<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OJMS</journal-id><journal-title-group><journal-title>Open Journal of Marine Science</journal-title></journal-title-group><issn pub-type="epub">2161-7384</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ojms.2018.81007</article-id><article-id pub-id-type="publisher-id">OJMS-82188</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Earth&amp;Environmental Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Chondrichthyes Chitinase: Molecular Cloning, Distribution, and Phylogenetic Analysis
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Miku</surname><given-names>Watanabe</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hiromi</surname><given-names>Kakizaki</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Momo</surname><given-names>Kanai</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Satoshi</surname><given-names>Kawashima</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Kaneyuki</surname><given-names>Hamaguchi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hiroki</surname><given-names>Mizuno</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Tsubasa</surname><given-names>Ueno</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Chiaki</surname><given-names>Yasukawa</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ryuji</surname><given-names>Agata</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mana</surname><given-names>Ikeda</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hideto</surname><given-names>Fukushima</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mitsuhiro</surname><given-names>Ueda</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Masahiro</surname><given-names>Matsumiya</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>College of Bioresource Sciences, Nihon University, Fujisawa, Japan</addr-line></aff><aff id="aff2"><addr-line>Laboratory of Biocycle Engineering, Department of Applied Biological Chemistry, Osaka Prefecture University, Sakai, Japan</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>matsumiya@brs.nihon-u.ac.jp(MM)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>15</day><month>12</month><year>2017</year></pub-date><volume>08</volume><issue>01</issue><fpage>136</fpage><lpage>151</lpage><history><date date-type="received"><day>29,</day>	<month>December</month>	<year>2017</year></date><date date-type="rev-recd"><day>28,</day>	<month>January</month>	<year>2018</year>	</date><date date-type="accepted"><day>31,</day>	<month>January</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  
    We have previously reported the presence of three types of chitinase (acidic fish chitinase-1: AFCase-1, acidic fish chitinase-2: AFCase-2, fish chitinase-3: FCase-3) in Actinopterygii. In the present research, we report the identification of the novel chitinase genes 
   <em>HjChi</em> (ORF: 1380 bp) and 
   <em>DkChi</em> (ORF: 1440 bp) from the stomach of Chondrichthyes, Japanese bullhead shark (
   <em>Heterodontus japonicas</em>) and Kwangtung skate (
   <em>Dipturus kwangtungensis</em>), respectively. Organ-specific expression analysis identified the stomach-specific expression of 
   <em>HjChi</em>, whereas 
   <em>DkChi</em> was expressed widely in all organs. Chitinase activity was measured using 
   <em>p</em>NP-(GlcNAc)
   <sub>n</sub> (
   <em>n</em> = 2, 3) as a substrate and 
   <em>β-N</em>-acetylhexosaminidase (Hex) activity was measured using 
   <em>p</em>NPGlcNAc. Relatively high values of chitinase activity were observed in the stomach, spleen, and gonads of the Japanese bullhead shark, H. japonicas , compared with that observed in the stomach of the Kwangtung skate D. kwangtungensis . However, Hex activity was detected throughout the body of both species. The optimal pH of chitinase in both the Japanese bullhead shark, 
   <em>H. japonicas</em>, and the Kwangtung skate, 
   <em>D. kwangtungensis</em>, were 3.5 - 5.5 and 3.5 - 4.0, respectively, and 4.0 for Hex in both species. Phylogenetic analysis revealed that Chondrichthyes chitinase forms a unique group (Chondrichthyes chitinase). These results suggested that the possibility of the formation of chitinase groups for each class in the phylogenetic analysis based on the observation of class-specific chitinase. 
  
 
</p></abstract><kwd-group><kwd>Chitinase</kwd><kwd> Distribution</kwd><kwd> Chondrichthyes</kwd><kwd> cDNA Cloning</kwd><kwd> Phylogenetic Analysis</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Chitinase (EC 3.2.1.14) is an endo-chitinolytic enzyme that randomly hydrolyzes the β-1,4 glycosidic linkages of chitin to produce N-acetyl chitooligosaccharides ((GlcNAc)<sub>n</sub>) [<xref ref-type="bibr" rid="scirp.82188-ref1">1</xref>] . β-N-acetylhexosaminidase (Hex, EC 3.2.1.52) is an exo-type chitin-decomposing enzyme that sequentially hydrolyzes terminal residues, resulting in the formation of N-acetyl-D-glucosamine (GlcNAc) [<xref ref-type="bibr" rid="scirp.82188-ref2">2</xref>] . After cellulose, chitin is the second most abundant biopolymer and is found in the exoskeleton of arthropods, the cell walls of fungi, and the epithelium of nematodes [<xref ref-type="bibr" rid="scirp.82188-ref3">3</xref>] . (GlcNAc)<sub>n</sub>, a degradation product of chitin, displays various physiological properties based on the length of its carbohydrate chain; similarly, GlcNAc also exhibits useful physiological activity [<xref ref-type="bibr" rid="scirp.82188-ref4">4</xref>] . The aforementioned points are a clear indication of the potential for the application of chitin in a wide range of fields and the research on chitinase enzymes was invaluable to their efficient use. A wide range of functions is suggested by the distribution of chitinase throughout a wide range of organisms. For example, the enzyme has been found to play a physiological role in digestion in mammals and fish [<xref ref-type="bibr" rid="scirp.82188-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.82188-ref6">6</xref>] , plant and mammalian host defense [<xref ref-type="bibr" rid="scirp.82188-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.82188-ref8">8</xref>] , and arthropod morphogenesis [<xref ref-type="bibr" rid="scirp.82188-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.82188-ref10">10</xref>] .