<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJMB</journal-id><journal-title-group><journal-title>American Journal of Molecular Biology</journal-title></journal-title-group><issn pub-type="epub">2161-6620</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajmb.2018.82008</article-id><article-id pub-id-type="publisher-id">AJMB-83723</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Isolation and Functional Analysis of the Regulation of Branching by Isopentenyl Transferase Gene CmIPT1 in &lt;i&gt;Chrysanthemum morifolium &lt;/i&gt;cv. ‘Jinba’
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Abdurazak</surname><given-names>Ishak</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lili</surname><given-names>Dong</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Huang</surname><given-names>Rong</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Shuiming</surname><given-names>Zhang</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Liangjun</surname><given-names>Zhao</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Beijing, China</addr-line></aff><aff id="aff2"><addr-line>Department of Ornamental Horticulture, Anhui Agricultural University, Hefei, China</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>zhaolj5073@163.com(LZ)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>11</day><month>04</month><year>2018</year></pub-date><volume>08</volume><issue>02</issue><fpage>92</fpage><lpage>101</lpage><history><date date-type="received"><day>19,</day>	<month>December</month>	<year>2017</year></date><date date-type="rev-recd"><day>10,</day>	<month>April</month>	<year>2018</year>	</date><date date-type="accepted"><day>13,</day>	<month>April</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Today’s
   chrysanthemums 
  are highly evolved flowering plants and they are considered as one of the most important ornamental cut flowers. In this research an isopentenyl transferase gene named 
  CmIPT
  1
   
  was isolated from 
  Chrysanthemum morifolium cv. 
  ‘
  Jinba
  ’
   using RACE and RT-PCR methods. The full cDNA sequence of CmIPT1 was 873
   
  bp which encoded a deduced protein of 290 amino acids. It contained GxxGxGKS which is a conserved sequence of the typical domain of IPT family. The phylogenetic tree analysis of CmIPT1 in Chrysanthemum morifolium cv. 
  ‘
  Jinba
  ’
   shows that it has the closest relationship with CcIPT1 in Cynara cardunculus var. scolymus. Expression of CmIPT1 was higher in stems and apex, whereas it was lower in leaves and roots. And the overexpression of CmIPT1 obviously increased the number of rosette branches in Arabidopsis. Here, in our study, we showed that CmIPT1 is a positive regulator of branch development in Chrysanthemum and may play a key role in regulating lateral branch formation of Chrysanthemum plants.
 
</p></abstract><kwd-group><kwd>Chrysanthemum</kwd><kwd> Cytokinin</kwd><kwd> &lt;i&gt;CmIPT1&lt;/i&gt;</kwd><kwd> Shoot Branching</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The development of branching in plants involves the formation and subsequent growth of axillary buds [<xref ref-type="bibr" rid="scirp.83723-ref1">1</xref>] . Plant hormones, location on the plant, gene expression and environment all influence the growth of axillary buds. Hormones are one of the primary factors regulating branching. At present, it has been considered that three types of hormones participate in regulating the growth of axillary buds. Cytokinins accelerate the growth of axillary buds [<xref ref-type="bibr" rid="scirp.83723-ref2">2</xref>] , while auxin and strigolactones inhibit the growth of axillary buds [<xref ref-type="bibr" rid="scirp.83723-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.83723-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.83723-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.83723-ref6">6</xref>] . Cytokinin is considered to be the second messenger [<xref ref-type="bibr" rid="scirp.83723-ref7">7</xref>] , and influences the growth of axillary buds under mutual antagonization with strigolactones [<xref ref-type="bibr" rid="scirp.83723-ref8">8</xref>] . Isopentenyl transferase (IPT) is the first reaction in the biosynthesis of cytokinin, and is also a limiting enzyme in cytokinin biosynthesis. There are two types of Isopentenyltransferase (IPT), namely tRNA-IPT which forms the