<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2018.83014</article-id><article-id pub-id-type="publisher-id">AiM-83472</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Inhibitory Activity of &lt;i&gt;Paenibacillus&lt;/i&gt; sp. Isolated from Soil in Gotsu City, Shimane Prefecture, Against Xanthomas &lt;i&gt;oryzae&lt;/i&gt; pv. &lt;i&gt;oryzae&lt;/i&gt;, the Causal Agent of Rice Bacterial Leaf Blight
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mohammad</surname><given-names>Naser Haidary</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Tomoko</surname><given-names>Tamura</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Makoto</surname><given-names>Ueno</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Laboratory of Plant Pathology, Faculty of Life and Environmental Science, Shimane University, Matsue, Japan</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>makoto-u@life.shimane-u.ac.jp(MNH)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>21</day><month>03</month><year>2018</year></pub-date><volume>08</volume><issue>03</issue><fpage>197</fpage><lpage>210</lpage><history><date date-type="received"><day>5,</day>	<month>February</month>	<year>2018</year></date><date date-type="rev-recd"><day>26,</day>	<month>March</month>	<year>2018</year>	</date><date date-type="accepted"><day>30,</day>	<month>March</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Microorganism isolates (n = 49) were obtained from the soil samples collected from field in Gotsu city (Kawahira), Shimane. Isolate GT2-E culture inhibited the growth of 
  Xanthomonas oryzae pv. 
  oryzae in disk diffusion method. Rice bacterial leaf blight was suppressed by GT2-E culture in the pre- and post-treated rice leaves. Sequence analysis of 16S rDNA region of the GT2-E isolate indicated that it shared 99% similarity with 
  Paenibacillus polymyxa. The growth of GT2-E on LB medium was observed at 15&#176;C, 28&#176;C, 37&#176;C, and 45&#176;C, but not at 4&#176;C. GT2-E isolate could be grown even in the presence of agrochemicals (Amister, Blasin and Kasumin). Furthermore, the growth of 
  X. oryzae pv. 
  oryzae was inhibited by the culture filtrate of GT2-E isolate in disk diffusion method. However, the inhibitory activity of the culture filtrate was heat-unstable. This result suggested that GT2-E isolate can produce heat-unstable inhibitory compound(s). In conclusion, GT2-E isolate might contribute to the development of a new bactericide and biological agent against rice bacterial leaf blight.
 
</p></abstract><kwd-group><kwd>Rice Bacterial Leaf Blight</kwd><kwd> &lt;i&gt;Xanthomonas oryzae&lt;/i&gt; pv. &lt;i&gt;oryzae&lt;/i&gt; </kwd><kwd> Microorganisms</kwd><kwd> &lt;i&gt;Paenibacillus polymyxa&lt;/i&gt;</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Rice (Oryzae sativa L.) is one of the major staple food crops in the world. Annually, more than 40% of the world rice crop is lost owing to biotic stresses like insects, pests, pathogens, and weeds [<xref ref-type="bibr" rid="scirp.83472-ref1">1</xref>] . Diseases cause by bacterial, fungal, and viral pathogens. Among several other diseases, rice bacterial leaf blight have devastated rice yield all over the world. Rice bacterial leaf blight caused by Xanthomonas oryzae pv. oryzae is one of the most destructive disease of rice around the globe. This disease reduces the grain yield to varying levels depending on the stage of the crop, degree of cultivar susceptibility, and a great extent to the conduciveness of the environment in which it occurs [<xref ref-type="bibr" rid="scirp.83472-ref2">2</xref>] . Rice bacterial leaf blight appears on the infected leaves as pale green to grey green water soaked streaks near leaf tips and margins after a while, the lesions coalesce and turn yellowish. Finally, the whole leaves may become whitish or grayish and eventually dies [<xref ref-type="bibr" rid="scirp.83472-ref3">3</xref>] . Several chemicals have been developed to control the disease. However, none of them has been fully effective under severe condition [<xref ref-type="bibr" rid="scirp.83472-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.83472-ref5">5</xref>] . In addition, a wide range chemicals and broad-spectrum antibiotics have been recommended for control of rice bacterial leaf blight [<xref ref-type="bibr" rid="scirp.83472-ref6">6</xref>] . However, chemical control has been known to have several disadvantages, e.g., causing detrimental effects on the ecosystem and human health, being costly, and potentially leading to pathogen resistance [<xref ref-type="bibr" rid="scirp.83472-ref7">7</xref>] . Biological control using antagonistic bacteria, particularly plant growth-promoting rhizobacteria has been considered an attractive alternative for control of rice bacterial leaf blight [<xref ref-type="bibr" rid="scirp.83472-ref8">8</xref>] .