1. Introduction

JEP

Journal of Environmental Protection

2152-2197

Scientific Research Publishing

10.4236/jep.2018.93018

JEP-83367

Articles

Earth&Environmental Sciences

Phosphate Solubilization by Bacillus subtilis and Serratia marcescens Isolated from Tomato Plant Rhizosphere

Eman

A. H. Mohamed

¹^*Azza

G. Farag

²Sahar

A. Youssef

Department of Biotechnology, Faculty of Science, Taif University, Taif, KSA

Botany and Microbiology Department, Faculty of Science, Damanhour University, Damanhour, Egypt

Department of Virus and Phytoplasma Research, Institute of Plant Pathology Research, Agriculture Research Centre, Cairo, Egypt

* E-mail:emanahm@hotmail.com(EAHM);

19032018

090326627723, February 201825, March 2018 28, March 2018

2014

This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/

Plants need phosphorus for many physiological activities in a form of phosphate anions. Three different bacterial strains ( Bacillus subtilis PH, Serratia marcescens PH1, and Serratia marcescens PH2), recently isolated from tomato plant rhizosphere, have high phosphate solubilization index (SI from 2.8 to 3.2) on Pikovskaya agar medium (which contains calcium phosphate). Moreover, phosphate release from calcium in Pikovskaya broth over 5 days is increasing with cell growth for the different isolates. The most efficient phosphate solubilization case is the mixed culture of the 3 strains (OD ₄₇₅ is almost 1). On the other hand, pH values decreased dramatically with time due to organic acids secretion and the maximum acidification level is recoded for Serratia marcescens PH2 (pH = 1.94). Interestingly, the isolates are resistance to important pesticides (oxamyl, thiophanate methyl, and captan) that are commonly used in the sampling area. This resistance is very favorable and increases the persistence of the phosphate solubilizing bacteria in contaminated soils. The isolates are therefore plant symbionts and growth promoting agents.

Phosphate Solubilization Pikovskaya Medium Bacillus subtilis Serratia marcescens

1. Introduction

Phosphorus plays a key role for all life forms [1] . It is essential for several plant physiological activities like photosynthesis, cell division, and others [2] . Its deficiency leads to brown and small leaves, weak stem and slow development [3] [4] . Accordingly, phosphorus is one of the major plant nutrients that limits plant growth [5] . It remains insoluble in the soil like other essential nutrients [6] . Phosphate chemical fertilizers are commonly applied to the soil to increase phosphate availability to plants. Unfortunately, soluble inorganic phosphate in such fertilizers is rapidly immobilized and becomes unavailable to plants [3] . To overcome this serious problem, farmers apply phosphate fertilizers in many fold excess [7] . On the other hand, excessive fertilizers use results in contamination of soil with heavy metals [8] . Therefore, an environmentally friend release of fixed and insoluble phosphorus forms is a necessary for increasing the availability of soil phosphorus to plants [9] [10] [11] .

Natural phosphate solubilization by different microorganisms [12] [13] [14] [15] is therefore an important phenomenon [16] . The predominant microorganisms that naturally solubilize mineral phosphates are bacteria [17] [18] . Phosphate solubilizing bacteria (PSB) which is associated with plant roots is one of the most significant alternatives for inorganic phosphate fertilizers [19] [20] [21] [22] . This group of bacteria is termed plant growth promoting rhizobacteria [23] [24] which includes many genera such as Serratia, Rhizobium, Pseudomonas, Paenibacillus, Flavobacterium, Erwinia, Enterobacter, Burkholderia, Bacillus, Azospirillum, Arthrobacter, Acinetobacter, and Alcaligenes [25] [26] [27] . These bacterial genera are then significant biofertilizers for agricultural improvement. Besides, PSB play a key role in cycling of biogeochemical phosphorus in aquatic and terrestrial environment [28] . PSB transform phosphates into soluble forms by secreting enzymes such as phosphatases and/or organic acids [28] [29] .

In this study, three different bacterial strains, isolated from tomato plant rhizosphere, were selected for their high phosphate solubilization index and molecularly identified using the 16S rDNA sequencing. The strains ability to release phosphate in Pikovskaya broth was also tested as well as resistance against some commonly used pesticides.

2. Materials and Methods2.1. Bacterial Isolation and Purification

Roots of tomato plant (found in a farm located at Nubarya, Beheera governorate, Egypt, in May-2017) were washed with sterile distilled water. Washing water was diluted and plated in nutrient agar (Oxoid, England) plates. The plates were incubated for 24 h at 30˚C. Bacterial colonies were carefully examined and predominant phenotypes were randomly selected and purified.