</p><p>It is reported that chitinase from marine animals displays characteristics that are unlike chitinase from other organisms. In particular, we made very interesting findings regarding chitinase in the stomach of fish that feed on organisms containing a chitin exoskeleton. For example, two or more kinds of chitinase isozymes have been discovered in the stomach of Actinopterygii, one of the most successful vertebrates on earth. The activity of these chitinase isozymes is dependent on an acidic pH and the crystalline α-chitin decomposition activity of these enzymes has been demonstrated to be superior to that of other organisms [<xref ref-type="bibr" rid="scirp.82188-ref6">6</xref>] . Two varieties of the chitinase genes were obtained from the stomach of the fish and subjected to phylogenetic analysis, based on the deduced amino acid sequence 2 fish-specific groups, acidic fish chitinase-1 (AFCase-1) and acidic fish chitinase-2 (AFCase-2) were identified [<xref ref-type="bibr" rid="scirp.82188-ref6">6</xref>] . In addition, chitinase activity has been observed in organs, excluding the stomach, in the class of fish classified as Actinopterygii [<xref ref-type="bibr" rid="scirp.82188-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.82188-ref12">12</xref>] , and a new group fish chitinase-3 (FCase-3), has been identified based on an isoform found in the stomach and kidneys [<xref ref-type="bibr" rid="scirp.82188-ref12">12</xref>] . In contrast, not even one chitinase gene of the AFCase-1, AFCase-2, and FCase-3 groups has been detected in the stomach of either Prionace glauca, classified as a Chondrichthyes, or the stomach of Latimeria chalmnae, classified as Sarcopterygii [<xref ref-type="bibr" rid="scirp.82188-ref12">12</xref>] . These findings suggested the possibility that there may be a new chitinase group different from groups of AFCase-1, AFCase-2, and FCase-3, as there were large differences in the amino acid sequences of fish chitinases based on systematic positioning. Therefore, in this paper, two species of fish within the same phylogenetic class, but from different subclasses, that share a similar feeding habitat, feeding on molluscs and crustaceans, the Japanese bullhead shark Heterodontus japonicas and Kwangtung skate Dipturus kwangtungensis were selected for analysis. Compared with Actinopterygii, information on Chondrichthyes is still limited; however, there are some reports on the occurrence of chitinase within the bodies of several varieties of sharks and stingrays [<xref ref-type="bibr" rid="scirp.82188-ref13">13</xref>] , as well as reports of cDNA cloning of chitinase genes in the stomach of P. glauca [<xref ref-type="bibr" rid="scirp.82188-ref14">14</xref>] . In addition, there is no literature comparing chitinolytic activity and chitinase mRNA in the body of chondrichthyes. Moreover, it is thought that the examination of chitinase from both animals will assist in the clarification of the specialization of fish chitinase, as there are theories that indicate contrasting evolutionary paths for Chondrichthyes and Actinopterygii.</p><p>This is the first paper that seeks to clarify the characteristics of Chondrichthyes chitinase compared with the larger group of fish chitinase. This was performed through primary structural analysis, the investigation of chitinase activity, the expression status of mRNA to assess the physiological role in the body, and the use of genetic databases, including phylogenetic analysis.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Preparation of Samples</title><p>The Japanese bullhead shark H. japonicus and Kwangtung skate D. kwangtungensis were purchased from the fishing port in Miura City, Kanagawa Prefecture. Each organ was collected, washed with chilled distilled water, and stored at −80˚C until use. Each organ was homogenized with five volumes of 20 mM sodium phosphate buffer (pH 7.3) and centrifuged at 9000 &#215;g for 20 min at 4˚C. The supernatant was filtered through filter paper to remove floating fat and used as the crude extract solution. The crude extract solution was stored at −80˚C until use.</p></sec><sec id="s2_2"><title>2.2. Cloning of H. japonicas chitinasec DNA (HjChi) and D. Kwangtungensis chitinase cDNA (DkChi)</title><p>The sequences of all primers are presented in <xref ref-type="table" rid="table1">Table 1</xref>. Total RNA was extracted from the stomach of H. japonicus and D. kwangtungensis using RNA extraction reagent (ISOGEN, Nippon Gene, Tokyo, Japan), in accordance with the manufacturer’s instructions. The total RNA concentration and purity were measured using ultraviolet and visible spectrophotometry. cDNA was synthesized from 1.0 μg total RNA using a primer for reverse transcription (oligo dT) and cDNA synthesis kit (PrimeScript™ II First Strand cDNA Synthesis Kit, Takara Bio, Shiga, Japan), in accordance with the manufacturer’s instructions. The internal sequences of HjChi and DkChi were amplified using the synthesized cDNA, DNA polymerase (Go Taq&#174; Green Master Mix, Promega, Madison, USA), and degenerate primers were designed