<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">JTR</journal-id><journal-title-group><journal-title>Journal of Tuberculosis Research</journal-title></journal-title-group><issn pub-type="epub">2329-843X</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/jtr.2018.61004</article-id><article-id pub-id-type="publisher-id">JTR-82869</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Medicine&amp;Healthcare</subject></subj-group></article-categories><title-group><article-title>
 
 
  The Prediction Factors of Pre-XDR and XDR-TB among MDR-TB Patients in Northern Thailand
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Risara</surname><given-names>Jaksuwan</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jayanton</surname><given-names>Patumanond</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Prasit</surname><given-names>Tharavichikul</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Charoen</surname><given-names>Chuchottaworn</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Pattana</surname><given-names>Pokeaw</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jongkolnee</surname><given-names>Settakorn</given-names></name><xref ref-type="aff" rid="aff6"><sup>6</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Faculty of Medicine, Thammasat University, Bangkok, Thailand</addr-line></aff><aff id="aff6"><addr-line>Department of Pathology, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand</addr-line></aff><aff id="aff1"><addr-line>Clinical Epidemiology Unit, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand</addr-line></aff><aff id="aff5"><addr-line>Office of Disease Prevention and Control 10, Chiang Mai, Thailand</addr-line></aff><aff id="aff4"><addr-line>Division of Respiratory Medicine, Chest Disease Institute, Nonthaburi, Thailand</addr-line></aff><aff id="aff3"><addr-line>Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand</addr-line></aff><pub-date pub-type="epub"><day>06</day><month>03</month><year>2018</year></pub-date><volume>06</volume><issue>01</issue><fpage>36</fpage><lpage>48</lpage><history><date date-type="received"><day>7,</day>	<month>December</month>	<year>2017</year></date><date date-type="rev-recd"><day>4,</day>	<month>March</month>	<year>2018</year>	</date><date date-type="accepted"><day>7,</day>	<month>March</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Background: Molecular diagnosis based on the detection of mutations conferring genetic drug resistance is useful for early diagnosis and treatment of Pre-XDR and XDR-TB patients. However, the study of mutation as a marker to predict Pre-XDR and XDR-TB is rare. 
  Methods: Thirty-four 
  <em>Mycobacterium tuberculosis</em> (MTB) isolates from MDR, Pre-XDR and XDR-TB patients in the upper north of Thailand, who had been identified for drug susceptibility using the indirect agar proportion method from 2005-2012, were examined for genetic site mutations of 
  <em>katG</em>, 
  <em>inhA</em>, and 
  <em>ahpC</em> for isoniazid (INH) drug resistance, 
  <em>rpoB</em> for rifampicin (RIF) drug resistance, 
  <em>gyrA</em> for ofloxacin (OFX), and 
  <em>rrs</em> for kanamycin (KAN). Associations between resistant genes and Pre-XDR and XDR-TB in the MDR patients were performed using exact probability tests. Univariable logistic regression was used to quantify the strength of association between the gene mutation with 
  <em>Mycobacterium tuberculosis</em> and the prevalence of Pre-XDR and XDR-TB in the MDR patients. 
  Results: The mutations in the region of the 
  <em>rpoB</em> gene at codon 445 (C445T) in the Pre-XDR or XDR-TB patients were significantly 20.6 times more prevalent among the MDR-TB patients. The 
  <em>inhA</em> gene mutation at codon 114 (T114G) was also significantly 8.1 times more prevalent. 
  Conclusion: The findings can be used to predict the odds of Pre-XDR and XDR-TB in MDR-TB patients, as a guide for prevention and treatments.
 
</p></abstract><kwd-group><kwd>Prediction</kwd><kwd> Tuberculosis</kwd><kwd> Drug Resistance</kwd><kwd> MDR-TB</kwd><kwd> XDR-TB</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Extensively drug-resistant (XDR) tuberculosis (TB) has emerged as a major threat to global TB control. Mycobacterium tuberculosis XDR strains are resistant to rifampin, isoniazid, fluoroquinolone, and any of the second-line injectable agents, including amikacin (AMK), kanamycin (KAN), and capreomycin (CAP) [<xref ref-type="bibr" rid="scirp.82869-ref1">1</xref>] . XDR-TB is usually developed from multidrug-resistant (MDR) TB, which is resistant to rifampin and isoniazid. MDR-TB typically requires two years of treatment with second-line drugs, which is more expensive and more toxic than first-line drugs [<xref ref-type="bibr" rid="scirp.82869-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.82869-ref3">3</xref>] . The low rate of diagnosis and diagnostic delay, the limited access to second-line drugs, and the poor adherence of MDR-TB patients have mainly led to the emergence of XDR-TB [<xref ref-type="bibr" rid="scirp.82869-ref4">4</xref>] . Most of the XDR-TB and Pre-XDR-TB patients in China were new cases, indicating the transmission of resistant strains [<xref ref-type="bibr" rid="scirp.82869-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.82869-ref6">6</xref>] . In 2016, Thailand had 80 MDR-TB patients. Of these cases, 20 were on treatment for XDR-TB and 60 were on MDR-TB and Pre-XDR-TB medication [<xref ref-type="bibr" rid="scirp.82869-ref7">7</xref>] . All of them are difficult to treatment.