cis-form zeatin, and adenylate isopentenyltransferase (A-IPT) which forms isopentenyladenine as well as anti-form zeatin [<xref ref-type="bibr" rid="scirp.83723-ref9">9</xref>] . The IPT family of genes has been identified in Arabidopsis [<xref ref-type="bibr" rid="scirp.83723-ref10">10</xref>] , rice [<xref ref-type="bibr" rid="scirp.83723-ref11">11</xref>] , pea [<xref ref-type="bibr" rid="scirp.83723-ref12">12</xref>] and corn [<xref ref-type="bibr" rid="scirp.83723-ref13">13</xref>] . However, IPT1 is rarely studied. Research on Physcomitrella patens showed that IPT1 was the main enzyme which catalysed the prenylation of tRNA, and mutation of IPT1 increased the number of lateral branches [<xref ref-type="bibr" rid="scirp.83723-ref14">14</xref>] . Research showed that the level of expression of PsIPT1 and PsIPT2 in peas increased significantly and axillary bud started germinating after removing the shoot top by pruning. This illustrated that cytokinin was synthesized promptly to accelerate the growth of axillary buds after removing the shoot top by pruning [<xref ref-type="bibr" rid="scirp.83723-ref15">15</xref>] . According to the research results, IPT1 plays an important role in regulating lateral branch formation and the development of plants.</p><p>Chrysanthemum is native to China, with a long history of cultivation and abundant cultural connotations, it is considered as one of the most important ornamental cut flowers. Plant architecture is one of the important factors which needs to be regulated when cultivating Chrysanthemum. In this study, we cloned an IPT1 homologous gene called CmIPT1 from C. morifolium cv. ‘Jinba’, and studied its expression pattern using fluorescent quantitative PCR. We also studied the role of the CmIPT1 gene in regulating branching by using allogenic transformation of Arabidopsis with the aim of breeding new varieties of cut-flower Chrysanthemum having less lateral branches or without any lateral branches by means of molecular biology techniques.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Materials</title><p>In this study, we used Chrysanthemum morifolium cv. ‘Jinba’ from the Germplasm Nursery of Anhui Agricultural University. Chrysanthemum cuttings and Arabidopsis wild-type (col-0) as well as transgenic Arabidopsis were all grown in a culture room at a temperature of (20 &#177; 2)˚C, photoperiod of 16 h/8 h (light/dark), illumination intensity of 100 - 120 &#181;mol∙m<sup>−2</sup>∙s<sup>−1</sup>.</p></sec><sec id="s2_2"><title>2.2. Method</title><sec id="s2_2_1"><title>2.2.1. Cloning of CmIPT1</title><p>Total RNA of Chrysanthemum was extracted from stems using Trizol reagent. Residual DNA was digested using RNase-free DNase. cDNA anti sense was synthesized by using M-MLV reverse transcriptase. Degenerate primers were designed according to the conservative nucleotide sequence of IPT1 in Cynara cardunculus var. scolymus, Medicago truncatula, Lotus japonicus and Arabidopsis thaliana. An intermediate fragment was obtained by amplification with degenerate primers. Specific primers for 5’ and 3’ were designed according to the sequence of the intermediate fragment. The 5’ and 3’ terminal sequences of CmIPT1 were obtained using a SMART<sup>er</sup>TM RACE cDNA Amplification Kit. DNAMAN 6.0 splices joints tripartite sequences, and finally the full length sequence of the CmIPT1 gene was obtained. CmIPT1 was amplified using TransStart Fast Pfu polymerase and was connected with the pEASY-Blunt Simple vector. DNA sequencing was conducted by Sangon Biotech (Shanghai). PCR amplification reaction procedure and conditions were: 95˚C initial denaturation 5 min; 95˚C denaturation 30 s, 55˚C annealing 30 s, 72˚C extension 2 min, overall 34 cycles; finally 72˚C extension 10 min, 12˚C preserved (<xref ref-type="table" rid="table1">Table 1</xref>).