2.2. Detection and Efficiency Estimation of Phosphate Solubilizing Bacteria

Predominant colonies were selected and tested for production of halozones on Pikovskaya agar (Techno Pharm Chem, Haryana, India) plates to detect phosphate solubilizing bacteria [25] . In 48 h of incubation at 30˚C, colonies showing halozones were selected to test their solubilization index (SI). However, colonies with the highest SI values were chosen for further experiments. Phosphate SI was determined by measuring both colony and halozone diameters using Edipremono et al. [30] formula:

Phosphate SI = (colony diameter + halozone diameter)/colony diameter

Quantitative analysis of phosphate solubilization by bacterial isolates was performed in vitro using Pikovskaya broth. Conical flasks containing that broth medium were inoculated with separate and mixed bacterial cultures in triplicates at 30˚C for 5 days on a rotary shaker at 150 rpm. After regular intervals, cultures were centrifuged at 5000 rpm for 10 min and available soluble phosphate was measured in supernatants spectrophotometrically at 475 nm using phosphomolybdate method [31] . In this method, quantification of phosphorous requires the conversion of the phosphorus to dissolved orthophosphate followed by colorimetric determination of dissolved orthophosphate. Ammonium molybdate and antimony potassium tartrate react in an acid medium with diluted solutions of orthophosphate to form an intensely colored antimony-phospho-molybdate complex. This complex is reduced to an intensely blue-colored complex by ascorbic acid. The color is proportional to the phosphorus concentration.

Besides, cultures optical densities at 550 nm were measured before centrifugation and pH values were also recorded.

2.3. Morphological Characterization and Pesticides Resistance

Some morphological features of the isolates were determined such as colony color, cell shape, and Gram stain reaction. Besides, isolates resistance to some commonly used pesticides (oxamyle, thiophonate methyl, and captan) was also tested. Oxamyl is a nematocide (Medmac, Jordon), thiophonate methyl is a fungicide (Wuxi xinan pesticides Co. Ltd., China), and captan is also a fungicide (Arysta Life Science, France). The resistance test was performed using nutrient agar plates supplemented with different pesticides concentrations. Plates were then incubated for 48 h at 30˚C.

2.4. 16S rDNA Sequencing and Analysis

For bacterial identification, the 16S rDNA partial sequencing (approx 900 pb) was performed using the universal and specific primers listed in Table 1 at Macrogen incorporation, Soul, Korea. Sequencing was performed using Big dye terminator cycle sequencing kit (Applied Biosystems, USA). Sequencing products were then analyzed on an Applied Biosytems model 3730XL Automated DNA Sequencing System (Applied Biosystems, USA). Finally, sequences were analyzed at DDBJ (DNA Data Bank of Japan) using BLASTN program [32] . After deposition in the GenBank, sequences accession numbers were obtained and listed in Results.

3. Results and Discussion

Predominant colonies in soil that is directly attached to tomato roots were selected and tested for production of halozones on Pikovskaya agar plates to detect phosphate solubilizing bacteria. Accordingly, solubilization index (SI) values were measured for all of them (data not shown). However, three isolates (C2, T1, and T5) were found to have the highest SI values and therefore were selected for further experiments. Firstly, the three unique isolates were subjected to molecular identification by partial sequencing of the 16S rDNA gene and the accession numbers of the sequences were listed in Table 2. The strains are found to be Bacillus subtilis strain PH (C2), Serratia marcescens strain PH1 (T1), and Serratia marcescens strain PH2 (T5). Secondly, the phosphate solubilization ability of the strains was qualified on Pikovskaya plates. The three strains are potent phosphate solubilizers and the halozone diameter is almost double of the colony diameter (Table 3). Values of solubilization index, SI, are relatively close to each other among the isolates. Similar results have been obtained by Paul and Sinha, 2017 [4] . They recorded a SI of 2.85 for their bacterium, Pseudomonas aeroginosa KUPSB12, using Pikovskaya agar plates. These clear zones around colonies are due to the solubilization of phosphate found in Pikovskaya medium. Phosphate solubilization may be due to the production of organic acids, polysaccharides or phosphatases [33] [34] . Uma Maheswar and Sathiyavani, 2012, [35] reported that B. subtilis and B. cereus are forming halozones in Pikoviskaya agar medium due to solubilization of calcium phosphate. In addition, Widiastuti, 2008, [36] stated that the ratio of clearing zone to colony diameter for two different Serratia marcescens isolates were approximately 2.1 and 1.9.