</p><p>The cure rate for MDR-TB patients is 50% - 60%, compared with 95% - 97% of the patients with drug-susceptible TB [<xref ref-type="bibr" rid="scirp.82869-ref8">8</xref>] . As a result, MDR-TB and XDR-TB have emerged as significant threats to global TB control [<xref ref-type="bibr" rid="scirp.82869-ref9">9</xref>] . The emergence of XDR-TB strains is a reflection of poor tuberculosis management and control, and this situation should be considered as an urgent global health problem, especially in developing countries and those lacking resources [<xref ref-type="bibr" rid="scirp.82869-ref10">10</xref>] .</p><p>Our study aimed to ascertain the risk factors of gene mutation that are associated with the development of Pre-XDR and XDR-TB. The rapid diagnosis of these resistant cases is urgently needed and is useful for treatment. In the future, molecular diagnosis will involve MDR-TB and XDR-TB detection, which is also useful for predicting Pre-XDR and XDR-TB and for monitoring treatment.</p></sec><sec id="s2"><title>2. Material and methods</title><sec id="s2_1"><title>2.1. Study Design</title><p>This study was a retrospective study of MDR-TB and XDR-TB M. tuberculosis isolates involving TB patients during 2005-2012 at the Office of Disease Prevention and Control Region 10 (DPC 10) in the north of Thailand as shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>. The DPC 10 laboratory is a Regional TB Laboratory covering TB patient treatment from eight provinces in the upper north of Thailand, which can provide M. tuberculosis (MTB) cultures, identification, and Drug Susceptibility Tests (DST) for first- and second-line drugs. The MTB isolates were subcultured, then tested for phenotypes for first- and second-line drug resistance to isoniazid (INH), rifampicin (RIF), ofloxacin (OFX), and kanamycin (KAN) at DPC 10. Further, genetic site mutation for drug resistance in the corresponding resistant gene (katG, inhA, ahpC, rpoB, gyrA and rrs) was performed at Macrogen in Korea. Medical records were retrospectively reviewed for demographic data, diagnosis, and laboratory identification and DST results.</p></sec><sec id="s2_2"><title>2.2. Mycobacterial isolates</title><p>161 MTB multidrug and extensive drug resistant strain isolates from TB patients during 2005-2012 were subcultured from collections at DPC 10 received from 8 hospitals in the upper north of Thailand. Only 34 isolates were able to grow in 5 ml of 7H9 broth supplemented with PANTA and 3% Ogawa. Samples were collected from individual TB patients who presented with the initial treatment status.</p></sec><sec id="s2_3"><title>2.3. Drug susceptibility Testing</title><p>Phenotypes testing on first and second line anti-tuberculous drugs (INH, RIF, OFX, and KAN) were performed on 34 isolates of M. tuberculosis, using the proportion method on LJ medium [<xref ref-type="bibr" rid="scirp.82869-ref11">11</xref>] . DST was completed according to the WHO guideline for DST testing for first- and second-line anti-tuberculosis drugs for DOTS-plus [<xref ref-type="bibr" rid="scirp.82869-ref12">12</xref>] . DST was determined using the indirect agar proportion method which, was performed on an LJ medium supplemented individually with anti-TB drugs, which included INH (0.2 &#181;g/ml), RIF (40.0 &#181;g/ml), OFX (2.0 &#181;g/ml), and KAN (30 &#181;g/ml).</p></sec><sec id="s2_4"><title>2.4. DNA extraction</title><p>34 isolates were grown on solid media (L&#246;wenstein-Jensen and OGAWA), and chromosomal DNA was extracted using the commercial kit method with MolecuTech REBA MTB-MDR 2011. The purified DNA pellet was stored at 4˚C until use.</p></sec><sec id="s2_5"><title>2.5. Sequencing method</title><p>Six loci were amplified by PCR: katG, inhA, and ahpC (INH); rpoB (RIF); gyrA (OFX); and rrs (KAN) at Macrogen. Genetic site mutations in the corresponding resistance gene (katG, inhA, ahpC, rpoB, gyrA, and rrs) were performed using Macrogen molecular laboratory outsources. The primers are presented in <xref ref-type="table" rid="table1">Table 1</xref> [<xref ref-type="bibr" rid="scirp.82869-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.82869-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.82869-ref14">14</xref>] . The result of sequencing was then subjected to comparison and analysis.</p></sec><sec id="s2_6"><title>2.6. Analysis</title><p>The sequencing data produced by the ABI 3730xl DNA analyzer were reviewed for confidence levels with an ABI sequence scanner, and chromatograms were analyzed for the presence or absence of mutations by comparison with published sequences of H37Rv. The data on clinical patients, resistant genes, genetic site mutation, and phenotype were compiled using the Excel 2010 database. Statistical analysis was performed using a statistical software package. The baseline characteristics of demographic data, treatment outcome and the genetic site mutation were presented using frequency and percentage. The associations between the demographic data, treatment outcome, resistant gene and MDR, Pre-XDR, and XDR were evaluated using exact probability tests. Univariable logistic regression was used to quantify the strength of the association between the demographic data, the gene mutation with Mycobacterium tuberculosis and the prevalence of Pre-XDR and XDR-TB among the MDR-TB patients.