</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primers</th><th align="center" valign="middle" >Sequence 5’-3’</th><th align="center" valign="middle" >Usage</th></tr></thead><tr><td align="center" valign="middle" >IPT1-PF</td><td align="center" valign="middle" >CTCCGACAAAATGCAAGTCTAC</td><td align="center" valign="middle" >Amplification of CmIPT1 middle fragment</td></tr><tr><td align="center" valign="middle" >IPT1-PR</td><td align="center" valign="middle" >TTCACAATCT TTACGCTTGG</td><td align="center" valign="middle" >Amplification of CmIPT1 middle fragment</td></tr><tr><td align="center" valign="middle" >IPT1-5’-R1</td><td align="center" valign="middle" >CGACCCGAGACTCCGAAAATCCGAG</td><td align="center" valign="middle" >Amplification of CmIPT1 5’ end</td></tr><tr><td align="center" valign="middle" >IPT1-5’-R2</td><td align="center" valign="middle" >GGGTCGGGTCAATGGCTCCGAGAAG</td><td align="center" valign="middle" >Amplification of CmIPT1 5’ end</td></tr><tr><td align="center" valign="middle" >IPT1-3’-F1</td><td align="center" valign="middle" >CACGTGTCAGTTGGCGAAAAGACAAATAGG</td><td align="center" valign="middle" >Amplification of CmIPT1 3’ end</td></tr><tr><td align="center" valign="middle" >IPT1-3’-F2</td><td align="center" valign="middle" >GAGTGGATGCCACCGAGGCGTTTAA</td><td align="center" valign="middle" >Amplification of CmIPT1 3’ end</td></tr><tr><td align="center" valign="middle" >IPT1-RTPF</td><td align="center" valign="middle" >CGCCAAGTTCTTTCCCGAGTATCC</td><td align="center" valign="middle" >qRT-PCR for CmIPT1</td></tr><tr><td align="center" valign="middle" >IPT1-RTPR</td><td align="center" valign="middle" >ATGCCAAGGTCTCTGAGCTTCTGC</td><td align="center" valign="middle" >qRT-PCR for CmIPT1</td></tr><tr><td align="center" valign="middle" >18S-F</td><td align="center" valign="middle" >CTCATGGGATGTGGCTTCTT</td><td align="center" valign="middle" >Reference gene in Chrysanthemum</td></tr><tr><td align="center" valign="middle" >18S-R</td><td align="center" valign="middle" >GCGTTCAAAAACTCGATGGT</td><td align="center" valign="middle" >Reference gene in Chrysanthemum</td></tr><tr><td align="center" valign="middle" >Tubulin-F</td><td align="center" valign="middle" >GAGCCTTACAACGCTACTCTGTCTGTC</td><td align="center" valign="middle" >Reference gene in Arabidopsis</td></tr><tr><td align="center" valign="middle" >Tubulin-R</td><td align="center" valign="middle" >ACACCAGACATAGTAGCAGAAATCAAG</td><td align="center" valign="middle" >Reference gene in Arabidopsis</td></tr></tbody></table></table-wrap></sec><sec id="s2_2_2"><title>2.2.2. CmIPT1 Sequence Analysis and Construction of a Polygenetic Tree</title><p>Multiple comparison analyses were conducted between the protein sequences of gene code and homologous sequences of other species in the NCBI data base, using clustalX 1.8 and MEGA 5.05 software to establish maximum likelihood phylogenetic tree, adopting the neighbor-joining method [<xref ref-type="bibr" rid="scirp.83723-ref16">16</xref>] , and by setting up bootstrap analysis repeated 1000 times.</p></sec><sec id="s2_2_3"><title>2.2.3. Expression Analysis of CmIPT1 from Different Tissues of Chrysanthemum and after Removing the Shoot Top by Pruning</title><p>RNA was extracted from root, stem, leaf and apex of the plant respectively, using 2 μg of each, and after DNase digestion, cDNA template was obtained by conducting reverse transcription using M-MLV reverse transcriptase. Real-time fluorescent quantitative PCR (qRT-PCR) was used, adopting the ABI 7500 Fast real-time PCR system and SYBR<sup>&#174;</sup>Premix Ex Taq™ II fluorochrome. The response procedure as follows: 95˚C denaturation 90 s, 95˚C 15 s, 60˚C 30 s, 40 cycles. Data analysis was conducted using 7500 software (version 2.0.4). Tubulin was used as the reference gene, and the 2<sup>−ΔΔCT </sup>method was used to compute relative expression [<xref ref-type="bibr" rid="scirp.83723-ref17">17</xref>] .</p></sec><sec id="s2_2_4"><title>2.2.4. Construction of a CmIPT1 Overexpression Vector</title><p>SalⅠ and HindШ cutting sites were respectively added in the upstream and downstream primer, CmIPT1. The full length sequence was amplified using M-MLV and ligated into the PJL-Blue vector. Sequencing was conducted by Sangon Biotech (Shanghai). The correct plasmid from sequencing was ligated into the PFK205 expression vector through LR reaction.</p></sec><sec id="s2_2_5"><title>2.2.5. Gene Transfer and Phenotypic Analysis</title><p>The vector plasmid was transformed into (Agrobacterium tumefaciens) ASE, and was then transformed into Arabidopsis thaliana wild type col-0 using the floral dip method [<xref ref-type="bibr" rid="scirp.83723-ref18">18</xref>] . Transformants were selected using 1/2 MS which contained 50 mg∙L<sup>−1</sup> kanamycin, and selected T3 generation transgenic plants were transplanted into pots. RNA was extracted from rosette leaves of the control and T3 generation transgenic plants respectively. cDNA was synthesized using reverse transcription and the level of expression of CmIPT1 was determined. The number of lateral branches and plant height were recorded after culturing the plant for 40 days in growth chamber.