Table 1 Primers used in amplification and sequencing

Primer	Primer sequence (5’-3’)	Amplification	Sequencing
27F	AGAGTTTGATCMTGGCTCAG	•
1492R	TACGGYTACCTTGTTACGACTT	•
518F	CCAGCAGCCGCGGTAATACG		•
800R	TACCAGGGTATCTAATCC		•

Table 2 Accession numbers of the new bacterial isolates

code	strain	Accession number
T1	Serratia marcescens PH1	LC335898
C2	Bacillus subtilis PH	LC335897
T5	Serratia marcescens PH2	LC335899

Table 3 Phosphate solubilization index (SI) for the bacterial isolates

Isolate code	Strain	Colony diameter (cm)	Halozone diameter (cm)	SI
T1	Serratia marcescens PH1	0.5 ± 0.03	1.1 ± 0.05	3.2
C2	Bacillus subtilis PH	0.5 ± 0.02	1 ± 0.1	3
T5	Serratia marcescens PH2	0.5 ± 0.05	0.9 ± 0.05	2.8

Thirdly, some morphological traits for the recent isolates are illustrated in Table 4. Interestingly, Serratia marcescens has a red color in nutrient agar medium and loses the pigment in Pikovskaya plates. It is obvious that medium composition affects pigment production by Serratia marcescens [37] . This is may be due to the difference in nitrogen source. Pikovskaya medium contains inorganic nitrogen (ammonium sulphate) while the nutrient agar contains organic nitrogen (beef extract and peptone) [36] . However, the red pigment, prodigiosin, results from secondary metabolism of Serratia marcescens [37] .

For more characterization of the recent isolates, resistance against some pesticides (captan, Thiophonate methyl, and oxamyl) is also tested and the results are recorded in Table 5. Generally, the isolates showed relatively high resistance against captan and Thiophonate methyl. Lower resistance was detected against oxamyl. However, both of Serratia marcescens strains scored the highest resistance levels against captan. On the other hand, Bacillus subtilis PH is the most resistant against thiophonate methyl. Resistance against pesticides, which are commonly used at the sampling area, is an advantage for phosphate solubilizing bacteria because it means more persistence in that harsh environment.

Finally, cell growth patterns and phosphate release of the three newly isolated strains as well as pH changes with time are clearly shown in Figures 1(a)-(d). Obviously, phosphate release which is in a direct proportion with OD475 and cell growth are increasing with days for all of the isolates. However, the mixed culture of the 3 isolates is the most efficient case in phosphate release (Figure 1(d)). On the other hand, pH is decreasing with time due to the secretion of organic acids into the medium for solubilization of calcium phosphate found in Pikovskaya broth [3] . The maximum drop in pH values was parallel with increased

Table 4 Morphological characterization of the new isolates

Characteristic	Isolates
Characteristic	S. marcescens PH1	B. subtilis PH	S. marcescens PH2
Colony color in nutrient agar	Dark red	White	Slight red
Colony color in Pikovskaya agar	White	White	White
Gram reaction	Negative	Positive	Negative
Cell shape	Rods	Rods	Rods

Table 5 Resistance of the isolates against some commonly used pesticides

Isolate	Pesticide concentration in ppm
Isolate	Captan	Thiophonate methyl	Oxamyl
Serratia marcescens PH1	2000	1000	150
Bacillus subtilis PH	200	2000	150
Serratia marcescens PH2	2000	500	150

phosphate solubilization levels. The maximum acidification level was recorded for Serratia marcescens strain PH2 (pH = 1.94). However, in the mixed culture medium, pH dropped dramatically to 1 in 5 days from an initial point of 7. Phosphate solubilizing bacteria are usually produce lactic, gluconic, isobutyric, ketogluconic, oxalic, acetic, and citric acids. Besides, the mechanism of mineral phosphate solubilization is due to production of organic acids and/or phosphatases [38] [39] [40] . However, inorganic phosphate is solubilized by both organic and inorganic acids of phosphate solubilizing bacteria. Carboxyl and hydroxyl groups in these acids chelate Ca, Fe, and Al cations [41] . Usually, calcium phosphates (including rock phosphate ores) are insoluble in soil [41] . Gerretsen [42] reported that when pure cultures of soil bacteria are added to the soil, plant phosphate nutrition is increased throughout increased calcium-phosphate solubility. Soil pH is decreased in parallel and therefore phosphate solubilization is the net result of both pH decrease and acids production [43] . In other words, carboxylic and hydroxylic anions produced by phosphate solubilizing bacteria have high calcium affinity and therefore can solubilize more phosphorus than acidification alone [44] . Accordingly, there is a symbiotic relationship between plants and phosphate solubilizing bacteria [45] [46] , as bacteria provide the soluble phosphate and plant roots provide carbon compound such as sugars [47] . The net result of this relationship is crop production enhancement [48] [49] . The most significant solubilizers of phosphate are mainly belonging to Bacillus spp. such as B. subtilis, B. cereus, B. polymyxa, B. circulans, B. circalmous and B. megaterium [50] . Patil, 2014, [51] has reported that B. subtilis is a powerful phosphate solubilizer that tolerates soil salinity. Besides, phosphate solubilizing Bacillus megaterium mj1212 regulates endogenous plant carbohydrates and amino acids contents to promote Mustard plant growth [52] .