</p><p>In fact, control of plant disease by using microorganisms and microbial antagonists is an important component of integrated pest management. Some studies on biological control of rice bacterial leaf blight have been reported from several countries. Most of the studies attempted to screen microorganisms from phyllplane or other sources for antibacterial activity against the bacterial pathogen in vitro. However, their practical use in the field still remains largely unknown, because to provide a clear demonstration of the biological control, considerable knowledge on the growth and survival of the microbial antagonists in the phyllplane of rice and the development of valid experimental techniques are required. Therefore, more extensive testing of potential microbial antagonists against X. oryzae pv. oryzae is required for effective biological control of rice bacterial leaf blight. It is well known that microorganisms produce different compounds even in the same species. Furthermore, microorganisms have different characteristics even in the same species. Therefore, it is necessary to examine a collection of wide biological diversity to find new inhibitory compounds and microorganisms for plant disease control. In the past ten years, advances in molecular genetics, monoclonal antibody technology, and biological control of plant disease have been made. In order to develop an ecofriendly technology, agrochemicals are not recommended for disease control, because they may be toxic to living beings and might lead to the development of pesticide-resistant pathogen. Therefore, control of plant disease by microorganisms is an alternative approach to prevent chemical control of plant disease. Geographically, Shimane prefecture is elongated from east to west and has various characteristic climatic diversities. Consequently, the soil of Shimane prefecture is expected to have diverse microbial resources. However, there is a limited report to microbial communities found in Shimane, or on their utility in the pathogen control for rice bacterial leaf blight.</p><p>In this article, we report the biological control of rice bacterial leaf blight with microorganism (GT2-E) isolated from soil in Gotsu City, Shimane Prefecture, Japan.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Microorganism, Xanthomonas oryzae and Rice Plant</title><p>The microorganism (GT2-E) were isolated and obtained from the soil samples collected from field in Gotsu city (Kawahira), Shimane in accordance with previously reported procedures [<xref ref-type="bibr" rid="scirp.83472-ref9">9</xref>] . It was suspended in 15% - 20% glycerol solution and stored at -80˚C until use. A single colony of the isolate was transferred to PC-1 medium (5 g starch, 5 g polypeptone, 5 g molasses, 1200 &#181;L 2N NaOH, and final volume of 1000 mL distilled water). The liquid cultures were incubated at 26˚C &#177; 2˚C for 3 - 4 days with constant shaking on a rotary shaker (130 rpm). X. oryzae pv. oryzae (strain MAFF 210616) was grown on peptone sucrose agar (PeSA; 5 g peptone, 20 g sucrose, 20 g agar, and final volume of 1000 mL distilled water) or PeS broth medium at 26˚C &#177; 2˚C. The liquid cultures were incubated at 26˚C &#177; 2˚C for 3 - 4 days with constant shaking on a rotary shaker (130 rpm). Seedlings of Oryza sativa L. “Asahi” and “Koshihikari” were used in this study. Germinated seeds were soaked in water for 4 days, and then germinated seeds were sown in plastic pots. Rice seedlings were grown to six- to seven-leaf stage under glasshouse conditions.</p></sec><sec id="s2_2"><title>2.2. Disk Diffusion Method</title><p>The antibacterial activity of GT2-E isolate against X. oryzae pv. oryzae was investigated by disk diffusion method using PeSA medium. X. oryzae pv. oryzae (100 &#181;L) was subcultured on PeSA and paper disc (8 mm), evaluated for antibiotic testing, and placed on petri dishes containing agar. Subsequently, the paper disc were inoculated with culture medium (50 &#181;L) containing the isolate. All petri dishes were incubated at 28˚C for 7 days and the diameter of inhibition zone was measured using a scale.