based on the conserved region of amino acid sequences of GH family 18 chitinases from several vertebrates, in accordance with the manufacturer’s instructions. The forward and reverse primers were designed from the chitinase gene sequences obtained by the internal sequence amplification, and the upstream (5') and downstream (3') regions were amplified using the rapid amplification of cDNA ends (RACE) method. The 5' and 3' RACE</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Sequence (5'-3')</th><th align="center" valign="middle" >Length</th><th align="center" valign="middle" >Usage</th></tr></thead><tr><td align="center" valign="middle" >Oligo dT</td><td align="center" valign="middle" >CTGTGAATGCTGCGACTACGATTTTTTTTTTTTTTTTTTT</td><td align="center" valign="middle" >40 mer</td><td align="center" valign="middle" >cDNA synthesis</td></tr><tr><td align="center" valign="middle" >HjChi-a</td><td align="center" valign="middle" >TGYTAYTTYACNAAYTGG</td><td align="center" valign="middle" >18 mer</td><td align="center" valign="middle" >Conserved region PCR</td></tr><tr><td align="center" valign="middle" >HjChi-b</td><td align="center" valign="middle" >GAYATHGAYTGGGARTAYCC</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HjChi-c</td><td align="center" valign="middle" >TTCCARTARTTCATNGCRTARTC</td><td align="center" valign="middle" >23 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-a</td><td align="center" valign="middle" >GYNGGNGGNTGGAAYTTYGGNAC</td><td align="center" valign="middle" >23 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-b</td><td align="center" valign="middle" >GAYTGGGARTAYCCNGG</td><td align="center" valign="middle" >17 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-c</td><td align="center" valign="middle" >AYTTCATNGCRAARTCNAC</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-d</td><td align="center" valign="middle" >TARTANGCNARRAANCCNGC</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >3'RACE</td><td align="center" valign="middle" >CTGTGAATGCTGCGACTACGAT</td><td align="center" valign="middle" >22 mer</td><td align="center" valign="middle" >3' RACE PCR</td></tr><tr><td align="center" valign="middle" >HjChi-1</td><td align="center" valign="middle" >CTGCGTCGTTATGGATTTGATGGT</td><td align="center" valign="middle" >24 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-1</td><td align="center" valign="middle" >GACAAGCATCTCTACACTG</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-2</td><td align="center" valign="middle" >TTCCTCAGCTCGGCAAGGTAGTT</td><td align="center" valign="middle" >23 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HjChi-2</td><td align="center" valign="middle" >AGMSSMRASATGGCAAAGCTT</td><td align="center" valign="middle" >21 mer</td><td align="center" valign="middle" >5' RACE PCR</td></tr><tr><td align="center" valign="middle" >HjChi-3</td><td align="center" valign="middle" >AGTCCAGGATTTGTCCAAGCTG</td><td align="center" valign="middle" >22 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >AAP</td><td align="center" valign="middle" >GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG</td><td align="center" valign="middle" >36 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >AUAP</td><td align="center" valign="middle" >GGCCACGCGTCGACTAGTACC</td><td align="center" valign="middle" >21 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-3</td><td align="center" valign="middle" >TTGCTCATCCCACCAGCAAC</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-4</td><td align="center" valign="middle" >ATCAGCTCCTGAGCCAG</td><td align="center" valign="middle" >17 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-5</td><td align="center" valign="middle" >CGAGATCCAGGATATTCCC</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-6</td><td align="center" valign="middle" >AAAGCCGTACCCTCTCAGG</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-7</td><td align="center" valign="middle" >AACTACCTTGCCGAGCTGAGG</td><td align="center" valign="middle" >21 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HjChi-4</td><td align="center" valign="middle" >AGAGGCGAGATGGCAAAGCTTCT</td><td align="center" valign="middle" >23 mer</td><td align="center" valign="middle" >Full length amplification</td></tr><tr><td align="center" valign="middle" >DkChi-8</td><td align="center" valign="middle" >CTCCTGCCCAGAACAGTAAC</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-9</td><td align="center" valign="middle" >CCCAAGACTGTGGTCAAC</td><td align="center" valign="middle" >18 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >β-actin-a</td><td align="center" valign="middle" >GAAAGACAGTTACGTTGGTG</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" >Organ expression</td></tr><tr><td align="center" valign="middle" >β-actin-b</td><td align="center" valign="middle" >AGAATCTAGCACAATGCCAG</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HjChi-5</td><td align="center" valign="middle" >TCCCAAATTCCCAAGACACT</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >HjChi-6</td><td align="center" valign="middle" >TCCAACCCATTCATTTCCAC</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-10</td><td align="center" valign="middle" >CTGCCTAATGACAAGGATTAC</td><td align="center" valign="middle" >21 mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DkChi-11</td><td align="center" valign="middle" >GCCGACCCATATTCCATTCT</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><p>analyses were performed using custom kits (5' and 3' RACE System for Rapid Amplification of cDNA Ends, Invitrogen, Carlsbad, USA) in accordance with the manufacturer’s instructions. Thefull-length chitinase genes were amplified using DNA polymerase (PrimeSTAR&#174; Max DNA Polymerase, Takara Bio), in accordance with the manufacturer’s instructions. The PCR products were electrophoresed on a 2% agarose gel and the resolved DNA was extracted using Quantum Prep&#174; Freeze ’N Squeeze spin columns (Bio Rad, Hercules, USA) and ligated into the pGEM-T Easy Vector (Promega). The base sequences were determined using the Big Dye Terminator Cycle Sequencing FS Ready Reaction Kit (Applied Biosystems, Waltham, USA) and domain prediction was performed using Inter Pro (EMBL-EBI: The European Bioinformatics Institute, European Molecular Biology Laboratory, Hinxton, England).