In 2008, Widiastuti [36] reported phosphate solubilization in Pikovskaya medium by Serratia marcescens and stated the relationship between phosphate solubilization and red pigment production. Previous studies reported the production of organic acids by Serratia marcescens [53] . Others proved the presence of genes such as pqq and gdh which are coding for phosphatase activity in Serratia marcescens [54] [55] as well as Pseudomonas [56] . Moreover, Lavania and Nautiyal [57] recorded that the soil isolate S. marcescens NBRI1213 is an efficient phosphate solubilizer and a potential plant growth promoting agent. Besides, Behera et al., and others [1] [58] [59] [60] [61] stated acid phosphatase production by Serratia. In addition to phosphate solubilization, Serratia and Alcaligenes faecalis have an antagonistic activity against plant pathogens [62] [63] [64] and can produce hydroxyl apatite [65] . In our research, the maximum phosphate solubilization efficiency was recorded in 5 days for the mixed culture followed by Serratia marcescens PH1. Previous studies recorded different periods to reach maximum phosphate solubilization. For instance, some researchers have reported 3, 4, 10, and even up to 15 days [66] .

4. Conclusions

In the present study, three different tomato rhizosphere bacterial strains are used for phosphate solubilization in Pikovskaya medium. These isolates are characterized by:

1) High phosphate solubilization index.

2) Increasing ability to release mineral phosphate over days with a dramatic decrease in pH values.

3) Resistance to pesticides that are commonly used in the sampling location.

All of these advantages make the bacterial isolates suitable as plant growth promoting symbionts that persist contamination conditions and make free phosphate anions available for plants.

Cite this paper

Mohamed, E.A.H., Farag, A.G. and Youssef, S.A. (2018) Phosphate Solubilization by Bacillus subtilis and Serratia marcescens Isolated from Tomato Plant Rhizosphere. Journal of Environmental Protection, 9, 266-277. https://doi.org/10.4236/jep.2018.93018

References1

Behera, B.C., Yadav, H., Singh, S.K., Mishra, R.R., Sethi, B.K., Dutta, S.K. and Thatoi, H.N. (2017) Phosphate Solubilization and Acid Phosphatase Activity of Serratia sp. Isolated from Mangrove Soil of Mahanadi River Delta, Odisha, India. Journal of Genetic Engineering and Biotechnology, 15, 169. https://doi.org/10.1016/j.jgeb.2017.01.003

Guptaa, M., Kiranc, S., Gulatic, A., Singhd, B. and Tewaria, R. (2012) Isolation and Identification of Phosphate Solubilizing Bacteria Able to Enhance the Growth and Aloin—A Biosynthesis of Aloe barbadensis Miller. Microbiological Research, 167, 358-363. https://doi.org/10.1016/j.micres.2012.02.004

Yadav, K.S. and Dadarwal, K.R. (1997) Phosphate Solubilization and Mobilization through Soil Microorganisms. In: Dadarwal K.R., Ed., Biotechnological Approaches in Soil Microorganisms for Sustainable Crop Production, Jodhpur, India, 293.

Paul, D. and Sinha, S.N. (2017) Isolation and Characterization of Phosphate Solubilizing Bacterium Pseudomonas aeruginosa KUPSB12 with Antibacterial Potential from River Ganga, India. Annals of Agricultural Sciences, 15, 130.

Bidondo, L.F., Bompadre, J., Pergola, M., Silvani, V., Colombo, R., Bracamonte, F. and Godeas, A. (2012) Differential Interaction between Two Glomus Intraradices Strains and a Phosphate Solubilizing Bacterium in Maize Rhizosphere. Pedobiologia, 55, 227-232. https://doi.org/10.1016/j.pedobi.2012.04.001

Yadav, K.S. and Dadarwal, K.R. (1997) Phosphate Solubilization and Mobilization through Soil Microorganisms. In: Dadarwal, K.R., Ed., Biotechnological Approaches in Soil Microorganisms for Sustainable Crop Production, Jodhpur, India, 293.