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used for sequencing</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene</th><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >Nucleotide sequencing (5' to 3')</th><th align="center" valign="middle" >Product size (pb)</th><th align="center" valign="middle" >Temp (˚C)</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle" >katG</td><td align="center" valign="middle" >MtkatGf MtkatGr</td><td align="center" valign="middle" >ACCCGAGGCTGCTCCGCTGG CAGCTCCCACTCGTAGCCGT</td><td align="center" valign="middle" >168</td><td align="center" valign="middle" >94˚C - 20 s 50˚C - 20 s 70 cycles 72˚C - 20 s</td><td align="center" valign="middle" >Afanas’ev MV, 2007</td></tr><tr><td align="center" valign="middle" >inhA</td><td align="center" valign="middle" >MtfabGf MtfabGr</td><td align="center" valign="middle" >GCCTCGCTGGCCCAGAAAGG CTCCGGATCCACGGTGGGT</td><td align="center" valign="middle" >320</td><td align="center" valign="middle" >94˚C - 20 s 56˚C - 20 s 70 cycles 72˚C - 20 s</td><td align="center" valign="middle" >Afanas’ev MV, 2007</td></tr><tr><td align="center" valign="middle" >ahpC</td><td align="center" valign="middle" >ahpC1 F ahpC2 R</td><td align="center" valign="middle" >GCCTGGGTGTTCGTCACTGGT CGCAACGTCGACTGGCTCATA</td><td align="center" valign="middle" >359</td><td align="center" valign="middle" >95˚C - 40 s 15 min (start) 94˚C - 40 s 30 cycles 57˚C - 40 s 1 min 72˚C - 40 s 15 min (final)</td><td align="center" valign="middle" >Valvatne H, 2009</td></tr><tr><td align="center" valign="middle" >rpoB</td><td align="center" valign="middle" >MtrpoBf MtrpoBr</td><td align="center" valign="middle" >GAGGCGATCACCGCAGAC GGTACGGCGTTTCGATGAAC</td><td align="center" valign="middle" >321</td><td align="center" valign="middle" >94˚C - 20 s 59˚C - 20 s 70 cycles 72˚C - 20 s</td><td align="center" valign="middle" >Afanas’ev MV, 2007</td></tr><tr><td align="center" valign="middle" >gyrA</td><td align="center" valign="middle" >gyrBA-3F gyrBA-3R</td><td align="center" valign="middle" >AAGAGCGCCACCGACATC CAGCATCTCCATCGCCAA</td><td align="center" valign="middle" >320</td><td align="center" valign="middle" >95˚C - 2 min (start) 95˚C - 30 cycles 1 min 65˚C - 1 min 72˚C - 1 min 72˚C - 10 min (final)</td><td align="center" valign="middle" >Liang L, 2012</td></tr><tr><td align="center" valign="middle" >rrs</td><td align="center" valign="middle" >16S-2F 16S-1R</td><td align="center" valign="middle" >CGTGGCCGTTTGTTTTGTC TGGTGCTCCTTAGAAAGGAGG</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >95˚C - 2 min (start) 94˚C - 35 cycles 1 min 60˚C - 1 min 68˚C - 2 min 68˚C - 10 min (final)</td><td align="center" valign="middle" >Liang L, 2012</td></tr></tbody></table></table-wrap></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Characteristics of MDR-TB and Pre-XDR/XDR-TB</title><p>There was no statistically significant difference (p &lt; 0.05) between the characteristic of MDR-TB and Pre-XDR/XDR-TB cases (<xref ref-type="table" rid="table2">Table 2</xref>).</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Characteristics of MDR and Pre-XDR/XDR-TB patients</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" ></th><th align="center" valign="middle" >n (%)</th><th align="center" valign="middle" ></th></tr></thead><tr><td align="center" valign="middle" >Characteristics</td><td align="center" valign="middle" >MDR-TB N = 24</td><td align="center" valign="middle" >Pre-XDR or XDR-TB N-10</td><td align="center" valign="middle" >p-value</td></tr><tr><td align="center" valign="middle" >Gender</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Male Female</td><td align="center" valign="middle" >13 (54.2) 11 (45.8)</td><td align="center" valign="middle" >6 (60.0) 4 (40.0)</td><td align="center" valign="middle" >1.000</td></tr><tr><td align="center" valign="middle" >Age (year)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >0 - 20 21 - 40 41 - 60 &gt;60 Mean (SD)</td><td align="center" valign="middle" >1 (4.2) 9 (37.5) 11 (45.8) 3 (12.5) 44.6 (14.5)</td><td align="center" valign="middle" >0 (0.0) 5 (50.0) 4 (40.0) 1 (10.0) 43.3 (11.5)</td><td align="center" valign="middle" >0.098</td></tr><tr><td align="center" valign="middle" >Nationality</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Thai Non-Thai</td><td align="center" valign="middle" >21 (87.5) 3 (12.5)</td><td align="center" valign="middle" >7 (70.0) 3 (30.0)</td><td align="center" valign="middle" >0.328</td></tr><tr><td align="center" valign="middle" >Treatment history</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >New Previous</td><td align="center" valign="middle" >14 (58.3) 10 (41.7)</td><td align="center" valign="middle" >4 (40.0) 6 (60.0)</td><td align="center" valign="middle" >0.457</td></tr><tr><td align="center" valign="middle" >BMI</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >&lt;18.5 ≥18.5 Mean (SD)</td><td align="center" valign="middle" >11 (45.8) 13 (54.2) 18.9 (3.3)</td><td align="center" valign="middle" >7 (70.0) 3 (30.0) 17.0 (3.8)</td><td align="center" valign="middle" >0.270</td></tr><tr><td align="center" valign="middle" >Chest x-ray</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Non-cavity Cavity</td><td align="center" valign="middle" >14 (58.3) 10 (41.7)</td><td align="center" valign="middle" >4 (40.0) 6 (60.0)</td><td align="center" valign="middle" >0.457</td></tr><tr><td align="center" valign="middle" >Sputum smear</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Negative AFB 1+ AFB 2+ AFB 3+</td><td align="center" valign="middle" >4 (16.7) 7 (29.2) 5 (20.8) 8 (33.3)</td><td align="center" valign="middle" >1 (10.0) 3 (30.0) 1 (10.0) 5 (50.0)</td><td align="center" valign="middle" >0.836</td></tr><tr><td align="center" valign="middle" >Comorbidity</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >No Yes</td><td align="center" valign="middle" >11 (91.7) 1 (8.3)</td><td align="center" valign="middle" >1 (10.0) 9 (90.0)</td><td align="center" valign="middle" >0.061</td></tr><tr><td align="center" valign="middle" >Location</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ChiangMai ChiangRai Lampang Lamphun Nan Phrae Phayao</td><td align="center" valign="middle" >5 (20.8) 7 (29.2) 2 (8.3) 1 (4.2) 3 (12.5) 5 (20.8) 1 (4.2)</td><td align="center" valign="middle" >3 (30.0) 3 (30.0) 0 (0.0) 0 (0.0) 1 (10.0) 2 (20.0) 1 (10.0)</td><td align="center" valign="middle" >1.000</td></tr></tbody></table></table-wrap></sec><sec id="s3_2"><title>3.2. Treatment patterns of MDR-TB and Pre-XDR/XDR-TB</title><p>The majority of treatments in of the MDR-TB and Pre-XDR/XDR-TB patients were similar that found combination directly observed and self-administered for therapy type, CAT V (I) for treatment pattern, during on treatment more than 24 months in <xref ref-type="table" rid="table3">Table 3</xref>. The majority of side effects were different in two groups that found minor side effect (75.0%) in MDR-TB patients but found major side effect (40.0%) in Pre-XDR or XDR-TB patients in <xref ref-type="table" rid="table3">Table 3</xref>.