</p></sec><sec id="s2_3"><title>2.3. Organ-Specific Gene Expression</title><p>Total RNA was extracted from the organs of H. japonicus and D. kwangtungensis. cDNA was synthesized from 1.0 μg of total RNA obtained from each organ and an oligo dT primer; 1.0 μg of the synthesized cDNA was amplified using PCR and primers for HjChi, DkChi, and fish β-actin amplification primers. The PCR parameters were 30 cycles of denaturation at 95˚C for 30 s, annealing at 53˚C for 30 s, and extension at 72˚C for 20 s.</p></sec><sec id="s2_4"><title>2.4. Chitinolytic Enzyme Activity Assay</title><p>Chitinolytic Activity was measured using p-Nitrophenyl-N-Acetyl-β-D-Gluco- saminide (pNP-GlcNAc), p-Nitrophenyl Di-N-Acetyl-β-Chitobioside (pNP- (GlcNAc)<sub>2</sub>), and p-Nitrophenyl Tri-N-Acetyl-β-Chitobioside (pNP-(GlcNAc)<sub>3</sub>) (Yaizu Suisan Kagaku Industry Co., Ltd., Shizuoka, Japan) as substrates in accordance with the method described by Ohtakara [<xref ref-type="bibr" rid="scirp.82188-ref15">15</xref>] , with slight modifications. Briefly, 2.5 μL of enzyme solution and 2.5 μL of substrate (4 mM solution) were added to 10.0 μL of 0.2 M phosphate-0.1 M citrate buffer (pH 6.0), and the solution was incubated at 37˚C for 20 min. After incubation, 65 μl of 0.2 M sodium carbonate solution was added to the solution, and the absorbance of released p- nitrophenol was measured at 420 nm. A unit of chitinolytic enzyme activity (U) was defined as the amount of enzyme that liberated 1 μmol of p-nitrophenol per minute.</p></sec><sec id="s2_5"><title>2.5. Determination of Optimal pH</title><p>When 4 mMpNP-(GlcNAc)<sub>n</sub> (n = 1 - 3) was used as a substrate, the optimal pH was determined by assaying enzyme activity. Specifically, the solution was incubated for 20 min at 37˚C in 0.2 M phosphate-0.1 M citrate buffer (pH 2.5 - 8.0) using the same technique used for the measurement of chitinolytic activity.</p></sec><sec id="s2_6"><title>2.6. Phylogenetic Analysis of HjChi and DkChi</title><p>Phylogenetic analysis based on the deduced amino acid sequences of HjChi and DkChi was performed using the chitinase genes obtained from many organisms. The analysis was performed using ClustalW2 program (EMBL-EBI: The European Bioinformatics Institute, European Molecular Biology Laboratory, Hinxton, England) and the tree view program. A bacterial chitinase (GenBank: X03657) was used as an outgroup.</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><sec id="s3_1"><title>3.1. Cloning of H. japonicas chitinase cDNA (HjChi) and D. kwangtungensis chitinase cDNA (DkChi)</title><p>Using degenerate primers designed based on the deduced amino acid sequences of several vertebrate chitinases, the internal sequences of the cDNA of the stomach of H. japonicas and D. kwangtungensis were amplified by RT-PCR and fragments of 450 bp and 400 bp were obtained, respectively. From the nucleotide sequence of the obtained fragments, upstream and downstream amplification primers were designed. Using the 5'RACE method, the upstream region of the gene fragments, 300 bp and 500 bp, were amplified and the nucleotide sequence of the start codon was included in the gene fragments. In addition, gene fragments of 1300 bp and 1000 bp were obtained by the 3'RACE method, and the analysis of the nucleotide sequence identified a stop codon and polyadenylation signals (AATAAA), each found in the 3'UTR. Based on the untranslated regions of these nucleotide sequences, the full-length primer was designed to sandwich an open reading frame (ORF) and using an enzyme with 3'→5' exonuclease activity, the full-length gene of chitinase was amplified. Based on these methods, we obtained full length chitinase genes from the stomach of both H. japonicas and D. kwangtungensis. The full-length gene of the stomach chitinase of the H. japonicas (HjChi), consisted of 1592 bp and included a 1380 bp ORF encoding 480 amino acids (<xref ref-type="fig" rid="fig1">Figure 1</xref>). For D. kwangtungensis, a 1440 bp ORF encoding 478 amino acids was included in the 1601 bp full length stomach chitinase gene (<xref ref-type="fig" rid="fig2">Figure 2</xref>). The nucleotide sequences of the full length chitinase genes were registered in DBBJ and the accession numbers were (HjChi: LC215400, DkChi: LC215399) issued. The nucleotide sequences of HjChi and DkChi were analyzed using NCBI BLAST search. The paper claims that HjChi and DkChi demonstrated approximately 70% homology with other Chondrichtyeschitinase (Rhincodon typus: XP_020390951, P. glauca: AB872008, Scyliorhinus torazame: BAU51439) and approximately 60% with Actinopterygii (Hexagrammos otakii: AB626093, Scophthalmus maximus: KY421058, Paralichthys olivaceus: AB121732). The computed pI/Mw tool was used to estimate the isoelectric point and molecular weight of the deduced amino acid sequence (HjChi and DkChi) of HjChi and DkChi, which were 8.52 and 51.6 kDa and 6.59 and 50.6 kDa, respectively. Using the same calculation method, the isoelectric point and molecular weight of chitinase of R. typus were 8.33 and 51.0 kDa (DDBJ: XM_ 020535362) and P. glauca were 8.42 and 52.0 kDa (DDBJ: AB872008) [<xref ref-type="bibr" rid="scirp.82188-ref14">14</xref>] , respectively. For P. olivaceus, Actinopterygii, the isoelectric points and molecular weights of the chitinase varieties were 6.31, 52.6 kDa (fChi1); 5.39, 53.2 kDa (fChi2); and 6.52, 53.1 kDa (fChi3), respectively. These results identified similar molecular weights of the chitinases of Chondrichthyes and Actinopterygii and the differing chitinase of the shark species, which tended to have a higher isoelectric point.