</p></sec><sec id="s2_3"><title>2.3. Pre-Treatment Test</title><p>In this investigation, six- to seven-leaf stage of rice seeding was treated once with the culture suspension of the isolated microorganism by clipping method [<xref ref-type="bibr" rid="scirp.83472-ref10">10</xref>] . PeS was treated on a set of seedlings as a control. The pretreated rice plants were maintained in a natural condition for 3 days, and then inoculated with the culture suspension of X. oryzae pv. oryzae by clipping method [<xref ref-type="bibr" rid="scirp.83472-ref10">10</xref>] . Inoculated rice plants were maintained under natural light condition. The lesion length of rice bacterial leaf blight on rice leaves were measured 2 weeks after inoculation. The experiments were repeated three times independently.</p></sec><sec id="s2_4"><title>2.4. Post-Treatment Test</title><p>In this investigation, six- to seven-leaf stage of rice seeding was inoculated with the culture suspension of X. oryzae pv. oryzae by clipping method [<xref ref-type="bibr" rid="scirp.83472-ref10">10</xref>] . The inoculated rice plants were maintained in a natural condition for 3 days, and then treated with the culture suspension of the isolated microorganism by clipping method [<xref ref-type="bibr" rid="scirp.83472-ref10">10</xref>] . PeS was treated on a set of seedlings as a control. Inoculated rice plants were maintained under natural light condition. The lesion length of rice bacterial leaf blight on the rice leaves were measured 2 weeks after inoculation. The experiments were repeated three times independently.</p></sec><sec id="s2_5"><title>2.5. DNA Extraction, PCR Amplification, Sequencing, and Generation of Phylogenetic Tree</title><p>To identify the GT2-E isolate, the 16S rDNA sequence was determined by PCR using the primers mentioned in <xref ref-type="table" rid="table1">Table 1</xref>. The bacterial genomic DNA was extracted by the method described previously [<xref ref-type="bibr" rid="scirp.83472-ref11">11</xref>] . PCR amplification of the 16S rDNA region was performed by the PCR enzyme kit: KOD FX (Toyobo), which included the following steps: An initial step at 95˚C for 30 s, followed by 30 cycles of denaturation at 95˚C for 30 s, annealing at 53˚C for 30 s, and extension at 72˚C for 1.45 min, and a final step at 72˚C for 10 min. The PCR-amplified fragments were purified using HiYield Gel/PCR DNA fragment extraction kit (RBC Bioscience, Taipei, Taiwan). DNA sequencing was performed using a Big Dye Terminator Cycle Sequencing kit (Applied Biosystems, Carlsbad, CA, USA). DNA sequence analysis was performed on an ABI PRIZM 3130xl Genetic Analyzer (Applied Biosystems, Carlsbad, CA, USA). The sequence homology was determined using the BLAST suite of programs (DNA Data Bank, Japan). The phylogenetic tree was constructed using the neighbor-joining method.</p></sec><sec id="s2_6"><title>2.6. Heat Stability Test</title><p>To evaluate heat stability, culture filtrate of GT2-E was heated at 121˚C for 20 min. The treated culture (heated culture filtrate) and unheated culture filtrate were exposed to the plates against rice bacterial leaf blight. The antibacterial activity of heated culture filtrate and unheated culture filtrate against X. oryzae pv. oryzae was investigated by the disk diffusion method using PeSA medium. X. oryzae pv. oryzae (100 &#181;L) was subcultured on PeSA and paper disc (8 mm), evaluated for inhibitory activity test, and placed on petri dishes containing agar.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> The sequence of primers used for the isolate sequence determination</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primers</th><th align="center" valign="middle" >Sequence (5’ → 3’)</th></tr></thead><tr><td align="center" valign="middle" >fD1 rP2 EUB906F EUB532R 1115R 802R 926F 785F 536R</td><td align="center" valign="middle" >AGAGTTTGATCCTGGCTCAG ACGGCTACCTTGTTACGACTT AAACTCAAAGGAATTGRCGG CACGGTCGKCGGCGCCATT GTTGCTCGCGTTGGGA CCTAATCTATGGGACCAT AAACTCAAAGGAATTGACGG GGATTAGATACCCTGGTAGTC GTCGTCGGCGCCATTATG</td></tr></tbody></table></table-wrap><p>Subsequently, the paper discs were inoculated with heated culture filtrate and unheated culture filtrate (50 &#181;L). PC-1 medium was used as a control. All the petri dishes were incubated at 28˚C for 7 days and the diameter of inhibition zone was measured using a scale.