</p></sec><sec id="s3_3"><title>3.3. Treatment outcome of MDR-TB and Pre-XDR/XDR-TB</title><p>The treatment outcome resulting as “cure” was observed mainly in MDR-TB (50%). Cure/successful treatment was found 30% in Pre-XDR/XDR-TB group with defaulted (30%) and dead (30%) as shown in <xref ref-type="table" rid="table4">Table 4</xref>. However, it is found that 20% of deaths in Pre-XDR/XDR-TB patients occurred before the initiation of TB treatment.</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Treatment patterns of MDR and Pre-XDR/XDR-TB patients</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" ></th><th align="center" valign="middle" >n (%)</th><th align="center" valign="middle" ></th></tr></thead><tr><td align="center" valign="middle" >Characteristics</td><td align="center" valign="middle" >MDR-TB N = 24</td><td align="center" valign="middle" >Pre-XDR or XDR-TB N-10</td><td align="center" valign="middle" >p-value</td></tr><tr><td align="center" valign="middle" >Therapy type</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >No directly ibserved and self-adminstered Directly observed only Self-administered only Combination directly ibserved and self-adminstered</td><td align="center" valign="middle" >2 (8.3) 3 (12.5) 4 (16.7) 15 (62.5)</td><td align="center" valign="middle" >2 (20.0) 1 (10.0) 2 (20.0) 5 (50.0)</td><td align="center" valign="middle" >0.872</td></tr><tr><td align="center" valign="middle" >Treatment patterns</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >No treatment CAT IV (I) CAT IV (II) CAT V Only INH</td><td align="center" valign="middle" >2 (8.3) 13 (54.2) 9 (37.5) 0 (0.0) 0 (0.0)</td><td align="center" valign="middle" >2 (20.0) 4 (40.0) 2 (20.0) 1 (10.0) 1 (10.0)</td><td align="center" valign="middle" >0.112</td></tr><tr><td align="center" valign="middle" >Period of treatment (months)</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >&lt;6.0 6.1 - 12.0 12.0 - 24.0 &gt;24.0 Min Max Mean (SD)</td><td align="center" valign="middle" >5 (20.8) 3 (12.5) 7 (29.2) 9 (37.5) 0 48.3 20.1 (1.4)</td><td align="center" valign="middle" >2 (20.0) 2 (20.0) 3 (30.0) 3 (30.0) 2.3 51.1 18.3 (14.4)</td><td align="center" valign="middle" >0.952</td></tr><tr><td align="center" valign="middle" >Major side effects</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >No yes</td><td align="center" valign="middle" >8 (33.3) 16 (66.7)</td><td align="center" valign="middle" >6 (60.0) 4 (40.0)</td><td align="center" valign="middle" >0.252</td></tr><tr><td align="center" valign="middle" >Minor side effect</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >No Yes</td><td align="center" valign="middle" >6 (25.0) 18 (75.0)</td><td align="center" valign="middle" >7 (70.0) 3 (30.0)</td><td align="center" valign="middle" >0.020</td></tr></tbody></table></table-wrap><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Treatment outcome for MDR and Pre-XDR/XDR-TB</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" ></th><th align="center" valign="middle" >n (%)</th><th align="center" valign="middle" ></th></tr></thead><tr><td align="center" valign="middle" >Outcome of treatment</td><td align="center" valign="middle" >MDR-TB N = 24</td><td align="center" valign="middle" >Pre-XDR or XDR-TB N-10</td><td align="center" valign="middle" >p-value</td></tr><tr><td align="center" valign="middle" >Treatment outcome</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >0.697</td></tr><tr><td align="center" valign="middle" >Cure Complete Failure Dead Defaulted</td><td align="center" valign="middle" >12 (50.0) 1 (4.2) 1 (4.2) 6 (25.0) 4 (16.6)</td><td align="center" valign="middle" >3 (30.0) 0 (0.0) 1 (10.0) 3 (30.0) 3 (30.0)</td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap></sec><sec id="s3_4"><title>3.4. MDR-TB, and Pre-XDR/XDR-TB with Gene mutation codon</title><p>The analysis was conducted on 34 isolates of which 24 was MDR-TB, 9 Pre XDR and 1 XDR-TB. DNA sequencing was tested following six resistant genes: katG, inhA, ahpC, rpoB, gyrA, and rrs. The katG, inhA, ahpC, and rpoB indicated resistance to the first-line antibiotic treatment, while gyrA and rrs indicated resistance to the second-line antibiotic treatment. The distribution of MDR, Pre-XDR and XDR-TB by mutation site in katG, inhA, ahpC, rpoB, gyrA, and rrs gene can be seen in <xref ref-type="table" rid="table5">Table 5</xref> and <xref ref-type="table" rid="table6">Table 6</xref>. The isoniazid (INH) resistant isolates had genetic site mutations within the katG gene, inhA gene, and ahpC gene, which had mutated in many codons (<xref ref-type="table" rid="table5">Table 5</xref>). The majority of the katG gene mutations in MDR-TB had a genetic site mutation in codon 315 (<xref ref-type="table" rid="table5">Table 5</xref>). There was no mutation in any katG codon of the 14 cases in MDR, Pre-XDR/XDR-TB (<xref ref-type="table" rid="table5">Table 5</xref>). There were two cases of isoniazid (INH) drug resistance that exhibited no mutation to any genetic site on the katG, inhA, and ahpC gene in the MDR-TB patients. Two cases found mutation only a katG gene in the Pre-XDR-TB patients in our study. Mutation of rpoB 445 codon was significantly found in Pre-XDR/XDR-TB isolates (50%) than in MDR-TB isolates (23.5%) with the p-value of 0.031 (<xref ref-type="table" rid="table6">Table 6</xref>).