</p><p>A comparison of the deduced amino acid sequences of several varieties of</p><p>previously reported chitinase from P. olivaceus (DDBJ: AB121732, AB121733, AB121734) [<xref ref-type="bibr" rid="scirp.82188-ref16">16</xref>] , Homo sapiens (DDBJ: AF290004, U29615) [<xref ref-type="bibr" rid="scirp.82188-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.82188-ref17">17</xref>] , and Mus musculus (DDBJ: EF094027, AY458654) [<xref ref-type="bibr" rid="scirp.82188-ref18">18</xref>] is shown in <xref ref-type="fig" rid="fig3">Figure 3</xref>. Based on the domain prediction, beginning at the N-terminal side, all sequences were composed of a signal peptide, a catalytic domain, a linker region, and a chitin-bind- ing domain. The domain structure predicted from the deduced amino acid sequence was a common structure in vertebrate chitinases [<xref ref-type="bibr" rid="scirp.82188-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.82188-ref20">20</xref>] . The (DXXDXDXE) array, a conserved sequence within the active site of the GH family18 chitinases [<xref ref-type="bibr" rid="scirp.82188-ref21">21</xref>] , was identified in the active site of the catalytic domain and was thought to possess chitin-degrading activity. The linker region of HjChi and DkChi was rich in glycine, and a distance between the catalytic domain and the chitin-binding domain was observed. The flexible, glycine-rich amino acid linker region allows for the flexibility in determining the appropriate distances between domains, which enabled the full demonstration of domain function [<xref ref-type="bibr" rid="scirp.82188-ref22">22</xref>] . Therefore, based on enzymatic degradation, it was inferred that HjChi and DkChi possessed a rational structure. In contrast, a different scenario was predicted for the linker regions of AMCase [<xref ref-type="bibr" rid="scirp.82188-ref8">8</xref>] , fChi1, and fChi2 [<xref ref-type="bibr" rid="scirp.82188-ref16">16</xref>] , in which serine-containing repetitive sequences are present in addition to glycine.</p></sec><sec id="s3_2"><title>3.2. Organ-Specific Gene Expression</title><p>Organ-specific expression analysis of HjChi and DkChi chitinase genes from the stomach, intestines, liver, kidney, spleen, and gonads of H. japonicas and D. kwangtungensis was performed (<xref ref-type="fig" rid="fig4">Figure 4</xref>). HjChi was expressed only in the stomach of H. japonicas. This was similar to the observed expression conditions of digestion-related genes, classified as AFCase-1 and AFCase-2 in the stomach of Actinopterygii [<xref ref-type="bibr" rid="scirp.82188-ref16">16</xref>] . However, their expression in D. kwangtungensis displayed a similar profile to that of P. glauca [<xref ref-type="bibr" rid="scirp.82188-ref14">14</xref>] and Latimeria chalumnae [<xref ref-type="bibr" rid="scirp.82188-ref23">23</xref>] , with expression in all organs, including metabolic and detoxification organs such as the liver and kidney, hematopoietic organs such as the spleen, and hormone-secreting organs (endocrine organs) such as the gonads. The expression conditions of DkChi were similar to that of FCase-3 obtained from the kidney and expressed in various parts of the body of Sebastiscus marmoratus. These results suggested that, similar to fish chitinase classified as AFCase-1 and AFCase-2, HjChi is mainly responsible for the digestion of food H. japonicas. In D. kwangtungensis, DkChi was responsible not only for digestion, but is also involved in the metabolism of chitin oligosaccharides in the liver and kidney, and the possible role</p><p>of biological defense is also suggested in the spleen and gonads for one variety of chitinase.</p></sec><sec id="s3_3"><title>3.3. Distribution of Chitinolytic Enzyme Activity</title><p>The distribution of chitinolytic enzyme activity in H. japonicas and D. kwangtungensis was investigated using pNP-(GlcNAc)<sub>n</sub> (n = 2, 3) as a substrate for the measurement of chitinase activity (<xref ref-type="fig" rid="fig5">Figure 5</xref>(a), <xref ref-type="fig" rid="fig5">Figure 5</xref>(c)). The highest activity for pNP-(GlcNAc)<sub>3</sub> was observed in the gonads, followed by the stomach and spleen in H. japonicas. However, with the substrate pNP-(GlcNAc)<sub>2</sub>, the activity</p><p>was remarkably low in all organs. Similarly, in D. kwangtungensis, the highest activity for the substrate pNP-(GlcNAc)<sub>n</sub> (n = 2, 3) was observed in the stomach and minimal activity against pNP-(GlcNAc)<sub>2</sub> was also detected in the liver. In H. japonicas, the activity of pNP-(GlcNAc)<sub>3</sub> was higher than pNP-(GlcNAc)<sub>2</sub> in almost all organs, and the chitinase displayed a similar degradation pattern to the chitinase encoded by the gene AFCase-2 [<xref ref-type="bibr" rid="scirp.82188-ref6">6</xref>] . In addition, chitinase activity observed in the stomach of the D. kwangtungensis was similar to that at the degradation site of the chitinase coded by the gene classified as an AFCase-1 [<xref ref-type="bibr" rid="scirp.82188-ref6">6</xref>] . Chitinase activity is present in the lymphomyeloid tissue of the Chimaera monstrosa, in the esophagus and lymphomyeloidepigonal organs of Etmopterus