</p></sec><sec id="s2_7"><title>2.7. Temperature Stability Test</title><p>To investigate the temperature stability, GT2-E isolate was incubated at different temperatures. The culture suspension of the GT2-E isolate (50 &#181;L) was spread on surface of LB medium and then incubated at 4˚C, 15˚C, 28˚C, 37˚C, and 45˚C. After 3 days, the growth of GT2-E isolate was observed.</p></sec><sec id="s2_8"><title>2.8. Agrochemical Sensitivity Test</title><p>We determined the agrochemical sensitivity of the GT2-E isolate. Amistar (Azoxystrobin, Syngenta Japan K.K.), Blasin (Ferimzone, Phthalide, Hokko Chemical Industry Co., LTD) and Kasumin (Kasugamycin, Hokko Chemical Industry Co., LTD) were used in this experiment. Each agrochemical was diluted (1000 fold) in molten LB medium and mixed thoroughly before dispensing to the respective, labeled 7-cm petri plates. The culture suspension of the GT2-E isolate (50 &#181;L) was spread on LB medium in the presence of agrochemicals and then incubated at 28˚C. After 3 days, the growth of GT2-E isolate was observed. LB medium without agrochemical addition was used as a control.</p></sec><sec id="s2_9"><title>2.9. Data Analysis</title><p>Data are represented in terms of the mean &#177; standard deviation values. Statistically significant differences were determined by t-test (P ˂ 0.05) using Statistical Package for the Social Sciences (IBM SPSS version 22.0).</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Inhibitory Effect of Culture Suspension of GT2-E on Growth of X. oryzae pv. oryzae</title><p>The inhibitory effect of the microbial isolates from soil against rice bacterial leaf blight diseases was evaluated using the disk diffusion method. Forty-nine microbial isolates were obtained from the soil in Gotsu city (Kawahira), Shimane, Japan (date not shown). Among the 49 isolates, GT2-E isolate significantly inhibited the growth of rice bacterial leaf blight compared to control plates (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). The diameter of the inhibition zone in the petri dish containing disc inoculated with GT2-E isolate was 13.8 &#177; 0.5 mm (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). In contrast, inhibition zone was not observed in the control plates in the absence of isolated microorganism (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)).</p></sec><sec id="s3_2"><title>3.2. Suppression of Rice Bacterial Leaf Blight by the Pre-Treatment with Culture Suspension of GT2-E</title><p>To investigate the suppression effect of rice bacterial leaf blight by the pre-treatment</p><p>with culture suspension of GT2-E, rice plant cultivars “Asahi” and “Koshihikari” were pre-treated with the culture suspension of GT2-E and were inoculated with X. oryzae pv. oryzae for 3 days. The result showed that the lesion formation in the two cultivars by X. oryzae pv. oryzae was inhibited by GT2-E (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)). In control, the length of the lesion on the leaves of cultivars “Asahi” and “Koshihikari” were 11.0 &#177; 2.9 and 12.1 &#177; 3.8 cm, respectively (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)), whereas the length of the lesion in both cultivars with pre-treated culture suspension of GT2-E were 2.5 &#177; 1.8 and 3.6 &#177; 2.1 cm, respectively (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)).</p></sec><sec id="s3_3"><title>3.3. Suppression of Rice Bacterial Leaf Blight by Post-Treatment with the Culture Suspension of GT2-E</title><p>To investigate the therapeutic effect of rice bacterial leaf blight by the post-treatment with the culture suspension of GT2-E, rice plant cultivars “Asahi” and “Koshihikari” were inoculated with X. oryzae pv. oryzae and were post-treated with the culture suspension of GT2-E 3 days. The result showed that lesion formation in the two cultivars by X. oryzae pv. oryzae was inhibited by GT2-E post-treatment (<xref ref-type="fig" rid="fig3">Figure 3</xref>(a)). In control, the length of the lesion on the leaves of cultivars “Asahi” and “Koshihikari” were 12.1 &#177; 2.6 and 16.3 &#177; 4.3 cm, respectively (<xref ref-type="fig" rid="fig3">Figure 3</xref>(b)), whereas the length of the lesion in both cultivars with post-treated culture suspension of GT2-E were 4.3 &#177; 1.8 and 7.0 &#177; 3.0 cm, respectively (<xref ref-type="fig" rid="fig3">Figure 3</xref>(b)).