</p></sec><sec id="s3_5"><title>3.5. Odds of Pre-XDR/XDR-TB by Clinical Profile and loci of gene Mutation</title><p>Our study found that Pre-XDR/XDR-TB patients significantly presented a mutation in the region of the rpoB gene at codon 445 (C445T) 20.6 times than the MDR-TB patients (P = 0.026) (<xref ref-type="table" rid="table7">Table 7</xref>). The results also showed that the prevalence inhA gene mutation at codon 114 (T114G) was significantly higher (8.1 times) in the Pre-XDR/XDR-TB patients than in the MDR-TB patients (p = 0.034) (<xref ref-type="table" rid="table7">Table 7</xref>). Also the data presented that minor side effect was significantly lower (0.14 times) in the Pre-XDR/XDR-TB patients than in the MDR-TB patients (p = 0.020) (<xref ref-type="table" rid="table7">Table 7</xref>).</p><p>The predictive markers in a logistic model (the mutation of the inhA gene at codon 114, the rpoB gene at codon 445, the rrs gene at codon 414 and minor</p><table-wrap id="table5" ><label><xref ref-type="table" rid="table5">Table 5</xref></label><caption><title> Distribution of MDR-TB, and Pre-XDR-TB/XDR-TB by katG, inhA, and ahpC gene mutation codon</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene mutation codon</th><th align="center" valign="middle" >MDR-TB n (%)</th><th align="center" valign="middle" >Pre-XDR or XDR-TB n (%)</th><th align="center" valign="middle" >Total</th><th align="center" valign="middle" >p-value</th></tr></thead><tr><td align="center" valign="middle" >katG</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >No mutation katG 315 katG 320 katG 300 katG 302 katG 314 katG 308 katG 299 katG 340 katG 343 katG 310 katG 312</td><td align="center" valign="middle" >10 (41.7) 10 (41.7) 1 (4.2) 0 (0.0) 0 (0.0) 1 (4.2) 1 (4.2) 0 (0.0) 3 (12.5) 5 (20.8) 1 (4.2) 1 (4.2)</td><td align="center" valign="middle" >4 (40.0) 2 (20.0) 0 (0.0) 1 (10.0) 0 (0.0) 0 (0.0) 2 (20.0) 1 (10.0) 1 (10.0) 2 (20.0) 2 (20.0) 3 (30.0)</td><td align="center" valign="middle" >14 (41.2) 12 (35.3) 1 (2.9) 1 (2.9) 1 (2.9) 1 (2.9) 3 (8.8) 1 (2.9) 4 (11.8) 7 (20.6) 3 (8.8) 4 (11.8)</td><td align="center" valign="middle" >0.618 0.211 0.706 0.294 0.294 0.706 0.201 0.294 0.666 0.670 0.201 0.067</td></tr><tr><td align="center" valign="middle" >InhA</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >No mutation inhA 14 inhA 25 inhA 78 inhA 81 inhA 84 inhA 86 inhA 94 inhA 114</td><td align="center" valign="middle" >5 (20.8) 8 (33.3) 1 (4.2) 5 (20.8) 5 (20.8) 6 (25.0) 6 (25.0) 3 (12.5) 5 (20.8)</td><td align="center" valign="middle" >2 (20.0) 3 (30.0) 0 (0.0) 3 (30.0) 2 (20.0) 3 (30.0) 2 (20.0) 0 (0.0) 6 (60.0)</td><td align="center" valign="middle" >7 (20.6) 11 (32.4) 1 (2.9) 8 (23.5) 7 (20.6) 9 (26.5) 8 (25.5) 3 (8.8) 11 (32.4)</td><td align="center" valign="middle" >0.670 0.591 0.706 0.435 0.670 0.538 0.565 0.338 0.036</td></tr><tr><td align="center" valign="middle" >ahpC</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >No mutation ahpC 10 ahpC 12 ahpC 20 ahpC 22 ahpC 75 ahpC 76</td><td align="center" valign="middle" >14 (58.3) 2 (8.3) 2 (8.3) 3 (12.5) 2 (8.3) 6 (25.0) 5 (20.8)</td><td align="center" valign="middle" >7 (70.0) 2 (20.0) 2 (20.0) 1 (10.0) 1 (10.0) 1 (10.0) 1 (10.0)</td><td align="center" valign="middle" >21 (61.8) 4 (11.8) 4 (11.8) 4 (11.8) 3 (8.8) 7 (20.6) 6 (17.7)</td><td align="center" valign="middle" >0.406 0.334 0.334 0.666 0.662 0.315 0.416</td></tr></tbody></table></table-wrap><table-wrap-group id="6"><label><xref ref-type="table" rid="table6">Table 6</xref></label><caption><title> Distribution of MDR-TB, and Pre-XDR/XDR-TB by rpoB, gyrA and rrs gene mutation codon</title></caption><table-wrap id="6_1"><table><tbody><thead><tr><th align="center" valign="middle" >Gene mutation codon</th><th align="center" valign="middle" >MDR-TB n (%)</th><th align="center" valign="middle" >Pre-XDR or XDR-TB n (%)</th><th align="center" valign="middle" >Total</th><th align="center" valign="middle" >p-value</th></tr></thead><tr><td align="center" valign="middle" >rpoB</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >No mutation rpoB 445 rpoB 450 rpoB 464 rpoB 483 rpoB 490 rpoB 493 rpoB 507 rpoB 508</td><td align="center" valign="middle" >4 (16.7) 3 (12.5) 5 (20.8) 6 (25.0) 2 (8.3) 5 (20.8) 2 (8.3) 7 (29.2) 8 (33.3)</td><td align="center" valign="middle" >2 (20.0) 5 (50.0) 1 (10.0) 0 (0.0) 2 (20.0) 2 (20.0) 2 (20.0) 2 (20.0) 1 (10.0)</td><td align="center" valign="middle" >6 (17.7) 8 (23.5) 6 (17.7) 6 (17.7) 4 (11.8) 7 (20.6) 4 (11.8) 9 (26.5) 9 (26.5)</td><td align="center" valign="middle" >0.584 0.031 0.416 0.100 0.334 0.670 0.334 0.462 0.165</td></tr></tbody></table></table-wrap><table-wrap id="6_2"><table><tbody><thead><tr><th align="center" valign="middle" >gyrA</th><th align="center" valign="middle" ></th><th align="center" valign="middle" ></th><th align="center" valign="middle" ></th><th align="center" valign="middle" ></th></tr></thead><tr><td align="center" valign="middle" >No mutation gyrA 21 gyrA 70 gyrA 87 gyrA 102 gyrA 162 gyrA 187</td><td align="center" valign="middle" >5 (20.8) 1 (4.2) 2 (8.3) 17 (70.8) 1 (4.2) 10 (41.7) 8 (33.3)</td><td align="center" valign="middle" >2 (20.0) 0 (0.0) 0 (0.0) 6 (60.0) 0 (0.0) 5 (50.0) 4 (40.0)</td><td align="center" valign="middle" >7 (20.6) 1 (2.9) 2 (5.9) 23 (67.7) 1 (2.9) 15 (44.1) 12 (35.3)</td><td align="center" valign="middle" >0.670 0.706 0.492 0.409 0.706 0.471 0.502</td></tr><tr><td