spinax and Raja pulchra [<xref ref-type="bibr" rid="scirp.82188-ref13">13</xref>] , and in the stomach, liver, and spleen of Mustelus manazo [<xref ref-type="bibr" rid="scirp.82188-ref24">24</xref>] . These findings indicated that chitinase was found in most rays and sharks, where it participates in physiological roles. Organ expression analysis identified HjChi only in the stomach and chitinase activity in H. japonicas was thought to be a result of the chitinase encoded by HjChi. Further, chitinase activity in the spleen and gonads is thought to be a result of chitinase encoded by a gene other than HjChi. In contrast, DkChi was expressed in all organs of D. kwangtungensis, but chitinase activity was observed only in the stomach, and based on the feeding status of the three samples used in the current study, the possibility of adjustment for expression confined to the stomach exists. Conversely, Hex activity, which was measured using pNP-GlcNAc as the substrate, was detected in all organs, similar to previous reports [<xref ref-type="bibr" rid="scirp.82188-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.82188-ref12">12</xref>] , with high values in the intestine, spleen, and gonads, and low values in the stomach, liver, kidney of H. japonicas, whereas in D. kwangtungensis, higher activity was found in the liver, kidney, spleen, and gonads and lower activity in the stomach and intestine (<xref ref-type="fig" rid="fig5">Figure 5</xref>(b), <xref ref-type="fig" rid="fig5">Figure 5</xref>(d)).</p></sec><sec id="s3_4"><title>3.4. Determination of Optimal pH</title><p>The effect of pH on chitinolytic activity was determind in the stomach of the H. japonicus and D. kwangtungensis using pNP-(GlcNAc)<sub>n</sub> (n = 2, 3) as substrate (<xref ref-type="fig" rid="fig6">Figure 6</xref>(a), <xref ref-type="fig" rid="fig6">Figure 6</xref>(c)). Optimal values of pH 5.5 and 5.0 for pNP-(GlcNAc)<sub>2</sub> and pNP-(GlcNAc)<sub>3</sub>, respectively, were observed in H. japonicas; for the same substrates in D. kwangtungensis, pH 4.0 and 3.5 were the optimal values, respectively. For both substrates, the relative activity in the stomach of H. japonicas and the D. kwangtungensis decreased to 50% or less of the maximal activity from pH 6.0 - 6.5 to basic pH values. Further, in the investigation of the effect of pH on Hex activity, pNP-GlcNAc was used as the substrate, and the optimal pH for Hex activity was pH 4.0 in H. japonicas and D. kwangtungensis (<xref ref-type="fig" rid="fig6">Figure 6</xref>(b), <xref ref-type="fig" rid="fig6">Figure 6</xref>(d)). The aforementioned results suggested that the optimal pH of stomach chitinase of H. japonicas and D. kwangtungensis was similar to that reported for the stomach of Actinopterygii [<xref ref-type="bibr" rid="scirp.82188-ref6">6</xref>] , and that it may be involved in feeding and digestion, based on the acidic environment because of the stomach acid.</p></sec><sec id="s3_5"><title>3.5. Phylogenetic Analysis of HjChi and DkChi</title><p>In order to determine the systematic position of the chitinases of Chondrichthyes, HjChi and DkChi, discovered in this study, and that of other fish chitinases, we performed phylogenetic analysis based on the homology of the deduced amino acid sequence of family 18 chitinases of other organisms (<xref ref-type="fig" rid="fig7">Figure 7</xref>). The accession number and the names of all organisms included in the phylogenetic tree are shown in <xref ref-type="fig" rid="fig7">Figure 7</xref>. The results indicated that, similar to previous reports [<xref ref-type="bibr" rid="scirp.82188-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.82188-ref12">12</xref>] , the chitinases expressed in mammalian stomach were classified as members of the AMCase [<xref ref-type="bibr" rid="scirp.82188-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.82188-ref25">25</xref>] , chitinases produced by mammalian macrophages were classified as members of the chitotriosidases [<xref ref-type="bibr" rid="scirp.82188-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.82188-ref18">18</xref>] , stomach chitinases of Actinopterygii were classified as members of the AFCase-1 and AFCase-2 [<xref ref-type="bibr" rid="scirp.82188-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.82188-ref16">16</xref>] , chitinases from the kidney of Actinopterygii were classified as members of the FCase-3 [<xref ref-type="bibr" rid="scirp.82188-ref12">12</xref>] ; however, HjChi and DkChi were not classified as members of any of the aforementioned groups. In addition, L. chalumnae (Sarcopterygii) [<xref ref-type="bibr" rid="scirp.82188-ref23">23</xref>] , Protopterus aethiopicus (LC350289), and Lethenteron japonicum (Cyclostomata) (EU741679) did not belong to these groups. A new group was created to classify Chondrichthyes in which HjChi and DkChi were detected, including R. typus (XM_020535362), P. glauca (AB872008) [<xref ref-type="bibr" rid="scirp.82188-ref14">14</xref>] ,</p><p>Dasyatis akajei (LC350288), Triakis scyllium (LC350287), M. manazo (LC085613), and S. torazame. The chitinases of Chondrichthyes group were identified to be similar to stomach chitinases and were more similar to the chitinases produced mainly within the stomach, such as AMCase, AFCase-1, and AFCase-2, more than the mammalian macrophage-produced chitotriosidase and the Actinopterygii produced FCase-3, and was particularly similar to the AFCase-2. Further, as in this study, the chitinases of Chondrichthyes were placed in the same group, whether of shark or ray origin; thus, we named the four chitinases obtained from sharks and rays as Chondrichthyes chitinase. These results indicated that fish possess chitinases with different functions and structures because of adaptation and that this was dependent on the feeding habitat and environment. Consequently, each chitinase group was formed based on a network classification by phylogenetic analysis.