</p></sec><sec id="s3_4"><title>3.4. Identification and Characterization of GT2-E</title><p>To identify the GT2-E isolate, we used specific PCR primers to amplify the 16S rDNA. The phylogenetic analyses showed that the microorganism was most</p><p>closely related to the strain type of Paenibacillus polymyxa NBRC 15309 (<xref ref-type="fig" rid="fig4">Figure 4</xref>) In the present study, the growth of GT2-E was observed at 15˚C, 28˚C, 37˚C, and 45˚C, but not at 4˚C. The optimum temperature of the growth of GT2-E was 28˚C - 37˚C (<xref ref-type="table" rid="table2">Table 2</xref>). Furthermore, no inhibitory activity on the growth of GT2-E was observed in the presence of agrochemical against rice diseases, such as Amister, Blasin, and Kasumin (<xref ref-type="table" rid="table3">Table 3</xref>).</p></sec><sec id="s3_5"><title>3.5. Effect of the Culture Filtrate of GT2-E on the Growth of X. oryzae pv. oryzae</title><p>For evaluating the inhibitory effect of the culture filtrate of GT2-E isolate, we</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Effect of temperature on growth of isolate GT2-E under different incubation temperature</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Isolate</th><th align="center" valign="middle"  colspan="5"  >Temperature(˚C)</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >GT2-E</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >15</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >37</td><td align="center" valign="middle" >45</td></tr><tr><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >++</td><td align="center" valign="middle" >++</td><td align="center" valign="middle" >+</td></tr></tbody></table></table-wrap><p>-: means no growth, +: means moderate growth, ++: means maximum growth.</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Effect of agrochemical on growth of isolate GT2-E on agrochemical amended LB medium</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Isolate</th><th align="center" valign="middle"  colspan="4"  >Agrochemical</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >GT2-E</td><td align="center" valign="middle" >Control</td><td align="center" valign="middle" >Blasin</td><td align="center" valign="middle" >Kasumin</td><td align="center" valign="middle" >Amister</td></tr><tr><td align="center" valign="middle" >++</td><td align="center" valign="middle" >++</td><td align="center" valign="middle" >++</td><td align="center" valign="middle" >++</td></tr></tbody></table></table-wrap><p>++: means maximum growth was observed.</p><p>investigated the effects of the culture filtrate of GT2-E isolate on the growth of X. oryzae pv. oryzae by the disk diffusion method. Culture filtrate of GT2-E inhibited X. oryzae pv. oryzae growth compared to control (<xref ref-type="fig" rid="fig5">Figure 5</xref>(a)). The diameter of the inhibition zone in the petri dish containing disc inoculated with the culture filtrate of GT2-E isolate was 21.7 &#177; 2.4 mm (<xref ref-type="fig" rid="fig5">Figure 5</xref>(b)). In contrast, the inhibition zone was not observed in the control plates in the absence of the isolated microorganism (<xref ref-type="fig" rid="fig5">Figure 5</xref>(b)). We also determined the inhibitory effect of heat-treated GT2-E culture filtrate. The result showed that heat-treated GT2-E culture filtrate did not inhibit the growth of X. oryzae pv. oryzae (<xref ref-type="fig" rid="fig6">Figure 6</xref>(a)). The diameter of the inhibition zone in the petri dish containing discs</p><p>inoculated with the culture filtrate and heat-treated culture filtrate of GT2-E isolate was 17.9 &#177; 1.8 and 0.0 &#177; 0.0 mm, respectively (<xref ref-type="fig" rid="fig6">Figure 6</xref>(b)).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Rice (Oryzae sativa L.) is one of the second staple food crops after wheat across the world. Rice plants are under constant threats owing to many diseases. Rice bacterial leaf blight is one of the most destructive bacterial disease that rendered considerable yield and economics losses. Control strategies applied against rice bacterial leaf blight mainly involve the use of chemicals and resistance cultivars. Several chemicals and broad-spectrum antibiotics have been recommended for the control of rice bacterial leaf blight [<xref ref-type="bibr" rid="scirp.83472-ref6">6</xref>] . However, chemical control has been known to have several disadvantages, e.g., causing detrimental effects on the ecosystem and human health, is costly, and use of chemical control potentially leads to pathogen resistance [<xref ref-type="bibr" rid="scirp.83472-ref7">7</xref>] . In addition, host resistance gene deployment is one of the solutions for rice bacterial leaf blight. However, the rapid