</p></sec></sec></sec><sec id="s3"><title>3. Results and Analysis</title><sec id="s3_1"><title>3.1. Cloning Full Length cDNA of the CmIPT1 Gene from Chrysanthemum</title><p>Based on the available IPT1 sequences from plant species such as Brassica campestris, Arabidopsis thaliana, Raphanus sativus and Solanum tuberosum, a 781 bp length DNA fragment was obtained from Chrysanthemum morifolium using PT1-PF/IPT1-PR. Amplification of the 5’ end of the CmIPT1 gene was conducted using the gene-specific primer IPT1-5’F1/IPT1-5’R1, and a fragment with the length of 477 bp was obtained (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). Amplifications of the 3’ end sequence of the CmIPT1 gene were conducted using 3’ Gene Racer outer and inner primers respectively with IPT1-3’F1 and IPT1-3’F2, and finally a 588 bp fragment was obtained with a poly A tail (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). The 1615 bp CmIPT1 gene sequence was obtained by joining the intermediate fragment, the 3’ end sequence and the 5’ end sequences.</p></sec><sec id="s3_2"><title>3.2. Sequence Analysis</title><p>The CmIPT1 gene with an overall length of 1155 bp was extracted from Chrysanthemum using the RACE method, and this gene encoded a protein with 384 amino acids. The predicted molecular weight was 43.41 kD and the theoretical isoelectric point was 8.68, using ExPaSy ProtParam online tool. The amino acid</p><p>sequence coded by the CmIPT1 gene (<xref ref-type="fig" rid="fig2">Figure 2</xref>) was compared with amino acid sequences of other plant species, and the result showed that CmIPT1 had the binding site GxxGxGKS sequence motif of ATP/ADP/AMP and DMAPP, which is the conserved domain of all IPT genes [<xref ref-type="bibr" rid="scirp.83723-ref10">10</xref>] .</p></sec><sec id="s3_3"><title>3.3. Phylogenetic Analyses of the IPT1 Homologous Protein</title><p>To confirm the genetic relationship between CmIPT1 and IPT1 from other plant species, multiple sequence alignment and phylogenetic analyses were conducted between CmIPT1 and IPT1 which had already been cloned from eight plant species such as Cynara cardunculus var. scolymus, Lotus japonicus, Arabidopsis thaliana, Morus notabilis, Malus domestica, Medicago truncatula, Brassica napus and Solanum tuberosum using clustal &#215; 1.8 and MEGA 5.05 software (<xref ref-type="fig" rid="fig3">Figure 3</xref>). The results showed that the origin of CmIPT1 and IPT1 from other plant species was the same, and was separated together with the other plant species during periods of evolution. CmIPT1 was most similar to CcIPT1 of Cynara cardunculus, and was most distant from StIPT1 of potato.</p></sec><sec id="s3_4"><title>3.4. Gene Expression Analysis of CmIPT1 in Different Tissues of Chrysanthemum</title><p>To reveal the expression features of CmIPT1 gene in Chrysanthemum, the</p><p>expression of CmIPT1 in different tissues of C. morifolium cv. ‘Jinba’ was detected. The results indicated that CmIPT1 gene was expressed in roots, stems, leaves and the apex of the plant. Expression of CmIPT1 in stem and apex was relatively high, while the expression in root and leaf tissues was relatively low (<xref ref-type="fig" rid="fig4">Figure 4</xref>).</p></sec><sec id="s3_5"><title>3.5. Phenotypic Analysis of CmIPT1 Over-Expressed Arabidopsis thaliana</title><p>To construct a plant expression vector based on CmIPT1, the gene was transformed into wild type Arabidopsis, and six transgenic plants were obtained.