align="center" valign="middle" >rrs</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >No mutation rrs 223 rrs 241 rrs 408 rrs 414 rrs 512</td><td align="center" valign="middle" >16 (66.7) 2 (8.3) 1 (4.2) 5 (20.8) 2 (8.3) 1 (4.2)</td><td align="center" valign="middle" >3 (30.0) 3 (30.0) 1 (10.0) 4 (40.0) 4 (40.0) 1 (10.0)</td><td align="center" valign="middle" >19 (60.2) 5 (14.7) 2 (5.9) 9 (26.5) 6 (17.7) 5 (5.9)</td><td align="center" valign="middle" >0.057 0.138 0.508 0.230 0.048 0.508</td></tr></tbody></table></table-wrap></table-wrap-group><table-wrap id="table7" ><label><xref ref-type="table" rid="table7">Table 7</xref></label><caption><title> Odds of Pre-XDR/XDR-TB by loci of gene mutation</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene</th><th align="center" valign="middle" >Loci of mutations</th><th align="center" valign="middle" >Odd ratio</th><th align="center" valign="middle" >95% CI</th><th align="center" valign="middle" >p-value</th></tr></thead><tr><td align="center" valign="middle" >inhA</td><td align="center" valign="middle" >No mutation inhA 14 inhA 81 inhA 84 inhA 86 inhA 114</td><td align="center" valign="middle" >1.00 0.66 3.00 1.23 0.60 8.12</td><td align="center" valign="middle" >Reference 0.10 - 4.55 0.14 - 65.52 0.09 - 17.00 0.04 - 8.19 1.17 - 56.10</td><td align="center" valign="middle" >- 0.676 0.484 0.876 0.702 0.034</td></tr><tr><td align="center" valign="middle" >ahpC</td><td align="center" valign="middle" >No mutation ahpC 10 ahpC 12 ahpC 76</td><td align="center" valign="middle" >1.00 1.88 1.88 0.51</td><td align="center" valign="middle" >Reference 0.17 - 20.11 0.17 - 20.11 0.05 - 5.31</td><td align="center" valign="middle" >- 0.602 0.602 0.577</td></tr><tr><td align="center" valign="middle" >rpoB</td><td align="center" valign="middle" >No mutation rpoB 445 rpoB 450 rpoB 483 rpoB 490 rpoB 507 rpoB 508</td><td align="center" valign="middle" >1.00 20.64 0.54 1.51 0.23 3.53 12.23</td><td align="center" valign="middle" >Reference 1.44 - 295.42 0.03 - 8.35 0.08 - 29.17 0.01 - 4.59 0.30 - 41.70 0.20 - 757.35</td><td align="center" valign="middle" >- 0.026 0.659 0.783 0.336 0.317 0.234</td></tr><tr><td align="center" valign="middle" >rrs</td><td align="center" valign="middle" >No mutation rrs 223 rrs 241 rrs 408 rrs 414 rrs 512</td><td align="center" valign="middle" >1.00 1.85 0.70 2.17 6.90 3.68</td><td align="center" valign="middle" >Reference 0.15 - 22.38 0.01 - 32.78 0.28 - 16.60 0.77 - 61.89 0.17 - 77.73</td><td align="center" valign="middle" >- 0.628 0.856 0.456 0.084 0.402</td></tr><tr><td align="center" valign="middle" >Minor side effect</td><td align="center" valign="middle" >No minor side effect Minor side effect</td><td align="center" valign="middle" >1.00 0.14</td><td align="center" valign="middle" >Reference 0.15 - 22.38</td><td align="center" valign="middle" >- 0.020</td></tr></tbody></table></table-wrap><p>side effect can be explained 89.6% the probability of Pre-XDR/XDR-TB among MDR-TB (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>The predictors of Pre-XDR/XDR-TB from MDR-TB that will be useful for early treatment need to be identified from the genetic mutation marker. Mutations in</p><p>the selected genes of M. tuberculosis have been used as markers for anti-TB drug resistance. Our results found that DST phenotypic resistance correlated with resistant genes, isoniazid resistance and katG, inhA, ahpC; and rifampicin resistance and rpoB.</p><p>Gene mutation site in MDR-TB and Pre-XDR/XDR-TB patents: The rpoB gene mutation was a significant factor in terms of increasing the severity of MDR-TB, which may lead to the diagnosis (prediction) of Pre-XDR-TB and XDR-TB in patients. Previous study showed that 31.2% of the primary MDR-TB patients in China had S531L rpoB mutation [<xref ref-type="bibr" rid="scirp.82869-ref15">15</xref>] . Wang Sheng Fen study further showed that the combination of mutations in gyrA, rrs, and tlyA could predict Pre-XDR-TB with 68.9% sensitivity and XDR-TB with 65.9% sensitivity and 100% specificity [<xref ref-type="bibr" rid="scirp.82869-ref16">16</xref>] .</p><sec id="s4_1"><title>4.1. InhA 114 among Pre-XDR/XDR-TB Patients and MDR-TB Patients</title><p>Our study showed that the inhA gene mutation position at 114 (T114G) and the rpoB gene mutation position at 445 (C445T) maybe used as a tool to predict the Pre-XDR/XDR-TB patients. The mutation of T114G or C445T was more likely to be associated with the development to Pre-XDR-TB and XDR-TB among MDR-TB, with the chance of 8.1 and 20.6 times, respectively. In our study, gene mutation in inhA 114 was detected in 82.6% (19/23) of the MDR and in 17.4% (4/23) of the Pre-XDR or XDR-TB strains. There have been no previous reports of inhA 114 mutation in MDR-TB and XDR-TB strains; however this could be a case of silent mutation. Mutations of inhA are also commonly found at (−15) [<xref ref-type="bibr" rid="scirp.82869-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.82869-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.82869-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.82869-ref20">20</xref>] among the Mycobacterium tuberculosis drug resistant strains that can be found among TB and MDR-TB patients.