adaptation of rice bacterial leaf blight population may affect the durability of the resistance genes [<xref ref-type="bibr" rid="scirp.83472-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.83472-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.83472-ref14">14</xref>] . Biological control might assume a special significance in being an environmental friendly and cost effective alternative for the management of rice bacterial leaf blight. Furthermore, development of resistance to biological control by antagonistic bacteria has not been reported. Several antagonistic bacteria such as Pseudomonas fluorescens, Bacillus sp. and Burkholderia sp. against rice bacterial leaf blight have been identified and extensively studied. Geographically, Shimane prefecture is extended from the east to west and has various characteristic diversities of climate in each region. Consequently, soil of the Shimane prefecture is expected to have diverse microbial resources. We reported that microorganisms isolated from the soil of Gotsu city (Shimane prefecture) suppress rice blast disease caused by Magnaporthe oryzae [<xref ref-type="bibr" rid="scirp.83472-ref11">11</xref>] . In this study, it was observed that GT2-E had inhibitory activity against X. oryzae pv. oryzae. The phylogenetic analysis of the GT2-E isolate revealed that the organism was most closely related to P. polymyxa.</p><p>Previously, it was reported that the genus Paenibacillus acts as a biocontrol agent and inhibits the growth of Botrytis cinerea, Fusarium oxysporum, Phytophthora palmivora, Pythium, aphanidermatum, and Rhizoctonia solani [<xref ref-type="bibr" rid="scirp.83472-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.83472-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.83472-ref17">17</xref>] . Furthermore, it is well known that the genus Paenibacillus is not only plant growth-promoting rhizobacteria, but also induces resistance against plant diseases [<xref ref-type="bibr" rid="scirp.83472-ref18">18</xref>] .</p><p>However, the effective control of Xanthomas oryzae pv. oryzae by P. polymyxa in rice plants has not yet been elucidated and the inhibitory substances are not yet to be detected.</p><p>In this study, rice bacterial leaf blight (X. oryzae pv. oryzae) was significantly suppressed by GT2-E culture suspension in pre- and post-treated rice plants. This result suggested that GT2-E has prevention and therapeutic effects against rice bacterial leaf blight. Moreover, plant growth promotion activity and induced resistance against plant diseases by GT2-E isolate has not been investigated up to date. Therefore, it will require further investigations in the plant.</p><p>In the present study, the culture filtrate of GT2-E inhibited the growth of X. oryzae pv. oryzae. However, the inhibitory activity of heat-treated culture filtrate was significantly decreased compared to that of non-heat-treated culture filtrate. These results suggested that the GT2-E isolate produced heat-unstable compound(s) against X. oryzae pv. oryzae. It was reported that Paenibacillus sp. produce various types of inhibitory compounds against plant diseases, such as butyl 2,3-dihydroxybenzoate [<xref ref-type="bibr" rid="scirp.83472-ref19">19</xref>] , fusaricidins A, B, and C [<xref ref-type="bibr" rid="scirp.83472-ref20">20</xref>] , pelgipeptins A and B [<xref ref-type="bibr" rid="scirp.83472-ref21">21</xref>] . Therefore, further studies are required to identify the inhibitory compound(s) secreted in the culture filtrate of GT2-E isolate.</p><p>Remarkably, GT2-E isolate was tolerant to several agrochemicals such as Amistar (Azoxystrobin), Blasin (Ferimzone, Phthalide), and Kasumin (Kasugamycin). It is well known that these agrochemicals are used against rice diseases. This result indicated that these agrochemicals can be used for the control of rice diseases along with GT2-E. In addition, the growth of GT2-E isolate was observed at 15˚C - 45˚C. Generally, the disease development of rice bacterial leaf blight caused by X.oryzae pv oryzae occurs at the optimum temperature range from 25˚C - 30˚C. This result indicated that GT2-E will be useful for the control of rice bacterial leaf blight under field conditions. Suppression effect of rice bacterial leaf blight by GT2-E will require further investigation in the field condition.</p></sec><sec id="s5"><title>5. Conclusion</title><p>In conclusion, these results suggested that GT2-E might contribute to the development of a new biocontrol agent against rice disease, such as rice bacterial leaf blight.