</p><p>CmIPT1 gene expression was detected in randomly selected transgenic plants. After 40 days growth, the number of lateral branches in wild type and transgenic plants was 3.5 and 6.3 respectively, with the number of lateral branches in transgenic plants being significantly greater. The mean heights of wild type and transgenic plants were 25.2 and 17.0 cm, respectively, with the transgenic plants being significantly shorter (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Chrysanthemum is one of world’s four major cut flowers. However, cut flower Chrysanthemums generally have many lateral branches. Controlling lateral</p><p>branching using hormones has been very difficult, and doing it manually is a common practice, but is very time-consuming. For C. morifolium cv. ‘Jinba’, for instance, the cost of manual bud removal is 1/3 of the overall production cost. So, producing new varieties of Chrysanthemum with no lateral branches or with fewer lateral branches is the key to promoting the efficient production of this flower. In our study, a homologous gene of IPT1 from C. morifolium cv. ‘Jinba’ was cloned. The predicted amino acid sequence of the gene contains the conserved structural domain of IPT family genes, GATGAGKS, hence it was named CmIPT1. Phylogenetic tree analysis indicated that the origin of CmIPT1 and IPT1s from other plants was similar. The Chrysanthemum IPT1 gene CMIPT1 was most closely related to that of Cynara cardunculus, and was most distant from those of Solanum tuberosum and Lotus japonicus. Asteraceae family contains both Chrysanthemum and Cynara. So, some degree of closer relatedness is to be expected. After testing gene expression levels in root, stem, leaf, and apex of the Chrysanthemum plant, it was found that the CmIPT1 gene was expressed in all 4 different tissues, and the expression in stem and apex of the plant was relatively high while the expression was relatively low in root and leaf of the plant.</p><p>Direct application of cytokinin could accelerate the growth of axillary buds, and synthesis of cytokinin is controlled by auxin, so cytokinin is considered to be the second messenger of auxin [<xref ref-type="bibr" rid="scirp.83723-ref7">7</xref>] . The CmIPT1 gene was transformed into wild type Arabidopsis, and the number of lateral branches in transgenic plants was increased significantly, showing that that CmIPT1 could be the key gene that controls lateral branch development in Chrysanthemum and t to produce single-stemmed plants a knockout mutant of CmIPT1 can be developed and tested.</p></sec><sec id="s5"><title>5. Conclusion</title><p>In summary, after analyzing the expression features and functional analysis of CmIPT1 gene, it was found that there is a correlation between the expression of CmIPT1 and the number of lateral branches, and it therefore appears to be an important regulator of lateral branch development in Chrysanthemum. The CmIPT1 gene is worthy of further study, in order to provide insight into the possibility of breeding new varieties of cut-flower Chrysanthemum using molecular biology.</p></sec><sec id="s6"><title>Cite this paper</title><p>Ishak, A., Dong, L., Rong, H., Zhang, S. and Zhao, L. (2018) Isolation and Functional Analysis of the Regulation of Branching by Isopentenyl Transferase Gene CmIPT1 in Chrysanthemum morifolium cv. ‘Jinba’. American Journal of Molecular Biology, 8, 92-101. https://doi.org/10.4236/ajmb.2018.82008</p></sec></body><back><ref-list><title>References</title><ref id="scirp.83723-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">McSteen, P. and Leyser, O. (2005) Shoot Branching. Annual Review of Plant Biology, 56, 353-374. https://doi.org/10.1146/annurev.arplant.56.032604.144122</mixed-citation></ref><ref id="scirp.83723-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Cline, M.G. (1991) Apical Dominance. The Botanical Review, 57, 318-358. https://doi.org/10.1007/BF02858771</mixed-citation></ref><ref id="scirp.83723-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Thimann, K.V. and Skoog, F. (1933) Studies on the Growth Hormone of Plants. The Inhibiting Action of the Growth Substance on Bud Development. Proceedings of the National Academy of Sciences of the United States of America, 19, 714-716. https://doi.org/10.1073/pnas.19.7.714</mixed-citation></ref><ref id="scirp.83723-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Thimann, K.V. and Skoog, F. (1934) On the Inhibition of Bud Development and Other Functions of Growth Substance in Vicia faba. Proceedings of the National Academy of Sciences of the United States of America, 114, 317-339. https://doi.org/10.1098/rspb.1934.0010</mixed-citation></ref><ref id="scirp.83723-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Gomez-Roldan, V., Fermas, S., Brewer, P.B., et al. (2008) Strigolactone Inhibition of Shoot Branching. Nature, 455, 189-194. https://doi.org/10.1038/nature07271</mixed-citation></ref><ref