypt. Microbial Drug Resistance, 21, 577-580. https://doi.org/10.1089/mdr.2014.0226

Lee, C.H., Chu, C., Liu, J.W., Chen, Y.S., Chiu, C.J. and Su, L.H. (2007) Collateral Damage of Flomoxef Therapy: In Vivo Development of Porin Deficiency and Acquisition of blaDHA-1 Leading to Ertapenem Resistance in a Clinical Isolate of Klebsiella pneumoniae Producing CTX-M-3 and SHV-5 Beta-Lactamases. Journal of Antimicrobial Chemotherapy, 60, 410-413. https://doi.org/10.1093/jac/dkm215

Hernandez-Alles, S., Benedi, V.J., Martinez-Martinez, L., Pascual, A., Aguilar, A., Tomas, J.M., Benedí, V.J. and Jacoby, G.A. (1999) Development of Resistance during Antimicrobial Therapy Caused by Insertion Sequence Interruption of Porin Genes. Antimicrobial Agents and Chemotherapy, 3, 937-939.