</p></sec><sec id="s6"><title>Acknowledgements</title><p>The authors are thankful to the Faculty of Life and Environmental Science, Shimane University for providing financial support to publish this report. This investigation was supported and founded by the Project for the Promotion and Enhancement of the Afghan Capacity for Effective Development of the Japan International Cooperation Agency (JICA).</p></sec><sec id="s7"><title>Cite this paper</title><p>Haidary, M.N., Tamura, T. and Ueno, M. (2018) Inhibitory Activity of Paenibacillus sp. Isolated from Soil in Gotsu City, Shimane Prefecture, Against Xanthomas oryzae pv. oryzae, the Causal Agent of Rice Bacterial Leaf Blight. Advances in Microbiology, 8, 197-210. https://doi.org/10.4236/aim.2018.83014</p></sec></body><back><ref-list><title>References</title><ref id="scirp.83472-ref1"><label>1</label><mixed-citation publication-type="book" xlink:type="simple">Pimentel, D. (1997) Pest Management in Agriculture. In: Pimentel, D., Ed., Techniques for Reducing Pesticide Use: Environmental and Economic Benefits, John Wiley &amp; Sons, Chichester, 1-11.</mixed-citation></ref><ref id="scirp.83472-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Akhtar, M.A., Abbasi, F.M., Ahmad, H., Shahzad, M., Shah, M.A. and Shah, A.H. (2011) Evaluation of Rice Germplasm against Xanthomonas oryzae Causing Bacterial Leaf Blight. Pakistan Journal of Botany, 43, 3021-3023.</mixed-citation></ref><ref id="scirp.83472-ref3"><label>3</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Reddy</surname><given-names> P.R. </given-names></name>,<etal>et al</etal>. (<year>1984</year>)<article-title>Kresek Phase of Bacterial Blight of Rice</article-title><source> Oryza</source><volume> 21</volume>,<fpage> 179</fpage>-<lpage>187</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.83472-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Noda, T., Yamamoto, T. and Horino, O. (1996) Geographical Distribution of Pathogenic Races of Xanthomonas oryzae pv oryzae in Japan in 1991 and 1993. Japanese Journal of Phytopathology, 62, 549-553.  
&lt;br /&gt;https://doi.org/10.3186/jjphytopath.62.549</mixed-citation></ref><ref id="scirp.83472-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Ezuka, A. and H. Kaku. (2000) A Historical Review of Bacterial Blight of Rice. Bulletin of the National Institute of Agrobiological Resource.</mixed-citation></ref><ref id="scirp.83472-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Ni&amp;ntilde;o-Liu, D.O., Ronald, P.C. and Bogdanove, A.J. (2006) Xanthomonas oryzae Pathovars: Model Pathogens of a Model Crop. Molecular Plant Pathology, 7, 303-324. &lt;br /&gt;https://doi.org/10.1111/j.1364-3703.2006.00344.x</mixed-citation></ref><ref id="scirp.83472-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Sigee, D.C. (1993) Cell and Molecular Aspects. In: Bacterial Plant Pathology, The Press Syndicate of the University of Cambridge, 126-145.</mixed-citation></ref><ref id="scirp.83472-ref8"><label>8</label><mixed-citation publication-type="book" xlink:type="simple">Gnanamanickam, S.S. (2009) An Overview of Progress in Biological Control. In: Gnanamanickam, S.S., Ed., Biological Control of Rice Diseases: Progress in Biological Control Series, Springer, Dordrecht, 43-51.</mixed-citation></ref><ref id="scirp.83472-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Lemtukei, D., Tamura, T., Nguyen, T.Q., Kihara, J. and Ueno, M. (2016) Antagonistic Potential of Isolated Microorganisms from Soil in Shimane Prefecture against Rice Blast Disease cause by Magnaporthe oryzae. Bulletin of the Faculty of Life and Environmental Science, Shimane University, 21, 9-12.&lt;br /&gt;  
http://ir.lib.shimane-u.ac.jp/files/public/3/38167/20170425034718360341/d0040021002.pdf</mixed-citation></ref><ref id="scirp.83472-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Kauffman, H.E., Reddy, A.P.K., Hsieh, S.P.Y. and Merca, S.D. (1973) An Improved Technique for Evaluating Resistance of Rice Varieties to Xanthomonas oryzae. The Plant Disease Reporter, 57, 537-541.  
&lt;br /&gt;https://babel.hathitrust.org/cgi/pt?id=uc1.31210000921674;view=1up;seq=9</mixed-citation></ref><ref id="scirp.83472-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Lemtukei, D., Tamura, T., Nguyen, T.Q. and Ueno, M. (2017) Inhibitory Activity of Burkholderia sp. Isolated from Soil in Gotsu City, Shimane, against Magnaporthe oryzae. Advances in Microbiology, 7, 137-148.  