Islama, M.T., Deoraa, A., Hashidokoa, Y., Rahmana, A., Itoa, T. and Taharaa, S. (2007) Isolation and Identification of Potential Phosphate Solubilizing Bacteria from the Rhizoplane of Oryza sativa L. cv. BR29 of Bangladesh. Zeitschrift für Naturforschung C, 62c, 103. https://doi.org/10.1515/znc-2007-1-218

Susilowati, L.E. and Syekhfani, S. (2014) Characterization of Phosphate Solubilizing Bacteria Isolated from Pb Contaminated Soils and Their Potential for Dissolving Tricalcium Phosphate. Journal of Degraded and Mining Lands Management, 1, 57-62.

Martinez-Viveros, O., Jorquera, M., Crowley, D., Gajardo, G. and Mora, M. (2010) Mechanisms and Practical Considerations Involved in Plant Growth Promotion by Rhizobacteria. Journal of Soil Science and Plant Nutrition, 10, 293-319. https://doi.org/10.4067/S0718-95162010000100006

Whiteside, M.D., Garcia, M.O. and Treseder, K.K. (2012) Amino Acid Uptake in Arbuscular Mycorrhizal Plants. PLoS One, 7, 476. https://doi.org/10.1371/journal.pone.0047643

Kang, S.M., Khan, A.L., Hamayun, M., Shinwar, Z.K., Kim, Y.H., Joo, G.J. and Lee, I.J. (2012) Acinetobacter calcoaceticus Ameliorated Plant Growth and Influenced Gibberellin and Functional Biochemical. Pakistan Journal of Botany, 44, 365-372.

Vassileva, M., Serrano, M., Bravo, V., Jurado, E., Nikolaeva, I., Martos, V. and Vassilev, N. (2010) Multifunctional Properties of Phosphate-Solubilizing Microorganisms Grown on Agro-Industrial Wastes in Fermentation and Soil Conditions. Applied Microbiology and Biotechnology, 85, 1287-1299. https://doi.org/10.1007/s00253-009-2366-0

Banerjee, S., Palit, R., Sengupta, C. and Standing, D. (2010) Stress Induced Phosphate Solubilization by Arthrobacter sp. and Bacillus sp. Isolated from Tomato Rhizosphere. Australian Journal of Crop Science, 4, 378-383.

Mohammadi, K., Ghalavand, A., Aghaalikhani, M., Heidari, G.R. and Sohrabi, Y. (2011) Introducing the Sustainable Soil Fertility System for Chickpea (Cicer arietinum L.). African Journal of Biotechnology, 10, 6011-6020.

Mohammadi, K. (2011) Soil, Plant and Microbe Interaction. Lambert Academic Publication, Latvia, European Union, 120 p.

Collavino, M.M., Sansberro, P.A., Mroginski, L.A. and Aguilar, O.M. (2010) Comparison of in Vitro Solubilization Activity of Diverse Phosphate-Solubilizing Bacteria Native to Acid Soil and Their Ability to Promote Phaseolus vulgaris Growth. Biology and Fertility of Soils, 46, 727-738. https://doi.org/10.1007/s00374-010-0480-x

Yin, R. (1988) Phosphate-Solubilization Microbes in Non-Irrigated Soils in China. Soils, 20, 243.

Hayat, R., Ali, S., Amara, U., Khalid, R. and Ahmed, I. (2010) Soil Beneficial Bacteria and Their Role in Plant Growth Promotion: A Review. Annals of Microbiology, 60, 579-598. https://doi.org/10.1007/s13213-010-0117-1

Thakuria, D., Talukdar, N.C., Goswami, C., Hazarika, S., Boro, R.C. and Khan, M.R. (2004) Characterization and Screening of Bacteria from Rhizosphere of Rice Grown in Acidic Soils of Assam. Current Science, 86, 978-985.

Mahmood, M., Rahman, Z.A., Saud, H.M., Shamsuddin, Z.H. and Subramaniam, S. (2010) Influence of Rhizobacterial and Agro-Bacterial Inoculation on Selected Physiological and Biochemical Changes of Banana Cultivar, Berangan (AAA) Plantlets. Journal of Agricultural Science, 2, 115-137.