id="scirp.83723-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Umehara, M., Hanada, A., Yoshida, S., et al. (2008) Inhibition of Shoot Branching by New Terpenoid Plant Hormones. Nature, 455, 195-200. https://doi.org/10.1038/nature07272</mixed-citation></ref><ref id="scirp.83723-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Brewer, P.B., Dun, E.A., Ferguson, B.J., et al. (2009) Strigolactone Acts Downstream of Auxin to Regulate Bud Outgrowth in Pea and Arabidopsis. Plant Physiology, 150, 482-493. https://doi.org/10.1104/pp.108.134783</mixed-citation></ref><ref id="scirp.83723-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Dun, E.A., Germain, A.D.S., Rameau, C. and Beveridge, C.A. (2012) Antagonistic Action of Strigolactone and Cytokinin in Bud Outgrowth Control. Plant Physiology, 158, 487-498. https://doi.org/10.1104/pp.111.186783</mixed-citation></ref><ref id="scirp.83723-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Kaori, M., Petr, T., Miho, M.K., Tomohiko, K., Shusei, S., Danuse, T., Satoshi T., Goran, S. and Tatsuo, K. (2006) Roles of Arabidopsis ATP/ADP Isopentenyltransferases and tRNA Isopentenyltransferases in Cytokinin Biosynthesis. Proceedings of the National Academy of Sciences of the United States of America, 103, 16598-16603. https://doi.org/10.1073/pnas.0603522103</mixed-citation></ref><ref id="scirp.83723-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Takei, K., Sakakibara, H. and Sugiyama, T. (2001) Identification of Genes Encoding Adenylate Isopentenyltransferase, a Cytokinin Biosynthesis Enzyme, in Arabidopsis thaliana. Journal of Biological Chemistry, 276, 26405-26410. https://doi.org/10.1074/jbc.M102130200</mixed-citation></ref><ref id="scirp.83723-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Hirose, N., Takei, K., Kuroha, T., Kamada-Nobusada, T., Hayashi, H. and Sakakibara, H. (2008) Regulation of Cytokinin Biosynthesis, Compartmentalization and Translocation. Journal of experimental Botany, 59, 75-83. https://doi.org/10.1093/jxb/erm157</mixed-citation></ref><ref id="scirp.83723-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Ye, C.J., Wu, S.W., Kong, F.N., Zhou, C.J., Yang, Q.K, Sun, Y. and Wang, B. (2006) Identification and Characterization of an Isopentenyltransferase (IPT) Gene in Soybean (Glycine max L.). Plant Science, 170, 542-550. https://doi.org/10.1016/j.plantsci.2005.10.008</mixed-citation></ref><ref id="scirp.83723-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Brugière, N., Humbert, S., Rizzo, N., Bohn, J. and Habben, J.E. (2008) A Member of the Maize Isopentenyl Transferase Gene Family, Zea mays Isopentenyl Transferase 2 (ZmIPT2), Encodes a Cytokinin Biosynthetic Enzyme Expressed during Kernel Development. Plant Molecular Biology, 67, 215-229. https://doi.org/10.1007/s11103-008-9312-x</mixed-citation></ref><ref id="scirp.83723-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Lindner, C.A., et al. (2014) Isopentenyltransferase-1 (IPT1) Knockout in Physcomitrella Together with Phylogenetic Analyses of IPTs Provide Insights into Evolution of Plant Cytokinin Biosynthesis. Journal of Experimental Botany, 65, 2533-2543. https://doi.org/10.1093/jxb/eru142</mixed-citation></ref><ref id="scirp.83723-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Tanaka, M., Takei, K., Kojima, M., Sakakibara, H. and Mori, H. (2006) Auxin Controls Local Cytokinin Biosynthesis in the Nodal Stem in Apical Dominance. The Plant Journal, 45, 1028-1036. https://doi.org/10.1111/j.1365-313X.2006.02656.x</mixed-citation></ref><ref id="scirp.83723-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Saitou, N. and Nei, M. (1987) The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Molecular Biology and Evolution, 4, 406-425.</mixed-citation></ref><ref id="scirp.83723-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Livak, K.J. and Schmittgen, T.D. (2001) Analysis of Relative Gene Expression Data Using Real Time Quantitative PCR and the 2-CT Method. Methods, 25, 402-408. https://doi.org/10.1006/meth.2001.1262</mixed-citation></ref><ref id="scirp.83723-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Clough, S.J. and Bent, A.F. (1998) Floral Dip: A Simplified Method for Agrobacterium-Mediated Transformation of Arabidopsis thaliana. The Plant Journal, 16, 735-743. https://doi.org/10.1046/j.1365-313x.1998.00343.x</mixed-citation></ref></ref-list></back></article>