</p></sec><sec id="s4_2"><title>4.2. RpoB 445 among Pre-XDR or XDR-TB Patients or MDR-TB Patients</title><p>Many studies have documented that rpoB 445 is very specific to rifampicin resistance, which has been used to detect MDR-TB [<xref ref-type="bibr" rid="scirp.82869-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.82869-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.82869-ref23">23</xref>] . In our study, gene mutation in rpoB was detected in 85.3% (29/34) of the MDR and XDR-TB strains and was more likely to be found in Pre-XDR and XDR-TB patients by about 20 times when compared with the MDR-TB patients. One study showed that rpoB 445 was a very strong factor in predicting rifampicin resistance [<xref ref-type="bibr" rid="scirp.82869-ref24">24</xref>] . A previous study in Swaziland showed rpoB 445 mutation in MDR-TB patients (79.17%) [<xref ref-type="bibr" rid="scirp.82869-ref22">22</xref>] . The rpoB 445 mutation was also found during the outbreak of MDR-TB in Argentina in 1973 [<xref ref-type="bibr" rid="scirp.82869-ref23">23</xref>] . Previous studies have shown that rpoB445 could predict MDR with high specificity but low sensitivity [<xref ref-type="bibr" rid="scirp.82869-ref19">19</xref>] .</p></sec><sec id="s4_3"><title>4.3. Minor Side effect among Pre-XDR/XDR-TB patients or MDR-TB Patients</title><p>The attention paid for treatment of ADR with minimum modification of treatment regimen that was increased cure rate [<xref ref-type="bibr" rid="scirp.82869-ref25">25</xref>] . Also the previous study in MDR-TB without co-infection with HIV showed ADR was not effect to stop treatment [<xref ref-type="bibr" rid="scirp.82869-ref26">26</xref>] . Minor side effects appeared to have little impact on treatment completion and the conversion to Pre-XDR/XDR-TB because patients tended to visit healthcare providers more often to discuss their side effect concerns, resulting in better continuation of care and treatment which indirectly lowering the conversion to Pre-XDR/XDR-TB.</p></sec></sec><sec id="s5"><title>5. Conclusion</title><p>In conclusion, our study has found that presence of mutations in inhA 114 and rpoB 445 could be an indicator for Pre-XDR and XDR-TB strains among MDR-TB patients in northern Thailand. Prospective results should be done before applying these mutations as markers for Pre-XDR and XDR-TB in this population.</p></sec><sec id="s6"><title>6. Limitations of this Study</title><p>The limitation of this study was that it was a retrospective study where the evaluation was carried out using only one-fifth isolates that could be subcultured from a total of 161 isolates. The sample size was rather limited. Generalization from this study should be made with caution.</p></sec><sec id="s7"><title>Acknowledgements</title><p>This study was supported by the National Research Council of Thailand and the Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand. We would like to thank all of the support staff at the Disease Prevention and Control Region 10 (DPC 10), and at Nakornping Hospital, Chiang Rai Hospital, Lampang Hospital, Phayao Hospital, ChiangKan Hospital, Lamphun Hospital, Phrae Hospital, and Nan Hospital.</p></sec><sec id="s8"><title>Cite this paper</title><p>Jaksuwan, R., Patumanond, J., Tharavichikul, P., Chuchottaworn, C., Pokeaw, P. and Settakorn, J. (2018) The Prediction Factors of Pre-XDR and XDR-TB among MDR-TB Patients in Northern Thailand. Journal of Tuberculosis Research, 6, 36-48. https://doi.org/10.4236/jtr.2018.61004</p></sec></body><back><ref-list><title>References</title><ref id="scirp.82869-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization (2014) Global Tuberculosis Report 2014. WHO/HTM/ TB/2014.08 ed. World Health Organization, Printed in France.</mixed-citation></ref><ref id="scirp.82869-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization (2014) Companion Handbook to the WHO Guidelines for the Programmatic Management of Drug-Resistant Tuberculosis. WHO Document Production Services, Geneva.</mixed-citation></ref><ref id="scirp.82869-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Ahmad, S. and Mokaddas, E. (2014) Current Status and Future Trends in the Diagnosis and Treatment of Drug-Susceptible and Multidrug-Resistant Tuberculosis. J Infect Public Health, 7, 75-91. https://doi.org/10.1016/j.jiph.2013.09.001</mixed-citation></ref><ref id="scirp.82869-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Liang, L., Wu, Q., Gao, L., et al. (2012) Factors Contributing to the High Prevalence of Multidrug-Resistant Tuberculosis: A Study from China. Thorax, 67, 632-638. 
https://doi.org/10.1136/thoraxjnl-2011-200018</mixed-citation></ref><ref id="scirp.82869-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Paramasivan, C.N., Lee, E., Kao, K., et al. (2010) Experience Establishing Tuberculosis Laboratory Capacity in a Developing Country Setting. International Journal of Tuberculosis and Lung Disease, 14, 59-64.</mixed-citation></ref><ref id="scirp.82869-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Heysell, S.K. and Houpt, E.R. (2012) The Future of Molecular Diagnostics for Drug-Resistant Tuberculosis. Expert Review of Molecular Diagnostics, 12, 395-405.  
https://doi.org/10.1586/erm.12.25</mixed-citation></ref><ref id="scirp.82869-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization ROfS-EA (2016) Joint WHO SEARO-WPRO-HQ “Experience Sharing Workshop on the Introduction of New Drugs for DR-TB Treatment in the WHO South East Asia and Western Pacific Regions” 24th-25th February 2016.</mixed-citation></ref><ref id="scirp.82869-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Behera, D. (2010) Expanding DOTS-New Strategies for TB Control? The Indian Journal of Tuberculosis, 57, 63-66.</mixed-citation></ref><ref id="scirp.82869-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">World Health Organization (2008) Anti-Tuberculosis Drug Resistance in the World: Forth Global Report. The WHO/IUATLD Global Project on Anti-Tuberculosis Drug Resistance Surveillance 2002-2007. WHO, Geneva.</mixed-citation></ref><ref id="scirp.82869-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Jain, A. and Dixit, P. (2008) Multidrug-Resistant to Extensively Drug Resistant Tuberculosis: What Is Next? Journal of Biosciences, 33, 605-616.  