Mamta, G., Bisht, S., Singh, B., Gulati. A. and Tewari, R. (2011) Enhanced Biomass and Steviol Glycosides in Stevia rebaudiana Treated with Phosphate-Solubilizing Bacteria and Rock Phosphate. Plant Growth Regulation, 65, 449-457. https://doi.org/10.1007/s10725-011-9615-9

Mamta, R.P., Pathania, V., Gulati, A., Singh, B., Bhanwra, R.K. and Tewari, R. (2010) Stimulatory Effect of Phosphate-Solubilizing Bacteria on Plant Growth, Stevioside and Rebaudioside-A Contents of Stevia rebaudiana Bertoni. Applied Soil Ecology, 46, 222-229. https://doi.org/10.1016/j.apsoil.2010.08.008

Sandeep, C., Thejas, M.S., Patra, S., Gowda, T., Venkat-Raman, R., Radhika, M., Suresh, C.K. and Mulla, S.R. (2011) Growth Response of Ayapana on Inoculation with Bacillus megaterium Isolated from Different Soil Types of Various Agroclimatic Zones of Karnataka. Journal of Phytology, 3, 13-18.

Kuhad, R.C., Singh, S., Lata and Singh, A. (2011) Phosphate Solubilizing Microorganisms. In: Singh, A., Parmar, N. and Kuhad, R.C., Eds., Bioaugmentation, Biostimulation and Biocontrol, Soil Biology Series, Vol. 28, Springer, Heidelberg, 65-84. https://doi.org/10.1007/978-3-642-19769-7_4

Pikovskaya, R.I. (1948) Mobilization of Phosphorous in Soil Connection with the Vital Activity of Some Microbial Species. Microbiologia, 17, 362.

Marra, L.M., Soares, C.R., Oliveira, S.M., Ferreira, P.A.A., Soares, B.L., Carvalho, R.F., Lima, J.M. and Moreira, F.M. (2012) Biological Nitrogen Fixation and Phosphate Solubilization by Bacteria Isolated from Tropical Soils. Plant and Soil, 357, 289-307. https://doi.org/10.1007/s11104-012-1157-z

Zeng, Q., Luo, F., Zhang, Z., Yan, R.M. and Zhu, D. (2012) Phosphate Solubilizing Rhizosphere Bacterial T21 Isolated from Dongxian Wild Rice Species Promotes Cultivated Rice Growth. Applied Mechanics and Materials, 108, 167-175. https://doi.org/10.4028/www.scientific.net/AMM.108.167

Das, S., Lyla, P.S. and Khan, S.A. (2007) Biogeochemical Processes in the Continental Slope of Bay of Bengal: I. Bacterial Solubilization of Inorganic Phosphate. Revista de Biologia Tropical, 55, 1-9.

Stephen, J. and Jisha, M.S. (2011) Gluconic Acid Production as the Principal Mechanism of Mineral Phosphate Solubilization by Burkholderia sp. (MTCC 8369). Journal of Tropical Agriculture, 49, 99-103.

Edi-Premono, M., Moawad, A.M. and Vleck, P.L.G. (1996) Effect of Phosphate Solubilizing Pseudomonas Putida on the Growth of Maize and Its Survival in the Rhizosphere. Indonesian Journal of Crop Science, 11, 13.

Watanabe, F.S. and Olsen, S.R. (1965) Test of an Ascorbic Acid Method for Determining Phosphorus in Water and NaHCO3 Extracts from Soil. Soil Science Society of America Journal, 29, 677-678. https://doi.org/10.2136/sssaj1965.03615995002900060025x

Zhang, Z., Schwartz, S., Wagner, L. and Miller, W. (2000) A Greedy Algorithm for Aligning DNA Sequences. Journal of Computational Biology, 7, 203-214. https://doi.org/10.1089/10665270050081478

Paul, D. and Sinha, S.N. (2013) Isolation of Phosphate Solubilizing Bacteria and Total Heterotrophic Bacteria from River Water and Study of Phosphate Activity of Phosphate Solubilizing Bacteria. Advances in Applied Science Research, 4, 409-412.

Paul, D. and Sinha, S.N. (2013) Phosphate Solubilization Potential and Phosphate Activity of Some Bacterial Strains Isolated from Thermal Power Plant Effluent Exposed Water of River Ganga. CIBTech Journal of Microbiology, 2, 1-7.

Maheswar, N.U. and Sathiyavani, G. (2012) Solubilization of Phosphate by Bacillus Sps, from Groundnurt Rhizosphere (Arachis hypogaea L). Journal of Chemical and Pharmaceutical Research, 4, 4007-4001.