</p></sec></sec><sec id="s4"><title>4. Conclusion</title><p>Novel chitinase genes were obtained from the stomach of H. japonicas, HjChi (ORF: 1380 bp) and the stomach of D. kwangtungensis, DkChi (ORF: 1440 bp). Although the amino acid sequence of the linker region was unique, the domain structure predicted from the deduced amino acid sequence was a common structure in vertebrate chitinases. Organ-specific analysis identified the expression of HjChi occurred mainly in the stomach of H. japonicas, which indicated a primary role in the digestion of food, whereas DkChi was expressed in all organs of D. kwangtungensis, which was suggestive of a variety of physiological roles. Moreover, chitinase activity against pNP-(GlcNAc)<sub>3</sub> was comparatively high in the stomach, spleen, and gonads, whereas chitinase activity against pNP- (GlcNAc)<sub>2</sub> was substantially lower in all organs. In contrast, a very high value was obtained for chitinase activity against pNP-(GlcNAc)<sub>n</sub> (n = 2, 3) in the stomach of D. kwangtungensis. Hex activity was widely observed throughout the body of both species of fish. In addition, the optimal pH of the stomach chitinase of both H. japonicas and D. kwangtungensis was similar to that reported for the stomach chitinase of Actinopterygii. Based on our phylogenetic analysis, HjChi and DkChi do not belong to previously reported groups; thus, a new group, Chondrichthyes chitinase, was established owing to the similarities with AMCase, AFCase-1, and AFCase-2, which are mainly expressed in the stomach, unlike chitotriosidase and FCase-3. These results suggested the existence of class- specific chitinase in the fish kingdom. Hence, it was possible to classify chitinase groups, along with the application of phylogenetic analysis. Our studies are expected to lead to efficient chitin degradation and production of chitin oligosaccharides of specific chain length by obtaining knowledge of chitinase of various properties of fish kingdom. In addition, we are going to try expression of protein in future.</p></sec><sec id="s5"><title>Acknowledgements</title><p>This work was supported in part by College of Bioresource Science, Nihon University Grant (2017).</p></sec><sec id="s6"><title>Cite this paper</title><p>Watanabe, M., Kakizaki, H., Kanai, M., Kawashima, S., Hamaguchi, K., Mizuno, H., Ueno, T., Yasukawa, C., Agata, R., Ikeda, M., Fukushima, H., Ueda, M. and Matsumiya, M. (2018) Chondrichthyes Chitinase: Molecular Cloning, Distribution, and Phylogenetic Analysis. Open Journal of Marine Science, 8, 136-151. https://doi.org/10.4236/ojms.2018.81007</p></sec></body><back><ref-list><title>References</title><ref id="scirp.82188-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Rovertus, J.D. and Monzingo, F.A. (1999) The Structure and Action of Chitinases. EXS, 87, 125-135.</mixed-citation></ref><ref id="scirp.82188-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Slámová, K., Bojarová, P., Petrásková, L. and Kren, V. (2010) β-N-Acetylhexosami- nidase: What’s in a Name…? Biotechnology Advances, 28, 682-693.  
https://doi.org/10.1016/j.biotechadv.2010.04.004</mixed-citation></ref><ref id="scirp.82188-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Muzzarelli, R.A.A. (1977) Chitin. Pergamon Press, Oxford.</mixed-citation></ref><ref id="scirp.82188-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Mei, Y.X., Chen, H.X., Zhang, J., Zhang, X.D. and Liang, Y.X. (2013) Protective Effect of Chitooligosaccharides against Cyclophosphamide-Induced Immunosuppression in Mice. International Journal of Biological Macromolecules, 62, 330-335.  
https://doi.org/10.1016/j.ijbiomac.2013.09.038</mixed-citation></ref><ref id="scirp.82188-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Muzzarelli, R.A.A., Boudrant, J., Meyer, D., Manno, N., Demarchis, M. and Paoletti, M.G. (2012) Current Views on Fungal Chitin/Chitosan, Human Chitinases, Food Preservation, Glucans, Pectins and Inulin: A Tribute to Henribraconnot, Precursor of the Carbohydrate Polymers Science, on the Chitin Bicentennial. Carbohydrate Polymers, 87, 995-1012. https://doi.org/10.1016/j.carbpol.2011.09.063</mixed-citation></ref><ref id="scirp.82188-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Ikeda, M., Kakizaki, H. and Matsumiya, M. (2017) Biochemistry of Fish Stomach Chitinase. International Journal of Biological Macromolecules, 104, 1672-1681.  
https://doi.org/10.1016/j.ijbiomac.2017.03.118</mixed-citation></ref><ref id="scirp.82188-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Ahmed, N.U., Park, J.I., Jung, H.J., Kang, K.K., Hur, Y., Lim, Y.P. and Nou, I.S. (2012) Molecular Characterization of Stress Resistance-Related Chitinase Genes of Brassica rapa. Plant Physiology and Biochemistry, 58, 106-115.  
https://doi.org/10.1016/j.plaphy.2012.06.015</mixed-citation></ref><ref id="scirp.82188-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Boot, R.G., Blommaart, E.F.C., Swart, E., Vlugt, K.G.V.D., Bijl, N., Moe, C., Place, A. and Aerts, J.M.F.G. (2001) Identification of a Novel Acidic Mammalian Chitinase Distinct from Chitotriosidase. The Journal of Biological Chemistry, 276, 6770-6778. &lt;br /&gt;https://doi.org/10.1074/jbc.M009886200</mixed-citation></ref><ref id="scirp.82188-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Arakane, Y. and Muthukrishnan, S. (2010) Insect Chitinase and Chitinase-Like Proteins. Cellular and Molecular Life Sciences, 67, 201-216.  