https://doi.org/10.1007/s12038-008-0078-8</mixed-citation></ref><ref id="scirp.82869-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Almeida Da Silva, P.E. and Palomino, J.C. (2011) Molecular Basis and Mechanisms of Drug Resistance in Mycobacterium tuberculosis: Classical and New Drugs. The Journal of Antimicrobial Chemotherapy, 66, 1417-1430. 
https://doi.org/10.1093/jac/dkr173</mixed-citation></ref><ref id="scirp.82869-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Ilina, E.N., Shitikov, E.A., Ikryannikova, L.N., et al. (2013) Comparative Genomic Analysis of Mycobacterium tuberculosis Drug Resistant Strains from Russia. PLoS ONE, 8, e56577. https://doi.org/10.1371/journal.pone.0056577</mixed-citation></ref><ref id="scirp.82869-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Afanas’ev, M.V., Ikryannikova, L.N., Il’ina, E.N., et al. (2007) Molecular Characteristics of Rifampicin- and Isoniazid-Resistant Mycobacterium tuberculosis Isolates from the Russian Federation. The Journal of Antimicrobial Chemotherapy, 59, 1057-1064. https://doi.org/10.1093/jac/dkm086</mixed-citation></ref><ref id="scirp.82869-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Valvatne, H., Syre, H., Kross, M., et al. (2009) Isoniazid and Rifampicin Resistance-Associated Mutations in Mycobacterium tuberculosis Isolates from Yangon, Myanmar: Implications for Rapid Molecular Testing. The Journal of Antimicrobial Chem-otherapy, 64, 694-701. https://doi.org/10.1093/jac/dkp292</mixed-citation></ref><ref id="scirp.82869-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Wang, H., Zhang, X., Luo, T., et al. (2014) Prediction of XDR/Pre-XDR Tuberculosis by Genetic Mutations among MDR Cases from a Hospital in Shandong, China. Tuberculosis, 94, 277-281. https://doi.org/10.1016/j.tube.2014.03.005</mixed-citation></ref><ref id="scirp.82869-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Wang, S.F., Zhou, Y., Pang, Y., Zheng, H.W. and Zhao, Y.L. (2016) Prevalence and Risk Factors of Primary Drug-Resistant Tuberculosis in China. Biomedical and Environmental Sciences: BES, 29, 91-98.</mixed-citation></ref><ref id="scirp.82869-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Bollela, V.R., Namburete, E.I., Feliciano, C.S., Macheque, D., Harrison, L.H. and Caminero, J.A. (2016) Detection of katG and inhA Mutations to Guide Isoniazid and Ethionamide Use for Drug-Resistant Tuberculosis. International Journal of Tuberculosis and Lung Disease, 20, 1099-1104. 
https://doi.org/10.5588/ijtld.15.0864</mixed-citation></ref><ref id="scirp.82869-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Lee, S.H., Kim, W.S., Choi, Y.D., et al. (2015) Analysis of Mutations in Epidermal Growth Factor Receptor Gene in Korean Patients with Non-small Cell Lung Cancer: Summary of a Nationwide Survey. Journal of Pathology and Translational Medicine, 49, 481-488. https://doi.org/10.4132/jptm.2015.09.14</mixed-citation></ref><ref id="scirp.82869-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Kardan Yamchi, J., Haeili, M., Gizaw Feyisa, S., et al. (2015) Evaluation of Efflux Pump Gene Expression among Drug Susceptible and Drug Resistant Strains of Mycobacterium tuberculosis from Iran. Infection, Genetics and Evolution, 36, 23-26.  
https://doi.org/10.1016/j.meegid.2015.08.036</mixed-citation></ref><ref id="scirp.82869-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Seifert, M., Catanzaro, D., Catanzaro, A. and Rodwell, T.C. (2015) Genetic Mutations Associated with Isoniazid Resistance in Mycobacterium tuberculosis: A Systematic Review. PLoS ONE, 10, e0119628. 
https://doi.org/10.1371/journal.pone.0119628</mixed-citation></ref><ref id="scirp.82869-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Salamon, H., Yamaguchi, K.D., Cirillo, D.M., et al. (2015) Integration of Published Information into a Resistance-Associated Mutation Database for Mycobacterium tuberculosis. The Journal of Infectious Diseases, 211, S50-S57. 
https://doi.org/10.1093/infdis/jiu816</mixed-citation></ref><ref id="scirp.82869-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Sanchez-Padilla, E., Merker, M., Beckert, P., et al. (2015) Detection of Drug-Resistant Tuberculosis by Xpert MTB/RIF in Swaziland. The New England Journal of Medicine, 372, 1181-1182. https://doi.org/10.1056/NEJMc1413930</mixed-citation></ref><ref id="scirp.82869-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Eldholm, V., Monteserin, J., Rieux, A., et al. (2015) Four Decades of Transmission of a Multidrug-Resistant Mycobacterium tuberculosis Outbreak Strain. Nature Communications, 6, Article Number: 7119. https://doi.org/10.1038/ncomms8119</mixed-citation></ref><ref id="scirp.82869-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Kumar, S. and Jena, L. (2014) Understanding Rifampicin Resistance in Tuberculosis through a Computational Approach. Genomics &amp; informatics, 12, 276-282. 
https://doi.org/10.5808/GI.2014.12.4.276</mixed-citation></ref><ref id="scirp.82869-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Dela, A.I., Tank, N.K.D., Singh, A.P. and Piparva, K.G. (2017) Adverse Drug Reactions and Treatment Outcome Analysis of DOTS-Plus Therapy of MDR-TB Patients at District Tuberculosis Centre: A Four Year Retrospective Study. Lung India: Official Organ of Indian Chest Society, 34, 522-526. 
https://doi.org/10.4103/0970-2113.217569</mixed-citation></ref><ref id="scirp.82869-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Isaakidis, P., Varghese, B., Mansoor, H., Cox, H.S., Ladomirska, J., Saranchuk, P., et al. (2012) Adverse Events among HIV/MDR-TB Co-Infected Patients Receiving Antiretroviral and Second Line Anti-TB Treatment in Mumbai, India. PloS ONE, 7, e40781. https://doi.org/10.1371/journal.pone.0040781</mixed-citation></ref></ref-list></back></article>