Widiastuti, H. (2008) Characteristics of Phosphate-Solubilizing Bacteria Isolated from Acid Soil of Cikopomayak, West Java, Indonesia. Microbiology Indonesia, 2, 115-118. https://doi.org/10.5454/mi.2.2.4

Helvia, W., Araújo, C., Fukushima, K. and Takaki, G.M.C. (2010) Prodigiosin Production by Serratia marcescens UCP 1549 Using Renewable-Resources as a Low Cost Substrate. Molecule, 15, 6931-6840. https://doi.org/10.3390/molecules15106931

Prasanna, R., Joshi, M., Rana, A., Shivay, Y.S. and Nain, L. (2011) Influence of Co-Inoculation of Bacteria-Cyanobacteria on Crop Yield and C-N Sequestration in Soil under Rice Crop. World Journal of Microbiology and Biotechnology, 28, 1223-1235. https://doi.org/10.1007/s11274-011-0926-9

Walpola, B.C. and Yoon, M.-H. (2013) In Vitro Solubilisation of Inorganic Phosphates by Phosphate Solubilizing Microorganisms. African Journal of Microbiology Research, 7, 3534-3541.

Stevenson, F.J. (2005) Cycles of Soil: Carbon, Nitrogen, Phosphorus, Sulfur, Micronutrients. John Wiley and Sons, Hoboken.

Gerretsen, F.C. (1948) The Influence of Microorganisms on the Phosphate Intake by the Plant. Plant and Soil, 1, 51-81. https://doi.org/10.1007/BF02080606

Fankem, H., Nwaga, D., Deubel, A., Dieng, L., Merbach, W. and Etoa, F.X. (2006) Occurrence and Functioning of Phosphate Solubilizing Microorganisms from Oil Palm Tree (Elaeis guineensis) Rhizosphere in Cameroon. African Journal of Biotechnology, 5, 2450-2460.

Staunton, S. and Leprince, F. (1996) Effect of pH and Some Organic Anions on the Solubility of Soil Phosphate: Implications for P Bioavailability. European Journal of Soil Science, 47, 231-239. https://doi.org/10.1111/j.1365-2389.1996.tb01394.x

Bulgarelli, D., Schlaeppi, K., Spaepen, S., Ver Loren van Themaat, E. and Schulze-Lefert, P. (2013) Structure and Functions of the Bacterial Microbiota of Plants. Annual Review of Plant Biology, 64, 807-838. https://doi.org/10.1146/annurev-arplant-050312-120106

Hussein, K.A. and Joo, J.H. (2015) Isolation and Characterization of Rhizomicrobial Isolates for Phosphate Solubilization and Indole Acetic Acid Production. Journal of the Korean Society for Applied Biological Chemistry, 58, 847-855. https://doi.org/10.1007/s13765-015-0114-y

Behera, B.C., Singdevsachan, S.K., Mishra, R.R., Dutta, S.K. and Thatoi, H.N. (2014) Diversity, Mechanism and Biotechnology of Phosphate Solubilizing Microorganism in Mangrove. Biocatalysis and Agricultural Biotechnology, 3, 97-110. https://doi.org/10.1016/j.bcab.2013.09.008

Mohammadi

,et al. (2012)Phosphorus Solubilizing Bacteria: Occurrence, Mechanisms and Their Role in Crop Production Resources and Environment 2, 80-85.

Patel, K.J., Singh, A.K., Nareshkumar, G. and Archana, G. (2010) Organic-Acid-Producing, Phytate-Mineralizing Rhizobacteria and Their Effect on Growth of Pigeon Pea (Cajanus cajan). Applied Soil Ecology, 44, 252-261. https://doi.org/10.1016/j.apsoil.2010.01.002

Kucey, R.M.N., Janzen, H.H. and Legget, M.E. (1989) Microbial Mediated Increases in Plant-Available Phosphorus. Advances in Agronomy, 42, 199-228. https://doi.org/10.1016/S0065-2113(08)60525-8

Patil

V.S.

,et al. (2014)Bacillus subtilis: A Potential Salt Tolerant Phosphate Solubilizing Bacterial Agent International Journal of Life Sciences Biotechnology and Pharma Research 3, 141-145.