&lt;br /&gt;https://doi.org/10.4236/aim.2017.72011</mixed-citation></ref><ref id="scirp.83472-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Dossa, G.S., Sparks, A., Cruz, C.V. and Oliva, R. (2015) Decision Tools for Bacterial Blight Resistance Gene Deployment in Rice-Based Agricultural Ecosystems. Frontiers in Plant Science, 6, 305. &lt;br /&gt;https://doi.org/10.3389/fpls.2015.00305</mixed-citation></ref><ref id="scirp.83472-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Leach, J.E., Vera Cruz, C.M., Bai, J. and Leung, H. (2001) Pathogen Fitness Penalty as a Predictor of Durability of Disease Resistance Genes. Annual Review of Phytopathology, 39, 187-224. &lt;br /&gt;https://doi.org/10.1146/annurev.phyto.39.1.187</mixed-citation></ref><ref id="scirp.83472-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Vera Cruz, C.M., Bai, J., Ona, I., Leung, H., Nelson, R.J., Mew, T.W. and Leach, J.E. (2000) Predicting Durability of a Disease Resistance Gene Based on an Assessment of the Fitness Loss and Epidemiological Consequences of a Virulence Gene Mutation. Proceedings of the National Academy of Sciences of the United States of America, 97, 135000-13505. &lt;br /&gt;https://doi.org/10.1073/pnas.250271997</mixed-citation></ref><ref id="scirp.83472-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Nguyen, X.H., Nating, K. W., Lee, Y.S., Moon, J.H., Lee, J.H. and Kim, K.Y. (2015) Isolation and Characteristics of Protocatechuic Acid from Paenibacillus elgii HOA73 against Botrytis cinerea on Strawberry Fruits. Journal of Basic Microbiology, 55, 625-634. &lt;br /&gt;https://doi.org/10.1002/jobm.201400041</mixed-citation></ref><ref id="scirp.83472-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Son, S.H., Khan, Z., Kim, S.G. and Kim, Y.H. (2009) Plant Growth-Promoting Rhizobacteria, Paenibacillus polymyxa and Paenibacillus lentimorbus Suppress Disease Complex Caused by Root-Knot Nematode and Fusarium Wilt Fungus. Journal of Applied Microbiology, 107, 524-532.  
&lt;br /&gt;https://doi.org/10.1111/j.1365-2672.2009.04238.x</mixed-citation></ref><ref id="scirp.83472-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Timmusk, S., Van West, P., Gow, N.A.R. and Huffstutler, R.P. (2009) Paenibacillus polymyxa Antagonizes Oomycete Plant Pathogens Phytophthora palmivora and Pythium aphanidermatum. Journal of Applied Microbiology, 5, 1473-1481.  
&lt;br /&gt;https://doi.org/10.1111/j.1365-2672.2009.04123.x</mixed-citation></ref><ref id="scirp.83472-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Yaoyao, E., Yuan, J., Yang, F., Wang, L., Ma, J., Li, J., Pu, X., Raza, W., Huang, Q. and Shen, Q. (2017) PGPR Strain Paenibacillus polymyxa SQR-21 Potentially Benefits Watermelon Growth by Re-Shaping Root Protein Expression. AMB Express, 7, 104. &lt;br /&gt;https://doi.org/10.1186/s13568-017-0403-4</mixed-citation></ref><ref id="scirp.83472-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Nguyen, X.H., Naing, K.W., Lee, Y.S. and Kim, K.Y. (2015) Isolation of Butyl 2,3-Dihydroxybenzoate From Paenibacillus elgii HOA73 against Fusarium oxysporum f. sp. Lycopersici. Journal of Phytopathology, 163, 342-352.  
&lt;br /&gt;https://doi.org/10.1111/jph.12324</mixed-citation></ref><ref id="scirp.83472-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Mikkola, R., Anderson, M.A., Grigoriev, P., Heinonen, M. and Salkinoja-Salonen, M.S. (2017) The Toxic Mode of Action of Cyclic Lipodepsipeptide Fusaricidins, Produced by Paenibacillus polymyxa, toward Mammalian Cells. Journal of Applied Microbiology, 123, 436-449. &lt;br /&gt;https://doi.org/10.1111/jam.13498</mixed-citation></ref><ref id="scirp.83472-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Wu, X.C., She, X.B., Ding, R., Qian, C.D., Fang, H.H. and Li, O. (2010) Isolation and Partial Characterization of Antibiotics Produced by Paenibacillus elgii B69. FEMS Microbiology Letters, 310, 32-38.  
&lt;br /&gt;https://doi.org/10.1111/j.1574-6968.2010.02040.x</mixed-citation></ref></ref-list></back></article>