https://doi.org/10.1007/s00018-009-0161-9</mixed-citation></ref><ref id="scirp.82188-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Gooday, G.W. (1999) Aggressive and Defensive Roles for Chitinases. EXS, 87, 157-169. https://doi.org/10.1007/978-3-0348-8757-1_11</mixed-citation></ref><ref id="scirp.82188-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Kakizaki, H., Ikeda, M., Fukushima, H. and Matsumiya, M. (2015) Distribution of Chitinolytic Enzymes in the Organs and cDNA Cloning of Chitinase Isozymes from the Stomach of Two Species of Fish, Chub Mackerel (Scomber japonicus) and Silver Croaker (Pennahiaargentata). Open Journal of Marine Science, 5, 398-411.  
https://doi.org/10.4236/ojms.2015.54032</mixed-citation></ref><ref id="scirp.82188-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">SmChi-3 (Submitted to Advances in Bioscience and Biotechnology).</mixed-citation></ref><ref id="scirp.82188-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Fange, R., Lundblad, G. and Lind, J. (1976) Lysozyme and Chitinase in Blood and Lymphomyeloid Tissues of Marine Fish. Marine Biology, 36, 277-282.  
https://doi.org/10.1007/BF00389289</mixed-citation></ref><ref id="scirp.82188-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Suzuki, T., Kakizaki, H., Ikeda, M. and Matsumiya, M. (2014) Molecular Cloning of a Novel Chitinase Gene from Blue Shark (Prionace glauca; Chondrichthyes) Stomach. Journal of Chitin and Chitosan Science, 2, 143-148.  
https://doi.org/10.1166/jcc.2014.1050</mixed-citation></ref><ref id="scirp.82188-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Ohtakara, A. (1988) Chitinase and β-N-acetylhexosaminidase from Pycnoporus cinnabarinus. Biomass, Part B: Lignin, Pectin, and Chitin, 161, 462-470.  
https://doi.org/10.1016/0076-6879(88)61059-7</mixed-citation></ref><ref id="scirp.82188-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Kurokawa, T., Tuji, S. and Suzuki, T. (2004) Molecular Cloning of Multiple Chitinase Genes in Japanese Flounder, Paralichthys olivaceus. Comparative Biochemistry and Physiology—Part B: Biochemistry &amp; Molecular Biology, 138, 255-268.  
https://doi.org/10.1016/j.cbpc.2004.03.015</mixed-citation></ref><ref id="scirp.82188-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Boot, R.G., Renkema, H., Strijland, A., Zonneveld, A.J.V. and Aerts, J.M.F.G. (1995) Cloning of a cDNA Encoding Chitotriosidase, a Human Chitinase Produced by Macrophages. The Journal of Biological Chemistry, 270, 26252-26256.  
https://doi.org/10.1074/jbc.270.44.26252</mixed-citation></ref><ref id="scirp.82188-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Zheng, T., Rabach, M., Chen, N.Y., Rabach, L., Hu, X., Elias, J.A. and Zhu, Z. (2005) Molecular Cloning and Functional Characterization of Mouse Chitotriosidase. Gene, 29, 37-46. https://doi.org/10.1016/j.gene.2005.05.006</mixed-citation></ref><ref id="scirp.82188-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Adrangi, S. and Faramarzi, M.A. (2013) From Bacteria to Human: A Journey into the World of Chitinases. Biotechnology Advances, 31, 1786-1795.  
https://doi.org/10.1016/j.biotechadv.2013.09.012</mixed-citation></ref><ref id="scirp.82188-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Reguera, G. and Leschine, S.B. (2003) Biochemical and Genetic Characterization of ChiA, the Major Enzyme Component for the Solubilization of Chitin by Cellulomonas uda. Archives of Microbiology, 180, 434-443.  
https://doi.org/10.1007/s00203-003-0611-y</mixed-citation></ref><ref id="scirp.82188-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">van Aalten, D.M., Synstad, B., Brurberg, M.B., Hough, E., Riise, B.W., Eijsink, V.G. and Wierenga, R.K. (2000) Structure of a Two-Domain Chitotriosidase from Serratia marcescens at 1.9-A Resolution. Proceedings of the National Academy of Sciences, 97, 5842-5847. https://doi.org/10.1073/pnas.97.11.5842</mixed-citation></ref><ref id="scirp.82188-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Gilkes, N.R., Henrissat, B., Kilburn, D.G., Miller, R.C. and Warren, R.A. (1991) Domains in Microbial Beta-1,4-glycanases: Sequence Conservation, Function, and Enzyme Families. Archive of Microbiological Reviews, 55, 303-315.</mixed-citation></ref><ref id="scirp.82188-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Kakizaki, H., Hamaguchi, K., Ikeda, M. and Matsumiya, M. (2014) Cloning of a Novel Chitinase cDNA from the Stomach of the Coelacanth Latimeria chalumnae (sarcopterygii). Journal of Chitin and Chitosan Science, 2, 123-129.  
https://doi.org/10.1166/jcc.2014.1051</mixed-citation></ref><ref id="scirp.82188-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Okutani, K. and Kiniata, M. (1964) Studies on Chitinolytic Enzyme Present in Aquaic Animals-III. Distribution of Chitinase in Digestive Organs of a Few Kinds of Aquatic Animals. The Japanese Society of Fisheries Science, 30, 574-576.</mixed-citation></ref><ref id="scirp.82188-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Chen, X.H., Xie, Z.H., Sun, S.J. and Cai, G. (2006) Cloning of a Rat Lung Fibrogenic Factor. Gene, 384, 9-17. https://doi.org/10.1016/j.gene.2006.06.026</mixed-citation></ref></ref-list></back></article>