Kang, S.-M., Radhakrishnan, R., You, Y.-H., Joo, G.-J., Lee, I.-J., Lee, K.-E. and Kim, J.-H. (2014) Phosphate Solubilizing Bacillus megaterium mj1212 Regulates Endogenous Plant Carbohydrates and Amino Acids Contents to Promote Mustard Plant Growth. Indian Journal of Microbiology, 54, 427-433. https://doi.org/10.1007/s12088-014-0476-6

Chen, Y.P., Rekha, P.D., Arun, A.B., Shen, F.T., Lai, W.A. and Young, C.C. (2006) Phosphate Solubilizing Bacteria from Subtropical Soil and Their Tricalcium Phosphate Solubilising Abilities. Applied Soil Ecology, 34, 33-41. https://doi.org/10.1016/j.apsoil.2005.12.002

Khan, A.R., Park, G., Asaf, S., Hong, S., Jung, K. and Shin, J. (2017) Complete Genome Analysis of Serratia marcescens RSC-14: A Plant Growth-Promoting Bacterium That Alleviates Cadmium Stress in Host Plants. PLoS ONE, 12, e0171534. https://doi.org/10.1371/journal.pone.0171534

Ben Farhat, M., Fourati, A. and Chouayekh, H. (2013) Coexpression of the Pyrroloquinoline Quinone and Glucose Dehydrogenase Genes from Serratia marcescens CTM 50650 Conferred High Mineral Phosphate-Solubilizing Ability to Escherichia coli. Applied Biochemistry and Biotechnology, 170, 1738-1750.

Meyer, J.B., Frapolli, M., Keel, C. and Maurhofer, M. (2011) Pyrroloquinoline Quinone Biosynthesis Gene pqqC, a Novel Molecular Marker for Studying the Phylogeny and Diversity of Phosphate-Solubilizing Pseudomonads. Applied and Environmental Microbiology, 77, 7345-7354. https://doi.org/10.1128/AEM.05434-11

Lavania, M. and Nautiyal, C.S. (2013) Solubilization of Tricalcium Phosphate by Temperature and Salt Tolerant Serratia marcescens NBRI1213 Isolated from Alkaline Soils. African Journal of Microbiology Research, 7, 4403-4413.

Schoebitz, M., Ceballos, C. and Ciampi, L. (2013) Effect of Immobilized Phosphate Solubilizing Bacteria on Wheat Growth and Phosphate Uptake. Journal of Soil Science and Plant Nutrition, 13, 1-10. https://doi.org/10.4067/S0718-95162013005000001

Farhat, M.B., Taktek, S. and Chouayekh, H. (2014) Encapsulation in Alginate Enhanced the Plant Growth Promoting Activities of Two Phosphate Solubilizing Bacteria Isolated from the Phosphate Mine of Gafsa. The Journal of Agricultural Science, 2, 131-139.

Anzuay, M.S., Luduena, L.M., Angelini, G.J., Fabra, A. and Taurian, T. (2015) Beneficial Effects of Native Phosphate Solubilizing Bacteria on Peanut (Arachis hypogaea L) Growth and Phosphorus Acquisition. Symbiosis, 66, 89-97. https://doi.org/10.1007/s13199-015-0337-z

Sharma, S.B., Sayyed, R.Z., Trivedi, M.H. and Gobi, T.A. (2013) Phosphate Solubilizing Microbes: Sustainable Approach for Managing Phosphorus Deficiency in Agricultural Soils. SpringerPlus, 2, 587. https://doi.org/10.1186/2193-1801-2-587

Chakraborty, U., Chakraborty, B.N. and Chakraborty, A.P. (2010) Influence of Serratia marcescens TRS-1 on Growth Promotion and Induction of Resistance in Camellia sinensis against Fomes lamaoensis. Journal of Plant Interactions, 5, 261-272. https://doi.org/10.1080/17429140903551738

Nandini, K., Preethi, U. and Earaana, N. (2014) Molecular Identification of Phosphate Solubilizing Bacterium (Alcaligenes faecalis) and Its Interaction Effect with Bradyrhizobium japonicum on Growth and Yield of Soybean (Glycine max L.). African Journal of Biotechnology, 13, 3450-3454. https://doi.org/10.5897/AJB2013.13343

Sayyed, R.Z., Gangurde, N.S., Patel, P.R., Joshi, S.A. and Chin-cholker, S.B. (2010) Siderophore Production by Alcaligenes faecalis and Its Application for Growth Promotion in Arachis hypogaea. Indian Journal of Biotechnology, 9, 302-307.

Sammon, R., Hikoy, T., Radeva, E., Presker, R., Mitev, D., Pramatarova, L. and Bulg, J. (2014) Biomineralisation on the Composites of Silicon-Based Polymer and Nanodiamond Particles by a Species of Serratia Bacteria. Bulgarian Journal of Physics, 41, 217-224.

Sridevi, M. and Mallaiah, K.V. (2009) Phosphate Solubilizing by Rhizobium Strains. Indian Journal of Microbiology, 49, 98-102. https://doi.org/10.1007/s12088-009-0005-1